Kit for detecting cytokines based on flow fluorescence method and application of kit
By developing a flow cytometry-based kit to optimize the cytokine antibody sequence and prepare recombinant antibodies, the problems of low detection complexity, accuracy and sensitivity in the prior art are solved, and the simultaneous accurate detection of 12 cytokines and dual detection of serum and plasma samples are achieved, which improves the auxiliary nature of disease diagnosis and treatment.
Patent Information
- Application Number
- CN202410116376.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-04
- Publication Date
- 2025-06-13
AI Technical Summary
The prior art is complex in detecting cytokines, has low accuracy, low sensitivity, and cannot detect serum samples and plasma samples at the same time, affecting the auxiliary diagnosis and treatment of diseases.
A flow cytometry-based kit was developed to prepare recombinant antibodies by screening and optimizing the antibody sequences of 12 cytokines, realizing the detection process of one incubation and one washing, improving the accuracy and sensitivity of the detection.
It realizes accurate detection of 12 cytokines, improves the accuracy and sensitivity of the detection, and can detect serum samples and plasma samples at the same time, helping to comprehensively evaluate the patient's immune function status.
Smart Images

Figure CN120142664A_ABST
Abstract
Description
[0001] This application is a divisional application of the parent case 2023116456884. Technical Field
[0002] The present invention relates to the field of flow cytometry technology, and specifically relates to a kit for detecting cytokines based on flow fluorescence method and its application. Background Art
[0003] Cytokines are a class of small-molecule proteins with a wide range of biological activities, synthesized and secreted by immune cells and certain non-immune cells upon stimulation. Cytokines can be classified into interleukins, interferons, tumor necrosis factor superfamily, colony-stimulating factors, chemokines, growth factors, etc. The secretion of cytokines will change under pathological conditions, such as various infectious diseases, etc. The detection of cytokines provides a scientific auxiliary basis for the prevention, diagnosis, and treatment of diseases clinically.
[0004] Helper T cells (Th) are one of the subsets of T cells, usually referring to a subset of T cells with the ability to assist humoral and cellular immune responses. According to the different cytokines secreted, Th cells can be divided into cell subsets such as Th1 and Th2. Currently, the cells that secrete cytokines studied more are Th1 and Th2 cells. Th1 cells mainly secrete pro-inflammatory cytokines IFN-γ, IL-2, and TNF-α, which are beneficial for B cells to produce opsonizing antibodies (IL-2, IL-4, IL-6, IL-10, TNF-α, IFN-γ, IgA) and antibodies that bind to complement (IgM, IL-2, IL-4, IL-6, IL-10, TNF-α, IFN-γ), and can stimulate macrophages, NK cells, CD8+ cytotoxic T cells to fight intracellular pathogens, causing T lymphocyte-mediated cytotoxicity and cellular immunity. The immune response dominated by Th1 mainly causes inflammation dependent on phagocytes. In addition, the Th1 response participates in tumor clearance by activating CD8+ cytotoxic T lymphocytes. Th2 cells mainly secrete IL-4, IL-6, and IL-10, which cause a strong antibody response (including IgE), promote the differentiation and activation of eosinophils, and produce an inflammation independent of phagocytes. Th2 cells participate in the defense against extracellular parasites (such as worms) and stimulate the humoral response (through B cells). Under pathological conditions, these cells are responsible for several inflammations, such as allergic reactions, asthma, atopic dermatitis, etc. Th1 cells can secrete IFN-γ but not IL-4, and Th2 cells can secrete IL-4 but not IFN-γ. Usually, these two cytokines are used as markers to distinguish Th1 and Th2. Measuring the regulation of Th1 and Th2 cells is crucial for maintaining the normal immune function of the body. The imbalance between Th1 and Th2 is closely related to the occurrence and development of autoimmune diseases, allergic diseases, tumors, transplant rejection reactions, and infectious diseases.
[0005] Factors such as IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-17, IFN-γ, TNF-α, and IFN-α are common cellular inflammatory factors in human immunity and play important roles in human immune regulation. For example, IL-1β, IL-6, and TNF-α play roles in osteoarthritis, coronary atherosclerotic syndrome, and cerebral infarction. IL-2, IL-4, IL-5, IL-6, IL-10, IFN-γ, etc. are secreted by helper T cells Th1 and Th2 cells and participate in regulating the dynamic balance of the functions of Th1 and Th2 cells, maintaining the normal cellular immunity and humoral immunity functions of the body. When the body is attacked by foreign antigens and the immune function balance of the body changes, the function of one subset of Th1 and Th2 cells increases, and the function of the other subset decreases. Therefore, the concentrations of various cytokines secreted by Th1 and Th2 will also change correspondingly. Among the six members of the IL-17 family, IL-17A is the prototype of IL-17. IL-17A binds to receptors, induces pro-inflammatory cells to secrete chemokines or cytokines, participates in tissue remodeling, and participates in the acute-phase response. Furthermore, it participates in various diseases of the body. IL-17A is mainly involved in the occurrence of innate immunity and certain inflammations. IL-17A has the unique feature of strongly recruiting neutrophils and the role of promoting the release of various cytokines and participates in the occurrence of various inflammatory diseases in the body. It has strong pro-inflammatory properties and is a fine-tuning factor for the inflammatory response. It can promote the local production of chemokines in the body, such as IL-8, monocyte chemoattractant protein (MCP-1), and growth regulatory factor-α, resulting in a rapid increase in monocytes and neutrophils. It can stimulate the production of IL-6 and prostaglandin-2 and enhance local inflammation. The expression levels of IL-8, IL-12p70, IFN-α, etc. are significantly increased in the sera of patients with viral infections and condyloma acuminata.
[0006] The multiplex protein quantitative detection of flow cytometry technology is a liquid-phase protein detection technology that combines the advantages of ELISA and flow cytometry technology. It integrates functions such as immunomicrospheres, laser detection, signal processing, and computer operation, and can qualitatively and quantitatively detect multiple indicators in a sample.
[0007] Currently, the kits for detecting cytokines such as IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-17A, IFN-γ, TNF-α, and IFN-α on the market have relatively complex operations, require multiple incubations and washings, have low accuracy and sensitivity, cannot detect many positive cases, and are time-consuming, which is not conducive to the detection of rare samples.
[0008] The patent with publication number CN115015561A provides a method for simultaneously detecting twelve cytokines by a flow cytometer. In its detection process, signals must be amplified by biotin, and the incubation process requires multiple incubations and multiple vortex oscillations, which is very cumbersome.
[0009] The patent with publication number CN114636824A provides a kit for jointly detecting cytokines and immune cells in perinatal umbilical cord blood and its usage method. Similarly, it requires multiple incubations, multiple vortexes, and multiple washings. The cumbersome pretreatment process is likely to introduce other impurities, which will inevitably affect the accuracy and batch-to-batch repeatability of the detection results.
[0010] In addition, the methods for detecting twelve cytokines provided by the prior art can only detect serum samples and cannot achieve precise detection of both serum samples and plasma samples simultaneously, which imposes more restrictions on sample collection.
[0011] Therefore, it is necessary to provide a new kit for jointly detecting cytokines, its preparation method, and usage method to solve the above problems existing in the prior art. Summary of the Invention
[0012] Aiming at the problems existing in the prior art, the present invention provides a kit and method for simultaneously detecting 12 cytokines based on a flow cytometer. For the 12 cytokines, the antibody 1 sequences and antibody 2 sequences of the 12 cytokines are respectively screened and optimized, and recombinant antibodies are prepared by expression in a eukaryotic cell expression system. Among them, antibody 1 is used to prepare an antibody solution for coupling microspheres, and antibody 2 is used to prepare a fluorescently labeled antibody solution. And for the most difficult-to-detect IL-17A antibody sequence, multiple mutation screening and heavy chain (H chain) and light chain (L chain) combination pairing screening are carried out to obtain the most preferred IL-17A antibody 1 and IL-17A antibody 2 sequences. The prepared kit can simultaneously detect 12 cytokines by a flow cytometer. The detection process only requires one incubation and one washing, and can improve the accuracy and sensitivity of the detection, control the batch-to-batch difference, achieve precise detection of both serum samples and plasma samples, help comprehensively evaluate the immune function status of patients, comprehensively judge the immune state of the body, and provide important references for the auxiliary diagnosis, guiding medication, monitoring the curative effect, and prognosis of diseases.
[0013] Existing antibodies for cytokine detection are basically prepared by using the traditional lymphocyte hybridoma technology. Monoclonal antibodies produced by hybridoma cells can specifically recognize cytokines in human blood, but there are the following three problems: 1. The yield of monoclonal antibodies secreted by hybridoma cells gradually decreases with the increase of cell passage times, and ultimately may result in the loss of cell lines; 2. There are batch-to-batch differences in the prepared monoclonal antibodies, which affects the accuracy of detection results; 3. Monoclonal antibodies secreted by traditional hybridoma cells have complete mouse antibody sequences, and when used to detect cytokines in human blood, they may have non-specific reactions with components in human blood, interfering with the accuracy and sensitivity of detection results and further affecting medical diagnosis results.
[0014] In addition, existing cytokine detection kits require multiple incubations and washings during the pretreatment process, with low accuracy and sensitivity. Many positive cases cannot be detected, and it takes a long time, which is not conducive to the detection of rare samples. At the same time, they can only detect one kind of plasma or one kind of serum sample, and it is difficult to achieve precise detection of both serum samples and plasma samples simultaneously.
[0015] Therefore, the present invention attempts to prepare humanized recombinant antibodies against 12 cytokines. The sequences of the recombinant antibodies are composed of the variable region sequences of mouse monoclonal antibodies and the constant region sequences of human antibody IgG1, which not only retains the specific antigen recognition ability of mouse monoclonal antibodies but also avoids false positive detection results caused by non-specific reactions with components in human serum or plasma, improving the accuracy and sensitivity of detection.
[0016] The present invention replaces the original H-chain and L-chain signal peptide sequences of the antibody with the screened and optimized H-chain and L-chain signal peptide sequences and connects them with the variable region sequences. The nucleotide sequences of the H-chain and L-chain encoding the antibody pair are codon-optimized, the DNA sequences are synthesized, and the pcDNA3.4 recombinant vector is constructed. The plasmids containing the target DNA encoding the H-chain and L-chain of the antibody are transfected into Expi293F cells for expression, and the culture medium supernatant is collected. The recombinant antibody is obtained by purification through Protein A medium. The constant region of human antibody IgG1 has a stronger binding ability with the Protein A medium of the purified antibody, improving the efficiency of purifying the antibody.
[0017] On the one hand, the present invention provides a kit for detecting 12 cytokines based on a flow cytometer, and the kit includes: an antibody solution conjugated with microspheres, a fluorescently labeled antibody solution, a microsphere buffer, and a washing buffer; the antibodies include any one or more of an IL-1β antibody, an IL-2 antibody, an IL-4 antibody, an IL-5 antibody, an IL-6 antibody, an IL-8 antibody, an IL-10 antibody, an IL-12p70 antibody, an IL-17A antibody, an IFN-γ antibody, a TNF-α antibody, and an IFN-α antibody.
[0018] Further, the antibody conjugated with microspheres is antibody 1, and the fluorescently labeled antibody is antibody 2; antibody 1 includes any one or more of an IL-1β antibody 1, an IL-2 antibody 1, an IL-4 antibody 1, an IL-5 antibody 1, an IL-6 antibody 1, an IL-8 antibody 1, an IL-10 antibody 1, an IL-12p70 antibody 1, an IL-17A antibody 1, an IFN-γ antibody 1, a TNF-α antibody 1, and an IFN-α antibody 1; antibody 2 includes any one or more of an IL-1β antibody 2, an IL-2 antibody 2, an IL-4 antibody 2, an IL-5 antibody 2, an IL-6 antibody 2, an IL-8 antibody 2, an IL-10 antibody 2, an IL-12p70 antibody 2, an IL-17A antibody 2, an IFN-γ antibody 2, a TNF-α antibody 2, and an IFN-α antibody 2.
[0019] For the antibody solution conjugated with microspheres and the fluorescently labeled antibody solution in the kit, antibodies are required. Research has shown that using different antibodies for the antibody conjugated with microspheres and the fluorescently labeled antibody, and selecting a more suitable antibody combination can significantly improve the detection sensitivity and accuracy of the 12 cytokines, and the entire detection process only requires one incubation and one washing.
[0020] Further, the amino acid sequence of the CDR3 region of the heavy chain of the IL-17A antibody 1 is as shown in Seq ID NO: 193, and the amino acid sequence of the CDR3 region of the light chain is as shown in Seq ID NO: 223; the amino acid sequence of the CDR3 region of the heavy chain of the IL-17A antibody 2 is as shown in Seq ID NO: 263, and the amino acid sequence of the CDR3 region of the light chain is as shown in Seq ID NO: 279.
[0021] Further, the heavy chain of the IL-17A antibody 1 has the amino acid sequence as shown in Seq ID NO: 116, the light chain has the amino acid sequence as shown in Seq ID NO: 117, the heavy chain of the IL-17A antibody 2 has the amino acid sequence as shown in Seq ID NO: 118, and the light chain has the amino acid sequence as shown in Seq ID NO: 119.
[0022] Among the 12 cytokines, IL-17A is the most difficult to detect. The reason may be that the affinity of the IL-17A antibody secreted by hybridoma cells is relatively low. Therefore, during the co-detection of the 12 cytokines, the detection sensitivity of the IL-17A antigen is likely to be lower than that of other antigens.
[0023] The present invention optimizes the variable region sequence of the IL-17A antibody, changes the amino acid sequence of the IL-17A antibody, improves the affinity of the IL-17A antibody, prevents non-specific binding during detection, and effectively improves the sensitivity and accuracy of quantitatively detecting the IL-17A antigen.
[0024] The present invention designs multiple single or multiple amino acid mutations for the heavy and light chains of IL-17A antibody 1 and IL-17A antibody 2, and then through combination and pairing, selects the most suitable pairing sequence for preparing antibody 1 and the most suitable pairing sequence for preparing antibody 2.
[0025] Except for the IL-17A antibody, the amino acid sequences of the variable regions of the other 11 cytokine antibodies have not changed compared to the monoclonal antibodies obtained by immunizing animals. However, the present invention replaces the constant region of the original antibody sequence with the corresponding sequence of the human antibody to form a recombinant chimeric antibody. Thus, when the 12 cytokine antibodies 1 and 2 prepared are used for detection, non-specific binding can be eliminated, cross-interference can be prevented, batch-to-batch variation can be reduced, and repeatability can be improved. The reason is that the encoded antibodies provided by the present invention are not likely to have non-specific reactions with the components in human serum or plasma, thereby enabling the detection results of the 12 cytokines to be more accurate.
[0026] Furthermore, the nucleotide sequences encoding the light and heavy chains of the antibody 1 and antibody 2 are shown in Table 1:
[0027] Table 1. Nucleotide sequences encoding the light and heavy chains of antibody 1 and antibody 2
[0028] Antibody Heavy chain sequence Light chain sequence Antibody Heavy chain sequence Light chain sequence IL-1β antibody 1 Seq ID NO:1 Seq ID NO:2 IL-1β antibody 2 Seq ID NO:3 Seq ID NO:4 IL-2 antibody 1 Seq ID NO:5 Seq ID NO:6 IL-2 antibody 2 Seq ID NO:7 Seq ID NO:8 IL-4 antibody 1 Seq ID NO:9 Seq ID NO:10 IL-4 antibody 2 Seq ID NO:11 Seq ID NO:12 IL-5 antibody 1 Seq ID NO:13 Seq ID NO:14 IL-5 antibody 2 Seq ID NO:15 Seq ID NO:16 IL-6 antibody 1 Seq ID NO:17 Seq ID NO:18 IL-6 antibody 2 Seq ID NO:19 Seq ID NO:20 IL-8 antibody 1 Seq ID NO:21 Seq ID NO:22 IL-8 antibody 2 Seq ID NO:23 Seq ID NO:24 IL-10 antibody 1 Seq ID NO:25 Seq ID NO:26 IL-10 antibody 2 Seq ID NO:27 Seq ID NO:28 IL-12p70 antibody 1 Seq ID NO:29 Seq ID NO:30 IL-12p70 antibody 2 Seq ID NO:31 Seq ID NO:32 IL-17A antibody 1 Seq ID NO:33 Seq ID NO:34 IL-17A antibody 2 Seq ID NO:35 Seq ID NO:36 IFN-γ antibody 1 Seq ID NO:37 Seq ID NO:38 IFN-γ antibody 2 Seq ID NO:39 Seq ID NO:40 TNF-α antibody 1 Seq ID NO:41 Seq ID NO:42 TNF-α antibody 2 Seq ID NO:43 Seq ID NO:44 IFN-α antibody 1 Seq ID NO:45 Seq ID NO:46 IFN-α antibody 2 Seq ID NO:47 Seq ID NO:48
[0029] Furthermore, the fluorescently labeled antibody solution is a phycoerythrin-labeled antibody solution; the microsphere buffer includes KH 2 PO 4 、Na 2 HPO 4 ·12H 2 O, NaCl, KCl, BSA, ProClin300, Tween-20, and PVP-k30.
[0030] Furthermore, the microsphere buffer includes 0.2 - 0.3% KH 2 PO 4(mass ratio), 3-4% Na 2 HPO 4 ·12H 2 O (mass ratio), 0.5-1.0% NaCl (mass ratio), 0.1-0.5% KCl (mass ratio), 2-4% BSA (mass ratio), 0.1-0.2% ProClin300 (volume ratio), 0.05-0.1% Tween-20 (volume ratio), and 0.1-0.3% PVP-k30 (volume ratio).
[0031] Furthermore, the washing buffer includes Tris, NaCl, BSA, ProClin300, Tween-20, and Dow Corning-1520.
[0032] Furthermore, the washing buffer includes 0.3-0.4% Tris (mass ratio), 0.8-1.2% NaCl (mass ratio), 1.5-3% BSA (mass ratio), 0.08-0.12% ProClin300 (volume ratio), 0.05-0.1% Tween-20 (volume ratio), and 0.01-0.02% Dow Corning-1520 (volume ratio).
[0033] The present invention also optimizes the formulations of the microsphere buffer and the washing buffer. By using the optimized microsphere buffer and washing buffer, the detection sensitivity of 12 cytokines can be significantly improved, making the detection results more accurate.
[0034] On the other hand, the present invention provides a method for preparing a kit for detecting 12 cytokines based on a flow cytometer. The method includes the following steps:
[0035] Step (1): Construct a recombinant vector containing the heavy and light chains of the antibody, express it through a eukaryotic expression system, and prepare a recombinant antibody. The recombinant antibody includes Antibody 1 and Antibody 2. Antibody 1 includes IL-1β Antibody 1, IL-2 Antibody 1, IL-4 Antibody 1, IL-5 Antibody 1, IL-6 Antibody 1, IL-8 Antibody 1, IL-10 Antibody 1, IL-12p70 Antibody 1, IL-17A Antibody 1, IFN-γ Antibody 1, TNF-α Antibody 1, and IFN-α Antibody 1; Antibody 2 includes IL-1β Antibody 2, IL-2 Antibody 2, IL-4 Antibody 2, IL-5 Antibody 2, IL-6 Antibody 2, IL-8 Antibody 2, IL-10 Antibody 2, IL-12p70 Antibody 2, IL-17A Antibody 2, IFN-γ Antibody 2, TNF-α Antibody 2, and IFN-α Antibody 2; The heavy chain of the IL-17A Antibody 1 has the amino acid sequence shown in Seq ID NO:116, and the light chain has the amino acid sequence shown in Seq ID NO:117. The heavy chain of the IL-17A Antibody 2 has the amino acid sequence shown in Seq ID NO:118, and the light chain has the amino acid sequence shown in Seq ID NO:119;
[0036] Step (2): Using the recombinant antibody, prepare an antibody solution conjugated with microspheres and a fluorescently labeled antibody solution.
[0037] Furthermore, the antibody conjugated with microspheres is Antibody 1, and the fluorescently labeled antibody is Antibody 2. The light and heavy chains encoding Antibody 1 and Antibody 2 are shown in Table 1.
[0038] In some ways, the basic process of constructing a recombinant vector containing the heavy and light chains of the antibody, expressing it through a eukaryotic expression system, and preparing a recombinant antibody in Step (1) is as follows:
[0039] a. Extract mRNA: First, extract mRNA from a hybridoma cell line secreting a monoclonal antibody against a cytokine.
[0040] b. Reverse transcribe cDNA: Reverse transcriptase MMLV starts replicating the first strand of cDNA from the 3' end of the mRNA. Subsequently, reverse transcriptase MMLV adds multiple cytosine deoxyribonucleotides (C) to the 5' end of the cDNA strand. The 3' end of the universal extension primer has 3 guanine ribonucleotides (G) that form a complement with the cytosine deoxyribonucleotides (C) at the 5' end of the cDNA strand. Since reverse transcriptase MMLV replicates cDNA using mRNA as a template, mediated by 3 guanine ribonucleotides (G), reverse transcriptase MMLV switches the template sequence and adds a universal PCR amplification sequence to the 5' end of the cDNA strand using the universal extension primer as a template. This method can obtain as complete an antibody variable region sequence as possible, including the signal peptide sequence.
[0041] c, PCR amplification of cDNA: Using universal 5'-end and 3'-end primers (Kappa chain / Lambda chain / H chain), PCR amplify the first-strand cDNA obtained in the above steps to obtain double-stranded DNA encoding the variable regions of the antibody heavy chain or light chain.
[0042] Electrophoretically purify the PCR product, perform Sanger sequencing, and then analyze the sequence using the IMGT database to locate the signal peptide sequences of the antibody heavy chain and light chain, as well as the variable region sequences including the complementarity-determining regions (CDR regions) and frameworks (FR regions).
[0043] d, Replace the original heavy chain and light chain signal peptide sequences of the antibody with the optimized heavy chain and light chain signal peptide sequences, ligate them with the variable region sequences, add restriction enzyme sites EcoRⅠ / HindⅢ at the 5'-end / 3'-end respectively, perform codon optimization, synthesize the DNA sequence and construct the pcDNA3.4 recombinant vector.
[0044] e, Transfect the aforementioned antibody heavy chain and light chain plasmids into Expi293F cells for expression, and collect the culture medium supernatant. Purify the recombinant antibody through Protein A medium.
[0045] In addition, optimize the complementarity-determining region (CDR3) sequences in the variable regions of IL-17A antibody 1 and IL-17A antibody 2, construct multiple recombinant IL-17A antibody 1 and IL-17A antibody 2 containing different mutant sequences, and select a group of antibodies with the best antigen detection results.
[0046] On the other hand, the present invention provides a method for detecting 12 cytokines based on a flow cytometer. The method adopts a one-step incubation method and includes the following steps:
[0047] Step (a): Take the sample to be tested, add the antibody solution conjugated with microspheres, the fluorescently labeled antibody solution, and the microsphere buffer respectively, and incubate.
[0048] Step (b): Add the washing buffer to wash, centrifuge, and wait for detection.
[0049] When the antibody prepared by the lymphocyte hybridoma technology is used for detecting 12 cytokines by flow cytometry, there is still a difficult problem to solve, that is, the incubation process is very complicated and requires multiple-step incubation. For example, since the detection of the IL-17A antibody is difficult, the IL-17A antibody needs to be incubated separately from other cytokine antibodies in the pretreatment to ensure the accuracy of the IL-17A detection result; TNF-α also needs to be incubated separately, resulting in at least 1.5-step incubation to achieve the detection of 12 cytokines. By screening suitable antibody 1 and antibody 2, the present invention only needs one-step incubation to complete the pretreatment when detecting 12 cytokines, greatly simplifying the operation process and also helping to improve the accuracy of the detection result.
[0050] Further, the sample to be detected is one or more of a plasma sample, a serum sample, and a calibrator.
[0051] On the other hand, the present invention provides the use of a group of recombinant antibodies for preparing a reagent for simultaneously detecting 12 cytokines in a blood sample by flow cytometry by a one-step incubation method, and the recombinant antibodies include antibody 1 and antibody 2; the light and heavy chains encoding antibody 1 and antibody 2 are shown in Table 1.
[0052] Further, the blood sample is a plasma sample and / or a serum sample.
[0053] On the other hand, the present invention provides the use of a group of IL-17A recombinant antibodies for preparing a reagent for simultaneously detecting 12 cytokines in a blood sample by flow cytometry by a one-step incubation method, and the IL-17A recombinant antibodies include IL-17A antibody 1 and IL-17A antibody 2. The heavy chain of IL-17A antibody 1 has the amino acid sequence shown in Seq ID NO:116, and the light chain has the amino acid sequence shown in Seq ID NO:117. The heavy chain of IL-17A antibody 2 has the amino acid sequence shown in Seq ID NO:118, and the light chain has the amino acid sequence shown in Seq ID NO:119.
[0054] On the other hand, the present invention provides the use of a group of IL-17A recombinant antibodies for preparing a reagent for improving the accuracy of simultaneously detecting 12 cytokines in a blood sample by flow cytometry, and the IL-17A recombinant antibodies include IL-17A antibody 1 and IL-17A antibody 2. The heavy chain of IL-17A antibody 1 has the amino acid sequence shown in Seq ID NO:116, and the light chain has the amino acid sequence shown in Seq ID NO:117. The heavy chain of IL-17A antibody 2 has the amino acid sequence shown in Seq ID NO:118, and the light chain has the amino acid sequence shown in Seq ID NO:119.
[0055] On the other hand, the present invention provides the use of a group of recombinant antibodies for preparing a reagent for improving the accuracy of simultaneously detecting 12 cytokines in a blood sample by a flow cytometer, wherein the recombinant antibodies include antibody 1 and antibody 2; the nucleotide sequences encoding the light and heavy chains of antibody 1 and antibody 2 are shown in Table 1.
[0056] The kit for detecting 12 cytokines based on a flow cytometer constructed by the present invention and its detection method have the following beneficial effects:
[0057] 1. Based on the flow cytometer, simultaneous and accurate detection of 12 cytokines, namely IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-17A, IFN-γ, TNF-α, and IFN-α, can be achieved;
[0058] 2. For the 12 cytokines, the nucleotide sequences of antibody 1 and antibody 2 for the 12 cytokines are respectively screened and optimized, and recombinant antibodies are prepared by expression in a eukaryotic cell expression system; wherein antibody 1 is used to prepare an antibody solution conjugated with microspheres, and antibody 2 is used to prepare a fluorescently labeled antibody solution;
[0059] 3. For the most difficult-to-detect IL-17A antibody sequence, multiple mutation screening and heavy-chain and light-chain combination pairing screening are carried out to obtain the most preferred nucleotide sequences and amino acid sequences of IL-17A antibody 1 and IL-17A antibody 2;
[0060] 4. The mRNA sequences of the monoclonal antibodies are extracted and cloned into plasmids, which are suitable for long-term storage and will not be lost;
[0061] 5. The constant region sequence of the mouse antibody is replaced with the constant region sequence of the human antibody IgG1 to form a recombinant chimeric antibody, which to a certain extent avoids non-specific reactions with components in human blood, improves the accuracy and sensitivity of antigen detection, and has stronger anti-interference ability;
[0062] 6. The constant region of the human antibody IgG1 has a stronger binding ability with the Protein A medium for purifying the antibody, which improves the efficiency of purifying the antibody;
[0063] 7. The blank limits of detection sensitivity for the 12 cytokines, namely IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-17A, IFN-γ, TNF-α, and IFN-α, are all below 1 pg / mL, the detection limits are all below 1.25 pg / mL, and the inter-batch difference is controlled within 7%;
[0064] 8. The detection process only requires one incubation and one washing, and can improve the accuracy and sensitivity of detection, control the inter-batch difference, achieve accurate detection for both serum samples and plasma samples, help comprehensively evaluate the immune function status of patients, comprehensively judge the immune state of the body, and provide important references for the auxiliary diagnosis, guiding medication, monitoring the curative effect, and prognosis of diseases. Description of the Drawings
[0065] Figure 1 It is the RNA electrophoresis result diagram in Example 1;
[0066] Figure 2 It is the PCR product electrophoresis result diagram in Example 1;
[0067] Figure 3 It is the sequence optimization flow chart of 24 antibodies in Example 1;
[0068] Figure 4 It is the SDS-PAGE electrophoresis result diagram in Example 1;
[0069] Figure 5 It is the schematic diagram of the detection principle of the kit for simultaneously detecting 12 cytokines based on a flow cytometer in Example 1, where 10 is a polystyrene microsphere, 20 is antibody 1 conjugated to the microsphere, 30 is the sample to be tested, 40 is the fluorescently labeled antibody 2, and 50 is phycoerythrin;
[0070] Figure 6 It is the distribution of capture microspheres for sample detection provided in Example 1;
[0071] Figure 7 It is the calibration curve for simultaneously detecting 12 cytokines based on a flow cytometer provided in Example 1;
[0072] Figure 8 It is the linear evaluation result of IL-1β provided in Example 1;
[0073] Figure 9 It is the linear evaluation result of IL-2 provided in Example 1;
[0074] Figure 10 It is the linear evaluation result of IL-4 provided in Example 1;
[0075] Figure 11 It is the linear evaluation result of IL-5 provided in Example 1;
[0076] Figure 12 It is the linear evaluation result of IL-6 provided in Example 1;
[0077] Figure 13 It is the linear evaluation result of IL-8 provided in Example 1;
[0078] Figure 14 Linear evaluation results of IL-10 provided for Example 1;
[0079] Figure 15 Linear evaluation results of IL-12p70 provided for Example 1;
[0080] Figure 16 Linear evaluation results of IL-17A provided for Example 1;
[0081] Figure 17 Linear evaluation results of IFN-γ provided for Example 1;
[0082] Figure 18 Linear evaluation results of TNF-α provided for Example 1;
[0083] Figure 19 Linear evaluation results of IFN-α provided for Example 1. Detailed implementation manners
[0084] To describe the present invention more specifically, the technical solutions of the present invention will be described in detail below in conjunction with the accompanying drawings and specific implementation manners. These descriptions are only to illustrate how the present invention is implemented and cannot limit the specific scope of the present invention. The scope of the present invention is defined in the claims.
[0085] Example 1: Preparation, use and effect evaluation of the kit
[0086] I. Preparation of the kit
[0087] The specific composition is shown in Table 2:
[0088] Table 2. Composition of the kit
[0089]
[0090] The preparation method is as follows:
[0091] 1. Preparation of antibodies
[0092] Reagents: Reverse transcriptase( MMLV Reverse Transcriptase, Baolai Biotech Co., Ltd. (Beijing), product number 639522), Universal Ribonucleic Acid Extraction Kit (TaKaRa MiniBEST Universal RNA Extraction Kit, Baolai Biotech Co., Ltd. (Beijing), product number 9767), High-Fidelity Deoxyribonucleic Acid Polymerase (Hieff Gold High-Fidelity DNA Polymerase, Yeasen Biotechnology (Shanghai) Co., Ltd., Catalog No. 10148ES60), Protein A affinity chromatography medium (AT Protein A Diamond, Bio-Gel Co., Catalog No. AA0272), Expi293 TM Expression medium (Thermo Fisher Scientific (China) Co., Ltd., Catalog No. A1435101), ExpiFectamine TM 293 Transfection Kit (Thermo Fisher Scientific (China) Co., Ltd., Catalog No. A14524).
[0093] a. Extract mRNA: First, extract mRNA from the hybridoma cell line secreting cytokine monoclonal antibodies.
[0094] Previously, Balb / c mice were immunized with cytokine recombinant proteins and screened to obtain monoclonal cell lines that can secrete antibodies (multiple monoclonal cell lines were obtained after immunization, and for each antigen, two monoclonal cell lines with the highest titers were selected for antibody preparation). Take 10 6 cells / mL of monoclonal cell lines in the logarithmic growth phase (IL-2 antibody 1, IL-2 antibody 2, IL-4 antibody 1, IL-4 antibody 2, IL-6 antibody 1, IL-6 antibody 2, IL-10 antibody 1, IL-10 antibody 2, TNF-α antibody 1, TNF-α antibody 2, IFN-γ antibody 1, IFN-γ antibody 2, IL-17A antibody 1, IL-17A antibody 2, IL-1β antibody 1, IL-1β antibody 2, IL-5 antibody 1, IL-5 antibody 2, IL-12p70 antibody 1, IL-12p70 antibody 2, IFN-α antibody 1, IFN-α antibody 2, IL-8 antibody 1, IL-8 antibody 2), ensure that the cell viability is greater than 90%, centrifuge at 300G for 5 minutes, discard the supernatant and retain the cells.
[0095] Use a ribonucleic acid extraction kit (TaKaRa MiniBEST Universal RNA Extraction Kit, Catalog No. 9767) to extract RNA. The qualified standard for the quality of RNA extraction is that the ratio of the 28S and 18S bands visible by electrophoresis is approximately 2:1, and the electrophoresis results are as Figure 1 shown.
[0096] b. Reverse transcribe cDNA: Use reverse transcriptase to reverse transcribe the first-strand cDNA from mRNA. The reverse transcription reaction system is set as follows:
[0097] (1) Add 1 μg of the above RNA to a 200 μL PCR reaction tube;
[0098] (2) Add 2.5 μL each of the reverse transcription forward primer and reverse primer (choose one of the three) with a concentration of 20 μM, and add water to a total volume of 11.5 μL;
[0099] (3) Incubate at 70 °C for 3 minutes and immediately cool on ice;
[0100] (4) Add 4 μL of 5× First-Strand Buffer, 2 μL of dNTP Mix, and 2 μL of 100 mM DTT, and mix well;
[0101] (5) Add 0.5 μL of reverse transcriptase and mix well;
[0102] (6) Incubate at 42 °C for 60 minutes;
[0103] (7) Terminate the reaction: Incubate at 70 °C for 15 minutes.
[0104] The primers used are shown in Table 3. The reverse transcription primer oligo(dT) can replace the antibody-specific primer and the universal extension primer used in this example, but the reverse transcription primer oligo(dT) will produce many non-specifically replicated cDNAs. In subsequent PCR amplifications, multiple 5'-end primers with different sequences need to be used to enumerate the correct sequence. The DNA fragments produced by replication may not include the complete antibody variable region and signal peptide sequences, and the operation is more time-consuming and the workload is greater.
[0105] Table 3. Reverse transcription forward primer and reverse primer
[0106]
[0107] The reverse transcriptase MMLV replicates the first-strand cDNA starting from the 3'-end of the mRNA. Subsequently, the reverse transcriptase MMLV adds multiple cytosine deoxyribonucleotides (C) to the 5'-end of the cDNA strand. The 3'-end of the universal extension primer has three guanine ribonucleotides (G) that form a complement with the cytosine deoxyribonucleotides (C) at the 5'-end of the cDNA strand. Since the reverse transcriptase MMLV replicates cDNA using mRNA as a template, mediated by the three guanine ribonucleotides (G), the reverse transcriptase MMLV switches the template sequence and adds a universal PCR amplification sequence to the 5'-end of the cDNA strand using the universal extension primer as a template. This method can obtain as complete an antibody variable region sequence as possible, including the signal peptide sequence.
[0108] c. PCR amplify the cDNA to obtain double-stranded DNA:
[0109] Using universal 5'-end primers and 3'-end primers (Kappa chain / Lambda chain / H chain), PCR amplify the first-strand cDNA obtained in the above steps to obtain double-stranded DNA encoding the variable region of the antibody H chain or L chain. The designed PCR primers are shown in Table 4, and the PCR reaction systems are shown in Tables 5 and 6.
[0110] Table 4, PCR forward and reverse primers
[0111]
[0112] Table 5, PCR reaction settings
[0113]
[0114] Table 6, PCR cycle settings
[0115]
[0116] Electrophoretically purify the PCR product. The electrophoresis results are as Figure 2 shown, indicating that the H chain and L chain of the antibody were successfully obtained.
[0117] d. Design the recombinant chimeric antibody sequence:
[0118] The DNA fragments obtained in the foregoing steps are sequenced using Sanger sequencing to obtain the original sequences of 24 antibodies (Table 9). The sequences are input into the database IgBlast for analysis to locate the signal peptide sequences of the antibody H chain and L chain, as well as the variable region sequences including the complementary determining region (CDR region) and the framework region (FR region).
[0119] Intercept the H chain / L chain variable region sequences from the foregoing sequences, add optimized H chain / L chain signal peptide sequences (Table 7) at the 5'-end of the variable region sequences, and add human IgG1 constant region H chain / L chain sequences (Table 8) at the 3'-end of the variable region sequences to obtain recombinant H chain / L chain gene sequences (optimize to obtain the H chain / L chain gene sequences of 24 recombinant antibodies shown in Table 1). Among them, if the variable region of the mouse antibody belongs to the Kappa chain, the human Kappa chain constant region is ligated; if the variable region of the mouse antibody belongs to the Lambda chain, the human Lambda chain constant region is ligated.
[0120] Add restriction endonuclease sites EcoRⅠ / HindⅢ at the 5'-end / 3'-end of the recombinant H chain / L chain gene, use the codon optimization service provided by GenScript, synthesize the H chain / L chain gene of the recombinant antibody, and the vector plasmid is pcDNA3.4 (Seq ID NO:103, provided by GenScript), and construct the pcDNA3.4 recombinant vector (provided by GenScript).
[0121] Table 7, H chain / L chain signal peptide sequences
[0122]
[0123] Table 8, Human IgG1 constant region H chain / L chain sequences
[0124] IgG1 H chain constant region Seq ID NO:49 IgG1 H chain constant region DNA sequence Seq ID NO:50 Ig Kappa chain constant region Seq ID NO:51 Ig Kappa chain constant region DNA sequence Seq ID NO:52 Ig Lambda chain constant region Seq ID NO:53 Ig Lambda chain constant region DNA sequence Seq ID NO:54
[0125] Table 9, Original sequences of H chain / L chain genes of 24 antibodies
[0126] Antibody Heavy chain sequence Light chain sequence Antibody Heavy chain sequence Light chain sequence IL-1β antibody 1 Seq ID NO:55 Seq ID NO:56 IL-1β antibody 2 Seq ID NO:57 Seq ID NO:58 IL-2 antibody 1 Seq ID NO:59 Seq ID NO:60 IL-2 antibody 2 Seq ID NO:61 Seq ID NO:62 IL-4 antibody 1 Seq ID NO:63 Seq ID NO:64 IL-4 antibody 2 Seq ID NO:65 Seq ID NO:66 IL-5 antibody 1 Seq ID NO:67 Seq ID NO:68 IL-5 antibody 2 Seq ID NO:69 Seq ID NO:70 IL-6 antibody 1 Seq ID NO:71 Seq ID NO:72 IL-6 antibody 2 Seq ID NO:73 Seq ID NO:74 IL-8 antibody 1 Seq ID NO:75 Seq ID NO:76 IL-8 antibody 2 Seq ID NO:77 Seq ID NO:78 IL-10 antibody 1 Seq ID NO:79 Seq ID NO:80 IL-10 antibody 2 Seq ID NO:81 Seq ID NO:82 IL-12p70 antibody 1 Seq ID NO:83 Seq ID NO:84 IL-12p70 antibody 2 Seq ID NO:85 Seq ID NO:86 IL-17A antibody 1 Seq ID NO:87 Seq ID NO:88 IL-17A antibody 2 Seq ID NO:89 Seq ID NO:90 IFN-γ antibody 1 Seq ID NO:91 Seq ID NO:92 IFN-γ antibody 2 Seq ID NO:93 Seq ID NO:94 TNF-α antibody 1 Seq ID NO:95 Seq ID NO:96 TNF-α antibody 2 Seq ID NO:97 Seq ID NO:98 IFN-α antibody 1 Seq ID NO:99 Seq ID NO:100 IFN-α antibody 2 Seq ID NO:101 Seq ID NO:102
[0127] The heavy chain of IL-17A antibody 1 with optimized amino acid sequence has the amino acid sequence shown in Seq ID NO: 116, the light chain has the amino acid sequence shown in Seq ID NO: 117, the heavy chain of IL-17A antibody 2 has the amino acid sequence shown in Seq ID NO: 118, the light chain has the amino acid sequence shown in Seq ID NO: 119, the heavy and light chains of IL-17A antibody 1 and IL-17A antibody 2 before optimization have the amino acid sequences shown in Seq ID NO: 120 - Seq ID NO: 123, and the heavy and light chains of 22 antibodies have the amino acid sequences shown in Seq ID NO: 124 - Seq ID NO: 167. See Table 10 for details. The sequence optimization flow chart of 24 antibodies is shown in Figure 3 。
[0128] Table 10, Amino acid sequences of 22 antibodies
[0129] Antibody Heavy chain amino acid sequence Light chain amino acid sequence Antibody Heavy chain amino acid sequence Light chain amino acid sequence IL-1β antibody 1 Seq ID NO:124 Seq ID NO:125 IL-1β antibody 2 Seq ID NO:126 Seq ID NO:127 IL-2 antibody 1 Seq ID NO:128 Seq ID NO:129 IL-2 antibody 2 Seq ID NO:130 Seq ID NO:131 IL-4 antibody 1 Seq ID NO:132 Seq ID NO:133 IL-4 antibody 2 Seq ID NO:134 Seq ID NO:135 IL-5 Antibody 1 Seq ID NO:136 Seq ID NO:137 IL-5 Antibody 2 Seq ID NO:138 Seq ID NO:139 IL-6 Antibody 1 Seq ID NO:140 Seq ID NO:141 IL-6 Antibody 2 Seq ID NO:142 Seq ID NO:143 IL-8 Antibody 1 Seq ID NO:144 Seq ID NO:145 IL-8 Antibody 2 Seq ID NO:146 Seq ID NO:147 IL-10 Antibody 1 Seq ID NO:148 Seq ID NO:149 IL-10 Antibody 2 Seq ID NO:150 Seq ID NO:151 IL-12p70 Antibody 1 Seq ID NO:152 Seq ID NO:153 IL-12p70 Antibody 2 Seq ID NO:154 Seq ID NO:155 IL-17A Antibody 1 Seq ID NO:120 Seq ID NO:121 IL-17A Antibody 2 Seq ID NO:122 Seq ID NO:123 IFN-γ Antibody 1 Seq ID NO:156 Seq ID NO:157 IFN-γ Antibody 2 Seq ID NO:158 Seq ID NO:159 TNF-α Antibody 1 Seq ID NO:160 Seq ID NO:161 TNF-α Antibody 2 Seq ID NO:162 Seq ID NO:163 IFN-α Antibody 1 Seq ID NO:164 Seq ID NO:165 IFN-α Antibody 2 Seq ID NO:166 Seq ID NO:167
[0130] e, Eukaryotic expression recombinant antibody: On the day of transfection, adjust the density of Expi293F cells in the logarithmic growth phase to 2.5×10 6 / mL, and the medium used is Expi293 TM Expression Medium (Thermo Fisher Scientific (China) Co., Ltd., A1435101). For transfecting 100 mL of cells, 100 μg of plasmid is required (including 35.5 μg of H chain plasmid and 64.5 μg of L chain plasmid), and add 270 μL of transfection reagent ExpiFectamine TM 293 (Thermo Fisher Scientific (China) Co., Ltd., A14524). Incubate at 37 °C and 8% carbon dioxide for 4 - 5 days, then centrifuge at 3000G for 20 minutes to collect the medium, and filter through a 0.22 μM filter membrane.
[0131] f, Antibody purification, taking 100 mL of medium as an example:
[0132] (1) Use 1 mL of AT Protein A Diamond affinity chromatography medium (Bogelong Co., AA0272) and load it into the chromatography column;
[0133] (2) Pass through 5 column volumes of 20 mM PBS (pH 7.4);
[0134] (3) Pass through 100 mL of culture medium (pH 7.0 - 8.0);
[0135] (4) Pass through 10 column volumes of 20 mM PBS (pH 7.4);
[0136] (5) Pass through 10 column volumes of 100 mM glycine (pH 3.1) and collect the eluate containing the antibody.
[0137] (6) Perform SDS - PAGE electrophoresis on the antibody - purified product. The electrophoresis pattern is as Figure 4 shown. It can be seen from Figure 4 that the antibody purity is good;
[0138] (7) Dialyze the antibody with 10 mM PBS (pH 7.4), take it out and store it at - 20 °C. The antibody preparation is completed.
[0139] 2. Prepare the antibody solution for coupling microspheres
[0140] Take 0.1 mL of fluorescent microspheres with a concentration of 5×10 7 per mL (manufacturer: Polysciences, model BLI239C - 20, BLI250C - 10), add PBST buffer and wash twice. Add 100 μg of 1 - (3 - dimethylaminopropyl) - 3 - ethylcarbodiimide hydrochloride (EDC) and 50 μg of N - hydroxysulfosuccinimide (NHS) to the washed first fluorescent microspheres and let stand for 30 minutes to activate the microspheres. Add 100 μg of IL - 1β antibody 1 and react by rotating at room temperature for 5 hours. After washing the first fluorescent microspheres to remove the excess antibody, add 5% skim milk powder by mass fraction to block for 30 minutes. After removing the skim milk powder, add Tris buffer with a pH of 7.2 for storage to obtain 0.5 mL of a polystyrene microsphere solution coated with IL - 1β antibody 1;
[0141] Prepare polystyrene microsphere solutions coated with IL - 4 antibody 1, IL - 5 antibody 1, IL - 6 antibody 1, IL - 8 antibody 1, IL - 10 antibody 1, IL - 12p70 antibody 1, IL - 17A antibody 1, IFN - γ antibody 1, TNF - α antibody 1, IFN - α antibody 1 in the same way, each with a volume of 0.5 mL;
[0142] Prepare the microsphere buffer: Dissolve 2.4 g of potassium dihydrogen phosphate (KH 2 PO4 )、36.32 g disodium hydrogen phosphate dodecahydrate (Na 2 HPO 4 ·12H 2 O), 8 g sodium chloride (NaCl), 2 g potassium chloride (KCl) were dissolved in 1000 mL of pure water. 25 g of bovine serum albumin (BSA) was added, 1.2 mL of ProClin300 was added, 0.6 mL of Tween 20 was added, and 2 mL of polyvinylpyrrolidone K30 (PVP-k30) (purchased from aladdin, English name RNase-free PVP k30 Solution, CAS No. 9003-39-8) was added and reserved for use.
[0143] Take 188 μL of microsphere buffer, and add 1 μL of polystyrene microsphere solutions coated with anti-IL-1β antibody 1, anti-IL-4 antibody 1, anti-IL-5 antibody 1, anti-IL-6 antibody 1, anti-IL-8 antibody 1, anti-IL-10 antibody 1, anti-IL-12p70 antibody 1, anti-IL-17A antibody 1, anti-IFN-γ antibody 1, anti-TNF-α antibody 1, anti-IFN-α antibody 1 respectively to prepare an antibody solution conjugated with microspheres.
[0144] 3. Prepare a fluorescently labeled antibody solution
[0145] Take anti-IL-1β antibody 2, anti-IL-2 antibody 2, anti-IL-4 antibody 2, anti-IL-5 antibody 2, anti-IL-6 antibody 2, anti-IL-8 antibody 2, anti-IL-10 antibody 2, anti-IL-12p70 antibody 2, anti-IL-17A antibody 2, anti-IFN-γ antibody 2, anti-TNF-α antibody 2, anti-IFN-α antibody 2, and add phycoerythrin fluorescein at a molar ratio of antibody 2 to phycoerythrin fluorescein of 1:30. After shaking and incubating at room temperature for 5 hours, wash 3 times with a PBS solution with a concentration of 0.01 mol / L using a 50K ultrafiltration tube to remove excess unbound phycoerythrin fluorescein, and obtain phycoerythrin fluorescein-labeled anti-IL-1β antibody 2, anti-IL-2 antibody 2, anti-IL-4 antibody 2, anti-IL-5 antibody 2, anti-IL-6 antibody 2, anti-IL-8 antibody 2, anti-IL-10 antibody 2, anti-IL-12p70 antibody 2, anti-IL-17A antibody 2, anti-IFN-γ antibody 2, anti-TNF-α antibody 2, anti-IFN-α antibody 2. Dilute the phycoerythrin fluorescein-labeled anti-IL-1β antibody 2, anti-IL-2 antibody 2, anti-IL-4 antibody 2, anti-IL-5 antibody 2, anti-IL-6 antibody 2, anti-IL-8 antibody 2, anti-IL-10 antibody 2, anti-IL-12p70 antibody 2, anti-IL-17A antibody 2, anti-IFN-γ antibody 2, anti-TNF-α antibody 2, anti-IFN-α antibody 2 to 2 μg / mL with a 0.01 mol / L PBS solution respectively.
[0146] Take 25 mL each of the phycoerythrin fluorescein-labeled IL-1β antibody 2, IL-2 antibody 2, IL-4 antibody 2, IL-5 antibody 2, IL-6 antibody 2, IL-8 antibody 2, IL-10 antibody 2, IL-12p70 antibody 2, IL-17A antibody 2, IFN-γ antibody 2, TNF-α antibody 2, and IFN-α antibody 2 with a diluted concentration of 2 μg / mL, and mix them to prepare a fluorescently labeled antibody solution. The concentration of each phycoerythrin fluorescein-labeled antibody is 0.5 μg / mL.
[0147] 4. Prepare sample diluent
[0148] Dissolve 2.38 g of 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) in 1000 mL of pure water to make a 0.01 mol / L HEPES solution, add 8.0 g of NaCl, ProClin300 with a mass concentration of 0.05%, and 10% human serum, and adjust the pH to 7.4 for standby.
[0149] 5. Prepare washing buffer (10×)
[0150] Take 3.0275 g of tris(hydroxymethyl)aminomethane (abbreviated as Tris) and 9.0 g of sodium chloride, dissolve them in 800 mL of pure water, add 0.8 mL of ProClin300 preservative, 0.6 mL of Tween-20, 0.1 mL of Dow Corning-1520 (purchased from Dow Corning, USA, model AFE-1520), add 20 g of bovine serum albumin (abbreviated as BSA), and adjust the pH value to 7.4 to obtain washing buffer (10×) for standby. Stabilize the washing buffer (10×) to room temperature. After all salts are dissolved, take 10 mL of the washing buffer (10×) and add it to 90 mL of pure water to obtain washing buffer (1×).
[0151] 6. Calibrator: The calibrator is a recombinant protein solution of IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-17A, IFN-γ, TNF-α, and IFN-α diluted to different concentrations with sample diluent to establish a calibration curve for detection. The preparation method is as follows:
[0152] ① Add 2 mL of sample diluent to the calibrator lyophilized powder to completely dissolve the lyophilized powder;
[0153] ② Let it stand at room temperature for 15 min. The concentration of this solution is the highest concentration, and it is labeled as C1;
[0154] ③ Prepare 14 empty flow tubes, and label them as C1, C2, C3, C4, C5, C6, C7, C8, C9, C10, C11, C12, C13, and C0 respectively;
[0155] ④ Add 300 μL of sample diluent to each tube and perform a 2-fold dilution, that is, take 300 μL of solution C1 and add it to C2, and mix well.
[0156] ⑤ Dilute in the same way to obtain calibration products C3, C4, C5, C6, C7, C8, C9, C10, C11, C12, C13, and C14. Only add sample diluent to C0.
[0157] 7. Quality control products: Lyophilized products of IL-2, IL-4, IL-6, IL-10, TNF-α, IFN-γ, IL-17, IL-12p70, IL-1β, IL-5, IL-8, IFN-α proteins, and prepare quality control products with high, medium, and low concentrations using sample diluent.
[0158] 8. Preparation of recombinant proteins of IL-2, IL-4, IL-6, IL-10, TNF-α, IFN-γ, IL-17, IL-12p70, IL-1β, IL-5, IL-8, IFN-α for preparing calibration products and quality control products.
[0159] Since the preparation processes of recombinant proteins of each cytokine are the same, this example only takes the preparation steps of IL-2 recombinant protein as an example. The recombinant proteins of the other 11 cytokines respectively use their own different gene sequences, and the preparation methods are the same, so they are not listed one by one.
[0160] Reagents: Expi293 TM Expression medium (Thermo Fisher Scientific (China) Co., Ltd., product number A1435101)
[0161] ExpiFectamine TM 293 transfection kit (Thermo Fisher Scientific (China) Co., Ltd., product number A14524)
[0162] Ni-NTA affinity chromatography medium (GenScript Corporation, product number L00250)
[0163] 8.1 Gene design and synthesis
[0164] Search for the mRNA sequence of the human IL-2 gene publicly available in NCBI. Insert the His-Tag sequence encoded by CACCACCACCACCACCACCACCACCACCAC (Seq ID NO: 183) after the gene sequence encoding the signal peptide: ATGTATAGAATGCAGCTGCTCTCCTGCATCGCCCTGAGCCTGGCTCTGGTGACCAACAGC (Seq ID NO: 182). According to the codon preference of the human cell eukaryotic expression system, perform codon optimization to obtain the coding sequence of the IL-2 recombinant protein gene shown in Seq ID NO: 104, which is synthesized by GenScript and cloned into the pcDNA3.4 vector (Seq ID NO: 103) to construct a recombinant plasmid.
[0165] The gene coding sequences of the recombinant proteins of IL-2, IL-4, IL-6, IL-10, TNF-α, IFN-γ, IL-17, IL-12p70, IL-1β, IL-5, IL-8, and IFN-α are shown in Seq ID NO: 104 to Seq ID NO: 115 respectively.
[0166] 8.2 Eukaryotic expression of recombinant proteins
[0167] On the day of transfection, adjust the density of Expi293F cells in the logarithmic growth phase to 2.5×10 6 / mL, and the medium used is Expi293 TM Expression Medium (Thermo Fisher Scientific (China) Co., Ltd., A1435101). For 100 mL of transfected cells, 100 μg of the aforementioned recombinant plasmid is required, and 270 μL of the transfection reagent ExpiFectamine TM 293 (Thermo Fisher Scientific (China) Co., Ltd., A14524). After culturing at 37°C and 8% carbon dioxide for 4 - 5 days, centrifuge at 3000G for 20 minutes to collect the medium, and filter it through a 0.22 μM filter membrane. Then purify the recombinant protein using Ni-NTA affinity chromatography medium (GenScript, product number L00250).
[0168] II. Usage method of the kit
[0169] Using the kit prepared in this example, the usage method is as follows:
[0170] (1) Add 25 μL of the antibody solution conjugated with microspheres, 25 μL of the sample (plasma sample or serum sample or calibrator), and 25 μL of the fluorescently labeled antibody solution to each tube respectively, mix well, and let it stand at room temperature in the dark for 2.5 h (one-step incubation);
[0171] (2) Add 1000 μL of 1× washing buffer (single wash), resuspend the microspheres by vortexing, mix well, centrifuge to remove the supernatant, and shake on a shaker for more than 30 seconds. Then add 300 μL of 1× washing buffer and detect the fluorescence type and fluorescence signal intensity on the BriCyte E6 flow cytometer produced by Mindray. The specific detection process is a conventional technical means for those skilled in the art and will not be elaborated here.
[0172] The principle of detection using the kit is as Figure 5 shown. Here, 10 is polystyrene microspheres, 20 is antibody 1 conjugated to the microspheres, 30 is the sample to be tested, 40 is fluorescently labeled antibody 2, and 50 is phycoerythrin. First, the antibody immobilized on the polystyrene microspheres 10 specifically binds to the sample to be tested 30, and then specifically binds to the antibody conjugated with phycoerythrin.
[0173] When two beams of excitation light with different wavelengths emitted by the flow cytometer irradiate the immune complex, the type of detection index is determined by the fluorescence intensity of different fluorescent microspheres, and the content of each detection index is determined by the fluorescence intensity of phycoerythrin.
[0174] Figure 6 This is the distribution of capture microspheres for sample detection. Refer to Figure 6 , with APC-CY7 (the polystyrene microspheres contain different contents of allophycocyanin conjugated with Cy7 dye) as the vertical axis and APC (the polystyrene microspheres contain different contents of allophycocyanin) as the horizontal axis. The vertical axis differentiates the fluorescence intensity of APC-CY7 carried by different microspheres, and the horizontal axis differentiates the fluorescence intensity of APC carried by different microspheres. Figure 6Twelve kinds of antibody-coupled microspheres conjugated with IL-2, IL-4, IL-6, IL-10, TNF-α, IFN-γ, IL-17A, IL-12p70, IL-1β, IL-5, IL-8 and IFN-α can be distinguished, where P1 represents the APC and APC-CY7 distributions of IL-2 antibody-coupled microspheres, P2 represents the APC and APC-CY7 distributions of IL-4 antibody-coupled microspheres of the present invention, P3 represents the APC and APC-CY7 distributions of IL-6 antibody-coupled microspheres, P4 represents the APC and APC-CY7 distributions of IL-10 antibody-coupled microspheres, P5 represents the APC and APC-CY7 distributions of TNF-α antibody-coupled microspheres, P6 represents the APC and APC-CY7 distributions of IFN-γ antibody-coupled microspheres, P7 represents the APC and APC-CY7 distributions of IL-1β antibody-coupled microspheres, P8 represents the APC and APC-CY7 distributions of IL-5 antibody-coupled microspheres, P9 represents the APC and APC-CY7 distributions of IL-8 antibody-coupled microspheres, P10 represents the APC and APC-CY7 distributions of IL-12p70 antibody-coupled microspheres, P11 represents the APC and APC-CY7 distributions of IL-17A antibody-coupled microspheres, and P12 represents the APC and APC-CY7 distributions of IFN-α antibody-coupled microspheres.
[0175] III. Analysis of Detection Results
[0176] 1. Calibration Curve
[0177] Using the kit provided by the present invention, calibration curves of 12 cytokines including IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-17A, IFN-γ, TNF-α, and IFN-α were established. Calibrators with different concentrations of IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-17A, IFN-γ, TNF-α, and IFN-α were respectively detected on a flow cytometer to obtain Figure 7 the calibration curve.
[0178] 2. Evaluation of Linearity, Limit of Blank, and Limit of Detection
[0179] Linearity evaluation: High-concentration samples at the upper limit of the linear range were diluted into at least 7 samples with different concentrations (xi), and each concentration was tested 3 times. The mean values (yi) of the detection results were calculated respectively. Taking the dilution concentration (xi) as the independent variable and the mean value of the detection result (yi) as the dependent variable, a linear regression equation was obtained. The correlation coefficient (R) of the linear regression was calculated.
[0180] Figure 8 This is the linearity evaluation result of IL-1β in this example.Figure 9 The linear evaluation result of IL-2 in this example, Figure 10 The linear evaluation result of IL-4 in this example, Figure 11 The linear evaluation result of IL-5 in this example, Figure 12 The linear evaluation result of IL-6 in this example, Figure 13 The linear evaluation result of IL-8 in this example, Figure 14 The linear evaluation result of IL-10 in this example, Figure 15 The linear evaluation result of IL-12p70 in this example, Figure 16 The linear evaluation result of IL-17A in this example, Figure 17 The linear evaluation result of IFN-γ in this example, Figure 18 The linear evaluation result of TNF-α in this example, Figure 19 The linear evaluation result of IFN-α in this example.
[0181] Refer to Figures 8 - 19 , the linear regression equation of IL-1β is y = 87.189x + 732.44, R 2 = 0.9999; the linear regression equation of IL-2 is y = 71.459x + 1090.8, R 2 = 0.9997; the linear regression equation of IL-4 is y = 96.061x + 2743.8, R 2 = 0.9989; the linear regression equation of IL-5 is y = 114.85x + 2709.1, R 2 = 0.9996; the linear regression equation of IL-6 is y = 33.055x + 329.03, R 2 = 0.9999; the linear regression equation of IL-8 is y = 77.68x + 1914.4, R 2 = 0.9995; the linear regression equation of IL-10 is y = 91.989x - 1750.1, R 2 = 0.9997; the linear regression equation of IL-12p70 is y = 69.711x + 1608.5, R 2 = 0.9997; the linear regression equation of IL-17A is y = 67.168x + 2046.1, R 2 = 0.9995; the linear regression equation of IFN-γ is y = 77.922x + 1262.7, R 2 = 0.9998; the linear regression equation of TNF-α is y = 79.312x + 885.84, R 2 = 0.9999; the linear regression equation of IFN-α is y = 46.949x + 716.61, R 2 = 0.9998.
[0182] Using the kit provided in this embodiment, the detectable linear ranges of IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-17A, IFN-γ, TNF-α, and IFN-α are not narrower than 1.25 - 5000 pg / mL. Within the linear range, the linear correlation coefficient ∣R∣ is not less than 0.990.
[0183] Compared with the kit prepared with the pre-optimization sequence (the monoclonal antibody directly prepared from the hybridoma cell line in Table 9), the sensitivity of the kit prepared with the optimized sequence for the detection of 12 cytokines has been greatly improved. The detection limit of IL-17A in the optimized sequence reaches 0.416 pg / mL, and the detection limits of IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IFN-γ, TNF-α, and IFN-α in the optimized sequence are 0.563 pg / mL, 0.401 pg / mL, 0.474 pg / mL, 0.395 pg / mL, 0.479 pg / mL, 0.534 pg / mL, 0.531 pg / mL, 0.554 pg / mL, 0.566 pg / mL, 0.473 pg / mL, and 0.468 pg / mL, respectively.
[0184] Method for detecting the blank limit: Use the zero-concentration calibrator as the sample for detection, repeat the determination 20 times, obtain the concentration values of the 20 measurement results according to the curve equation of the calibrator used in the kit, calculate their average value (M) and standard deviation (SD), and M + 2SD is the blank limit value.
[0185] Method for detecting the detection limit: Detect 5 low-value samples with concentrations approximately equal to the detection limit (the approximate detection limit is estimated according to the obtained blank limit value, slightly higher than the blank limit). Each sample is detected 5 times, and the detection results are sorted by size. The number of detection results lower than the blank limit value should be less than or equal to 3.
[0186] The results of the blank limit and detection limit measured according to the above method are shown in Table 11, and the unit in the table is pg / mL.
[0187] Table 11. Results of Blank Limit and Detection Limit (unit: pg / mL)
[0188] Cytokine Blank Limit Before Sequence Optimization Blank Limit After Sequence Optimization Detection Limit Before Sequence Optimization Detection Limit After Sequence Optimization IL-1β 0.881 0.199 1.795 0.563 IL-2 0.663 0.262 1.978 0.401 IL-4 0.719 0.147 1.583 0.474 IL-5 0.754 0.163 1.668 0.395 IL-6 0.894 0.189 1.553 0.479 IL-8 0.736 0.173 1.650 0.534 IL-10 0.811 0.306 1.899 0.531 IL-12p70 0.757 0.258 1.628 0.554 IL-17A 1.924 0.110 2.762 0.416 IFN-γ 0.886 0.332 1.903 0.566 TNF-α 0.753 0.204 1.505 0.473 IFN-α 0.779 0.262 1.980 0.468
[0189] 3. Recovery Evaluation
[0190] Add the calibrator of the high-level analyte with known concentration to the sample diluent, and the volume ratio between the added analyte and the sample diluent is not greater than 1:9. Use the kit provided in this example (after antibody sequence optimization), and repeat the detection 3 times for each, and take the average value. Table 12 shows the results of the recovery test (pg / mL, n = 3). According to Table 12, the recoveries of IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-17A, IFN-γ, TNF-α, and IFN-α are all between 95% and 105%.
[0191] Table 12. Results of Recovery Detection
[0192] Analyte IL-1β IL-2 IL-4 IL-5 Theoretical Concentration (pg / mL) 2500.00 2500.00 2500.00 2500.00 Detected Concentration (pg / mL) 2590.33 2477.18 2491.96 2459.12 Recovery Rate 103.61% 99.09% 99.68% 98.36% Analyte IL-6 IL-8 IL-10 IL-12p70 Theoretical Concentration (pg / mL) 2500.00 2500.00 2500.00 2500.00 Detected Concentration (pg / mL) 2488.3 2603.56 2467.87 2596.89 Recovery Rate 99.53% 104.14% 98.71% 103.88% Analyte IL-17A IFN-γ TNF-α IFN-α Theoretical Concentration (pg / mL) 2500.00 2500.00 2500.00 2500.00 Detected Concentration (pg / mL) 2601.19 2573.69 2469.11 2541.56 Recovery Rate 104.05% 102.95% 98.76% 101.66%
[0193] 4. Repeatability and Inter-Batch Difference Evaluation
[0194] Repeatability: Detect the calibrators of IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-17A, IFN-γ, TNF-α, and IFN-α at 2 different concentration levels, and perform parallel detection 10 times, and calculate the coefficient of variation CV. Tables 13 to 15 show the results of the repeatability test (pg / mL).
[0195] Table 13. Results of Repeatability Detection (unit: pg / mL)
[0196]
[0197]
[0198] Table 14. Results of Repeatability Detection (unit: pg / mL)
[0199]
[0200] Table 15. Results of Repeatability Detection (unit: pg / mL)
[0201]
[0202] As can be seen from Tables 13 to 15, the repeatability coefficients of variation (CV) of the high-value and low-value calibrators for IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-17A, IFN-γ, TNF-α, and IFN-α are all within 5%.
[0203] Inter-batch difference: Take three batches of kits, with 10 samples in each batch. Repeat the detection of the same reference sample separately, calculate the average value and standard deviation (SD) of the 30 measurement results, and calculate the coefficient of variation (CV). The results of the inter-batch difference detection are shown in Tables 16 to 18.
[0204] Table 16. Results of the inter-batch difference assessment (unit: pg / mL)
[0205]
[0206]
[0207] Table 17. Results of the inter-batch difference assessment (unit: pg / mL)
[0208]
[0209] Table 18. Results of the inter-batch difference assessment (unit: pg / mL)
[0210]
[0211]
[0212] According to Tables 16 to 18, the inter-batch difference CVs of IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-17A, IFN-γ, TNF-α, and IFN-α for 3 batches are all within 7%.
[0213] Through the evaluation of repeatability and inter-batch difference, it can be seen that the kit of the present invention has good repeatability and inter-batch difference. The coefficient of variation (CV) of the intra-batch experiment is not more than 5%, and the inter-batch difference CV is not more than 7%.
[0214] 5. Detection of clinical samples
[0215] The kit in this example was used to detect one sample each from a healthy person and a patient with severe Gram-negative bacterial infection, and a comparative analysis was performed. Table 19 shows the results of the comparative test (pg / mL) of detecting samples from a healthy person and a patient with severe Gram-negative bacterial infection. Referring to Table 19, the levels of IL-2, IL-6, IL-8, IL-10, and IFN-γ in the patient samples were higher than those in the healthy person sample measured, among which IL-6 was the most obvious, and the measured values were all significantly increased >10-fold, which was consistent with the "Expert Consensus on the Clinical Significance Interpretation of Infection-related Biomarkers".
[0216] Table 19. Detection of Clinical Samples
[0217] Healthy Individuals Patients IL-1β 3.86 6.47 IL-2 2.45 9.91 IL-4 2.64 1.72 IL-5 1.54 0.72 IL-6 1.96 13182.29 IL-8 4.21 1201.03 IL-10 3.31 800.90 IL-12p70 2.25 2.71 IL-17A 0.15 7.15 IFN-γ 2.74 8.81 TNF-α 2.46 2.25 IFN-α 3.21 1.59
[0218] As can be seen from the above examples, the kit for simultaneously detecting 12 cytokines by the flow cytometry fluorescence technology provided by the present invention can be used to determine the concentrations of IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-17A, IFN-γ, TNF-α, and IFN-α in different samples, which is more convenient for clinical detection and application and improves the accuracy of detection.
[0219] 6. Comparison with Mass Spectrometry Detection Results
[0220] For the same samples, the kit provided in this example and a mass spectrometer were used for detection respectively. The mass spectrometer (purchased from Shimadzu, model LC-MS / 8040) used 0.1% formic acid water and 0.1% formic acid acetonitrile as the mobile phase, an ESI ion source, a nebulizing gas pressure (GS1): 45 Psi, an auxiliary gas pressure: 45 Psi, a curtain gas pressure: 35 Psi, a temperature: 650 °C, a spray voltage: 5000 V (positive ion mode), gradient elution, and the samples to be detected were calibration products. The detection results are shown in Table 20.
[0221] Table 20. Comparison of the Detection Results of the Kit Provided in this Example and Mass Spectrometry (unit: pg / mL)
[0222] Mass Spectrometry Detection Value Detection Value of This Kit IL-1β 40.37 40.35 IL-2 40.69 41.56 IL-4 41.05 40.29 IL-5 41.38 41.33 IL-6 40.66 41.51 IL-8 40.57 40.68 IL-10 40.63 40.76 IL-12p70 41.09 40.32 IL-17A 40.93 41.11
[0223] Example 2: Optimization of the Antibody Variable Region Sequence
[0224] Since IL-17A is the most difficult to detect and is prone to cross-interference with other cytokines, this example takes IL-17A antibody 1 and IL-17A antibody 2 as examples, optimizes the sequence of the complementary determining region (CDR3) in the variable region, constructs multiple recombinant IL-17A antibodies 1 and IL-17A antibodies 2 containing different mutant sequences, and finds a group of antibodies with the best antigen detection accuracy, sensitivity, and lower cross-reactivity.
[0225] 1. Design mutations in the antibody amino acid sequence
[0226] Input the original sequences of Antibody 1 of the IL-17A antibody and Antibody 2 of the IL-17A antibody (Table 9) into the database IgBlast to obtain the CDR3 region sequences of all H / L chains. Subsequently, design 10 - 15 single or multiple amino acid mutations in the CDR3 region with reference to the sequences with higher similarity in the IMGT database.
[0227] For the H-chain DNA sequence of the recombinant IL-17A antibody 1, the corresponding base positions in the CDR3 region are 346 - 384. Ten mutations were designed while the sequences of other regions remained unchanged, as shown in Table 21.
[0228] Table 21. H-chain mutation sequence list of IL-17A antibody 1
[0229]
[0230] For the L-chain DNA sequence of the recombinant IL-17A antibody 1, the corresponding base positions in the CDR3 region are 337 - 363. Fifteen mutations were designed, as shown in Table 22.
[0231] Table 22. L-chain mutation sequence list of IL-17A antibody 1
[0232]
[0233]
[0234] For the H-chain DNA sequence of the recombinant IL-17A antibody 2, the corresponding base positions in the CDR3 region are 346 - 384. Thirteen mutations were designed, as shown in Table 23.
[0235] Table 23. H-chain mutation sequence list of IL-17A antibody 2
[0236]
[0237] For the DNA sequence of the L-chain of the recombinant IL-17A antibody 2, the corresponding base positions in the CDR3 region are 337 - 363. Fourteen mutations were designed, as shown in Table 24.
[0238] Table 24. L-chain mutation sequence list of IL-17A antibody 2
[0239]
[0240]
[0241] 2. Screening of antibody amino acid sequences
[0242] The heavy and light chains of antibodies containing the original sequence and different mutant sequences were pairwise combined and co-transfected for expression (the method was referred to Example 1), obtaining 176 kinds of IL-17A antibody 1 and 210 kinds of IL-17A antibody 2, and the combination methods are shown in Table 25 and Table 26.
[0243] 2.1 Screening of IL-17A antibody 1
[0244] Each time, 1 kind was selected from 176 kinds of IL-17A antibody 1 for detection, and the remaining 23 kinds of antibodies including IL-17A antibody 2 did not undergo amino acid sequence optimization (Seq ID NO:122, Seq ID NO:123, Seq ID NO:124 - Seq ID NO:167). The kit prepared by the method provided in Example 1 was used, and the detection was carried out according to the method provided in Example 1. The concentrations of the detection calibrators were 5000 pg / mL, 2500 pg / mL, 1250 pg / mL, 625 pg / mL, 312 pg / mL, 156 pg / mL, 80 pg / mL, 40 pg / mL, 20 pg / mL, 10 pg / mL, 5 pg / mL, 2.5 pg / mL, 1.25 pg / mL, 0 pg / mL respectively. Each calibrator concentration was tested 5 times, and the mean value (yi) of the detection results was calculated respectively. Taking the calibrator concentration (xi) as the independent variable and the mean value of the detection results (yi) as the dependent variable, a linear regression equation was obtained, and the correlation coefficient ∣R∣ of the linear regression was calculated. The result of the detection calibrator concentration of 5000.00 pg / mL was normalized, defined as: normalized detection result = detection result obtained by pairing mutant sequence antibodies / detection result obtained by antibodies without sequence optimization. Table 25 shows the detection results of each IL-17A antibody 1 for the calibrator concentration of 5000.00 pg / mL, and Table 27 shows the correlation coefficient ∣R∣ of the linear regression calculated from the detection results of each IL-17A antibody 1.
[0245] According to Table 25 and Table 27, the most preferred light and heavy chain combination (IL-17A antibody 1-1) is: the amino acid sequence of the CDR3 region of the H chain is 1H-4 (Seq ID NO:193), and the amino acid sequence of the CDR3 region of the L chain is 1L-8 (Seq ID NO:223). The IL-17A antibody 1 obtained by the combination has the highest detection result for the calibrator concentration of 5000.00 pg / mL, and also has the highest detection results for the remaining lower calibrator concentrations (the detection results of the remaining calibrator concentrations are not shown, only the detection result of IL-17A at 5000.00 pg / mL is shown), indicating that this antibody has the highest affinity. The correlation coefficient ∣R∣ of the linear regression is significantly higher than the results of other mutant sequence antibody pairings, indicating that the detection results of this antibody show a more regular linear change with the calibrator concentration.
[0246] The next light chain and heavy chain combination (IL-17A antibody 1-2) is as follows: The amino acid sequence of the CDR3 region of the H chain is 1H-2 (SeqID NO: 189), and the amino acid sequence of the CDR3 region of the L chain is 1L-8 (Seq ID NO: 223). The detection result of IL-17A antibody 1 obtained by this combination for the calibrator concentration of 5000.00 pg / mL is also relatively high, and it has good detection results for the remaining lower calibrator concentrations (the detection results of the remaining calibrator concentrations are not shown, only the detection result of IL-17A at 5000.00 pg / mL is shown), indicating that this antibody has a relatively high affinity, and the correlation coefficient |R| of the linear regression is also relatively high, demonstrating that the detection result of this antibody is significantly better than that of the antibody before mutation.
[0247] Based on the above two points, it can be determined that the detection accuracy of these two groups of antibodies has been greatly improved compared with that before optimization. Thus, two groups of light chain and heavy chain combinations are selected: The most preferred is: IL-17A antibody 1-1: The amino acid sequence of the H chain is 1H-4 (Seq IDNO: 116), and the amino acid sequence of the L chain is 1L-8 (Seq ID NO: 117); The second is IL-17A antibody 1-2: The amino acid sequence of the H chain is 1H-2 (Seq ID NO: 168), and the amino acid sequence of the L chain is 1L-8 (Seq ID NO: 117).
[0248] 2.2 Screening of IL-17A antibody 2
[0249] Each time, 1 out of 210 IL-17A antibodies 2 is selected for detection. IL-17A antibody 1 uses the sequences obtained from the previous screening (Seq ID NO: 116, Seq ID NO: 117), and the remaining 22 antibodies have not been optimized for the amino acid sequence (Seq IDNO: 124 - Seq ID NO: 167). The same method as the previous screening of IL-17A antibody 1 is used to screen IL-17A antibody 2.
[0250] Table 26 shows the detection results of each IL-17A antibody 2 for the calibrator concentration of 5000.00 pg / mL, and Table 28 shows the correlation coefficient |R| of the linear regression calculated from the detection results of each IL-17A antibody 2.
[0251] According to Tables 26 and 28, the most preferred light and heavy chain combination (IL-17A antibody 2-1) is as follows: the amino acid sequence of the CDR3 region of the H chain is 2H-12 (Seq ID NO: 263), and the amino acid sequence of the CDR3 region of the L chain is 2L-6 (Seq ID NO: 279). The IL-17A antibody 2 obtained by this combination has the highest detection result for the calibrator concentration of 5000.00 pg / mL, and also has the highest detection results for the remaining lower calibrator concentrations (the detection results for the remaining calibrator concentrations are not shown, only the detection result for 5000.00 pg / mL is shown), indicating that this antibody has the highest affinity. The correlation coefficient |R| of the linear regression is relatively ideal compared to the results of other mutant sequence antibody pairings, and is also slightly higher than that of the unoptimized antibody, indicating that the detection result of this antibody changes linearly with the calibrator concentration.
[0252] The second light and heavy chain combination (IL-17A antibody 2-2) is as follows: the amino acid sequence of the CDR3 region of the H chain is 2H-11 (Seq ID NO: 261), and the amino acid sequence of the CDR3 region of the L chain is 2L-6 (Seq ID NO: 279). The IL-17A antibody 2 obtained by this combination also has a relatively high detection result for the calibrator concentration of 5000.00 pg / mL, and has good detection results for the remaining lower calibrator concentrations (the detection results for the remaining calibrator concentrations are not shown, only the detection result for 5000.00 pg / mL of IL-17A is shown), indicating that this antibody has a relatively high affinity. The correlation coefficient |R| of the linear regression is also relatively high, indicating that the detection result of this antibody is significantly better than that of the antibody before mutation.
[0253] Based on the above two points, it can also be determined that the detection accuracy of these two groups of antibodies has been improved to a certain extent compared to before optimization. Thus, two groups of light and heavy chain combinations are selected: The most preferred is: IL-17A antibody 2-1: the amino acid sequence of the H chain is 2H-12 (Seq ID NO: 118), and the amino acid sequence of the L chain is 2L-6 (Seq ID NO: 119); the second is IL-17A antibody 2-2: the amino acid sequence of the H chain is 2H-11 (Seq ID NO: 169), and the amino acid sequence of the L chain is 2L-6 (Seq ID NO: 119).
[0254] Table 25. Results (normalized) of paired detection of mutant sequences of IL-17A antibody 1 for the 5000.00 pg / mL calibrator
[0255] L\H Original 1H-1 1H-2 1H-3 1H-4 1H-5 1H-6 1H-7 1H-8 1H-9 1H-10 Original 1.0 0.7 0.1 0.5 0.8 0.8 1.3 0.5 0.2 0.5 0.2 1L-1 0.7 0.9 1.3 0.5 0.7 0.4 0.3 0.6 0.8 0.6 0.8 1L-2 0.4 0.3 0.0 0.4 1.9 0.1 0.3 0.9 0.2 0.3 0.9 1L-3 0.7 0.5 0.6 0.4 0.5 0.9 0.1 0.1 0.4 0.8 0.4 1L-4 0.7 0.1 0.3 1.3 0.6 0.9 0.0 0.3 0.0 0.2 0.6 1L-5 0.6 0.5 0.6 0.0 0.6 1.1 0.9 0.2 0.2 0.7 0.3 1L-6 0.1 0.1 0.5 0.5 0.6 0.5 0.5 0.6 0.1 0.7 1.3 1L-7 0.4 0.5 0.1 0.7 2.1 0.5 0.7 0.5 0.1 1.4 0.9 1L-8 1.1 2.3 2.5 0.8 2.6 1.8 1.9 2.4 1.1 1.1 0.2 1L-9 1.5 1.2 2.3 0.2 2.4 2.3 1.4 0.5 1.9 0.0 0.7 1L-10 0.4 0.4 0.1 0.9 2.0 0.4 0.9 0.5 0.8 0.8 0.7 1L-11 0.3 0.9 0.7 0.7 0.7 0.6 0.7 0.6 0.9 0.8 0.2 1L-12 0.7 0.6 0.5 1.2 1.1 0.3 1.0 0.0 2.1 0.0 0.3 1L-13 0.8 0.4 1.1 0.1 2.0 0.3 0.8 0.8 0.8 0.5 1.4 1L-14 0.5 2.2 1.5 1.8 1.5 0.5 0.0 0.2 0.5 1.7 0.3 1L-15 0.9 0.3 1.6 0.7 0.2 1.8 1.7 1.2 0.2 0.1 0.1
[0256] Table 26. Results (normalized) of paired detection of mutant sequences of IL-17A antibody 2 for the 5000.00 pg / mL calibrator
[0257]
[0258] Table 27, correlation coefficient ∣R∣ of paired detection results of mutant sequences of IL-17A antibody 1
[0259]
[0260]
[0261] Table 28, correlation coefficient ∣R∣ of paired detection results of mutant sequences of IL-17A antibody 2
[0262]
[0263] 3. Detection sensitivity test
[0264] Using the four groups of IL-17A antibody 1 and IL-17A antibody 2 before and after amino acid sequence optimization described above: (1) IL-17A antibody 1-1, IL-17A antibody 2-1, (2) IL-17A antibody 1-2, IL-17A antibody 2-1, (3) IL-17A antibody 1-1, IL-17A antibody 2-2, (4) IL-17A antibody 1-2, IL-17A antibody 2-2. The kit prepared by the method provided in Example 1 was used to test and calculate the blank limit and detection limit results according to the method provided in Example 1 (Table 29). The blank limit results after amino acid sequence optimization were significantly smaller, and the detection limit results decreased from 2.762 pg / mL to a level similar to that of other cytokines. Therefore, it can be judged that the amino acid sequence optimization has greatly improved the detection sensitivity of IL-17A antibody 1 and IL-17A antibody 2.
[0265] Table 29, blank limit and detection limit results
[0266] Blank limit (pg / mL) Detection limit (pg / mL) After amino acid sequence optimization (1) 0.115 0.416 After amino acid sequence optimization (2) 0.401 0.623 After amino acid sequence optimization (3) 0.639 0.816 After amino acid sequence optimization (4) 0.495 0.672 Before amino acid sequence optimization 1.924 2.762
[0267] It can be seen from Table 29 that the most preferred antibody combination is IL-17A antibody 1-1 and IL-17A antibody 2-1 (Seq ID NO: 116~Seq ID NO: 119), with higher detection sensitivity and accuracy.
[0268] 4. Cross-reactivity test
[0269] The following three groups were used for cross-reactivity test:
[0270] (1) Take 11 cytokine antibodies (Table 1) and 12 recombinant proteins (Seq ID NO: 104~Seq ID NO: 115) after optimization;
[0271] (2) Take the optimized 11 cytokine antibodies (Table 1) and 12 recombinant proteins (Seq ID NO: 104 - Seq ID NO: 115), and use the IL-17A antibody 1 and IL-17A antibody 2 before the amino acid sequence optimization (Seq ID NO: 120 - Seq ID NO: 123) described above;
[0272] (3) Take the optimized 11 cytokine antibodies and 12 recombinant proteins, and use the IL-17A antibody 1 and IL-17A antibody 2 after the amino acid sequence optimization (Seq ID NO: 116 - Seq ID NO: 119) described above;
[0273] Use the kit prepared by the method provided in Example 1 and perform the detection according to the method provided in Example 1. The concentrations of the 12 cytokine detection calibrators are 5000 pg / mL, 2500 pg / mL, 1250 pg / mL, 625 pg / mL, 312 pg / mL, 156 pg / mL, 80 pg / mL, 40 pg / mL, 20 pg / mL, 10 pg / mL, 5 pg / mL, 2.5 pg / mL, 1.25 pg / mL, 0 pg / mL respectively. Each calibrator concentration is tested 5 times, and the mean value of the detection results is calculated respectively. Test the influence of the IL-17A amino acid sequence before and after optimization on the test results of 11 cytokines. As shown in Table 30-1, there is no cross-reaction among the other 11 cytokines after nucleotide sequence optimization; as shown in Table 30-2, IL-17A before amino acid sequence mutation still has cross-reactivity with IL-6 and IL-1β (when the concentration is 0, the detected fluorescence signal value (MFI) is already greater than 1000); as shown in Table 30-3, IL-17A after amino acid sequence mutation has no cross-reaction with the other 11 cytokines.
[0274] Table 30-1. Cross-reaction free results (MFI) of the other 11 cytokines
[0275] Concentration IL-2 IL-4 IL-6 IL-10 TNF-a IFN-γ IL-1β IL-5 IL-12p70 IFN-α IL-8 0 333 157 207 113 121 105 134 135 216 110 125 1.25 449 271 263 184 227 183 289 264 312 168 214 2.5 605 465 347 351 386 343 493 537. 489 289 369 5 854 846 458 513 699 615 753 1111 822 455 676 10 1212 1366 659 810 1057 961 1139 1790 1170 683 1076 20 2051 2425 1075 1414 1859 1889 2018 3209 2073 1193 1976 40 3573 4367 1884 2473 3587 3397 3697 5803 3809 2223 3630 80 6169 8563 3129 4526 6908 6471 6936 10705 6726 4083 7474 156 12391 17327 5965 11507 13589 14569 14569 24477 12981 7972 15332 312 22688 34619 11431 25189 26577 28168 27423 42810 25404 15959 29241 625 45354 65121 19453 49883 44276 51894 49808 63185 45103 30087 57796 1250 95695 135989 40822 107853 102905 102591 114118 154663 93235 62061 104942 2500 171659 245531 83835 225839 205654 206717 226875 285992 179627 124212 203646 5000 357146 479696 165613 459671 396687 389783 435631 574632 348924 234768 388670
[0276] Table 30-2. Cross-reaction results (MFI) of IL-17A antibody 1 and IL-17A antibody 2 before amino acid sequence optimization with the other 11 cytokines
[0277]
[0278]
[0279] Table 30-3, Cross-reactivity results (MFI) of IL-17A antibody 1 and IL-17A antibody 2 with 11 other cytokines after amino acid sequence optimization
[0280]
[0281] Example 3, Screening of Antibody 1 and Antibody 2
[0282] The kit for simultaneous detection of 12 cytokines provided by the present invention requires the use of antibodies in both the antibody solution conjugated to microspheres and the antibody solution labeled with fluorescence. Research has shown that different antibodies are preferably used for the antibody conjugated to microspheres and the antibody labeled with fluorescence. In this example, the two optimal antibodies screened in Example 2 are respectively used. However, which antibody is used to prepare the antibody solution conjugated to microspheres and which antibody is used to prepare the antibody solution labeled with fluorescence still need to be further explored.
[0283] In this example, the kit is prepared by the following two methods respectively: 1. Antibody 1 is conjugated to microspheres and antibody 2 is conjugated to phycoerythrin fluorescein; 2. Antibody 2 is conjugated to microspheres and antibody 1 is conjugated to phycoerythrin fluorescein. The remaining preparation methods are the same as those in Example 1, and the detection is carried out using the method provided in Example 1. The detection sample is a calibrator with a concentration of 40 pg / mL for each cytokine, and the detection results are shown in Table 31.
[0284] Table 31, Screening of Antibody 1 and Antibody 2 (unit: pg / mL)
[0285]
[0286]
[0287] It can be seen from Table 31 that the detection results of the 12 cytokines are significantly more accurate with the combination option of Method 1, which can significantly improve the detection sensitivity and accuracy of the 12 cytokines and can truly achieve only one incubation and one washing in the whole detection process. Therefore, it is preferably to conjugate antibody 1 to microspheres and antibody 2 to phycoerythrin fluorescein.
[0288] Example 4: Influence of 24 antibody sequences before and after optimization on the detection results of 12 cytokines
[0289] In this example, the kits prepared with the re-engineered antibodies with optimized sequences in Example 1 (Table 1 in Example 1) and the kits prepared with antibodies of the original sequences (Table 9 in Example 1, monoclonal antibodies directly prepared from hybridoma cell lines) were used to detect 12 cytokines. Among them, the incubation process adopted the one-step incubation method (Example 1), and 10 repeated detections were carried out for each group to investigate the repeatability. The test samples were plasma samples (detected by mass spectrometry, and the contents of 12 cytokines were all between 0.39 and 21.56 pg / mL). The test results are shown in Table 32.
[0290] Table 32. Comparison of test results before and after optimization (pg / mL)
[0291]
[0292] As can be seen from Table 32, when using the antibody preparation kits before sequence optimization to detect 12 cytokines, some cytokines are prone to false positives (such as IL-1β, IL-4, IL-6, etc., and the test results are on the high side). The main reason is non-specific binding. Some cytokines are not easy to accurately detect (such as IL-10, IL-17A, IFN-α, etc., and the test results are on the low side), and the test results are unstable with poor repeatability, thus affecting the accuracy of the test results. The kits prepared with the re-engineered antibodies can significantly improve the accuracy of the detection results of 12 cytokines, eliminate the batch-to-batch difference, and improve the accuracy of repeated detections.
[0293] Example 5: Selection of one-step incubation process
[0294] In this example, the kits prepared in Example 1, the kits prepared with the original sequences (Table 9 in Example 1), and the commercially available kits (12-cytokine detection kit (multiplex bead-based flow cytometric immunoassay fluorescence luminescence method) produced by Qingdao Risikel Biotechnology Co., Ltd., IFN-γ, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12p70, IL-17A, IL-17F, IL-22, TNFα, TNFβ detection kits (immunofluorescence luminescence method) produced by Tianjin Kuangbo Tongsheng Biotechnology Co., Ltd., 12-cytokine detection kit (magnetic particle luminescence method) produced by Nanjing Aituo Life Technology Co., Ltd., 12-cytokine determination kit (flow fluorescence luminescence method) produced by Chongqing Boshengte Biotechnology Co., Ltd.) were used to detect 12 cytokines. Among them, the incubation process adopted the one-step incubation method (Example 1) and the two-step incubation method.
[0295] The operation steps of the two-step incubation method are as follows: (1) Add 25 μL of the antibody solution conjugated with microspheres and 25 μL of the sample to each tube, mix well, and let stand at room temperature in the dark for 1.5 h;
[0296] (2) Add 1000 μL of 1× washing buffer (single wash), resuspend the microspheres by vortexing, mix well, and centrifuge to remove the supernatant.
[0297] (3) Add 25 μL of the fluorescently labeled antibody solution to each tube, mix well, and incubate in the dark at room temperature for 1.5 h (two-step incubation).
[0298] The test sample was a plasma sample (with a content of 20.01 pg / mL detected by mass spectrometry). The test results are shown in Table 33. Since among the 12 cytokines, the effect on IL-17A was the most obvious, the test results of IL-17A were taken as an example here, and 10 repeated tests were carried out, and the average value was taken.
[0299] Table 33. Test results of different incubation methods (pg / mL)
[0300] IL-17A test result One-step incubation method Two-step incubation method Kit prepared in Example 1 20.03 20.02 Kit prepared with the original sequence 15.13 16.57 Qingdao Risikel 15.36 17.36 Tianjin Kuangbo 16.17 19.57 Nanjing Aituo 15.21 18.36 Chongqing Boshengte 17.69 19.17
[0301] It can be seen from Table 33 that the kit prepared by the present invention can accurately detect by using the one-step incubation method, while the test results of the kits purchased on the market by the one-step incubation method are seriously low, and even the two-step incubation method still cannot achieve the effect of the one-step incubation of the kit of the present invention.
[0302] Example 6: Influence of plasma samples and serum samples on test results
[0303] In this example, the kits prepared in Example 1, the kits prepared with the original sequence (Table 9 in Example 1), and the kits purchased on the market (the twelve-cytokine detection kit (flow cytometry fluorescence luminescence method) produced by Hunan Weigong Biotechnology Co., Ltd., the twelve-cytokine detection kit (magnetic particle luminescence method) produced by Nanjing Aituo Life Technology Co., Ltd.) were used to detect 12 cytokines. Among them, the test samples were respectively two types: plasma samples or serum samples. The preparation method of the plasma sample was with EDTA anticoagulant, and the preparation method of the serum sample was with Orsin coagulant.
[0304] The test samples were homologous plasma and serum samples with a concentration of 40.05 pg / mL (detected by mass spectrometry). The test results are shown in Table 34. Since among the 12 cytokines, the effect on IL-17A was the most obvious, the test results of IL-17A were taken as an example here, and 10 repeated tests were carried out, and the average value was taken.
[0305] Table 34. Influence of plasma samples and serum samples on test results (pg / mL)
[0306] IL-17A test result Plasma sample Serum sample Kit prepared in Example 1 40.19 40.31 Kit prepared with the original sequence 30.36 43.13 Hunan Weigong 46.37 40.67 Nanjing Aituo 36.39 42.19
[0307] As can be seen from Table 34, for the kit prepared by the present invention, accurate detection can be achieved using either plasma samples or serum samples. However, for the kits purchased on the market, there are obvious differences in the detection results of plasma samples and serum samples, and simultaneous detection of plasma samples and serum samples cannot be achieved. It can be seen that for the kit provided by the present invention, due to the optimization of the antibody sequence, the binding force between the antibody and the protein to be detected is stronger, and cross-interference is reduced, enabling simultaneous detection of plasma samples and serum samples, providing more convenience for clinical detection.
[0308] Example 7: Selection of microsphere buffer
[0309] In this example, a kit for simultaneously detecting 12 cytokines based on a flow cytometer was prepared according to the method provided in Example 1. For the optimized microsphere-conjugated antibody solution, the formulation of the microsphere buffer also needs to be further optimized. Different formulations of microsphere buffer shown in Table 35 were used respectively. The samples to be detected were calibration products with a concentration of 40 pg / mL for each cytokine and 5 low-value samples with concentrations approximately close to the detection limit. Detection was carried out according to the one-step incubation method provided in Example 1 to investigate the influence of different microsphere buffers on the detection results of 12 cytokines. Since the trends of the detection results of 12 cytokines are relatively consistent, the detection results of IL-17A were used as an example in this example, and 10 repeated detections were carried out to investigate the repeatability.
[0310] Table 35. Influence of different microsphere buffers on detection results (buffer concentration according to Example 1)
[0311]
[0312] As can be seen from Table 35, after optimizing the sequences of 24 antibodies, the formulation of the microsphere buffer also needs to be further optimized to achieve better detection sensitivity. Therefore, the most preferred formulation of the microsphere buffer is: KH 2 PO 4 、Na 2 HPO 4 ·12H 2 O, NaCl, KCl, BSA, ProClin300, Tween-20 and PVP-k30.
[0313] Example 8: Selection of washing buffer
[0314] In this example, a kit for simultaneously detecting 12 cytokines based on a flow cytometer was prepared according to the method provided in Example 1, and the formula of the washing buffer was further optimized. The washing buffer was respectively the washing buffer with different formulas shown in Table 36. The test samples were calibration products with a concentration of 40 pg / mL for each cytokine and 5 low-value samples with concentrations approximately at the detection limit. Detection was carried out according to the one-step incubation method provided in Example 1 to investigate the influence of different washing buffers on the detection results of 12 cytokines. Since the trends of the detection results of 12 cytokines were relatively consistent, the detection results of IL-17A were used as an example in this example, and 10 repeated detections were carried out to investigate the repeatability.
[0315] Table 36. Influence of Different Washing Buffers on Detection Results (Buffer Concentration According to Example 1)
[0316] Washing buffer IL-17A (pg / mL) Detection limit (pg / mL) CV Tris + NaCl + Casein + ProClin300 + Tween-80 35.07 0.617 7.6% Tris + NaCl + BSA + ProClin300 + Tween-80 36.19 0.545 7.9% Tris + NaCl + BSA + ProClin300 + Tween-20 38.22 0.496 6.5% Tris + NaCl + BSA + ProClin300 + Dow Corning-1520 38.89 0.576 5.9% Tris + NaCl + BSA + ProClin300 + A504007 38.02 0.541 5.3% Tris + NaCl + BSA + ProClin300 + Tween-20 + A504007 38.95 0.502 3.4% Tris + NaCl + BSA + ProClin300 + Tween-20 + Dow Corning-1520 40.03 0.416 2.6%
[0317] It can be seen from Table 36 that after optimizing 24 antibody sequences, the formula of the washing buffer also needs to be further optimized to achieve better detection sensitivity. In this example, it was found through research that adding an antifoaming agent to the washing buffer helps to improve the detection sensitivity. The reason is that the washing buffer contains BSA, and bubbles will appear during the vortex mixing process after adding the washing buffer, which will lead to residues on the wall of the flow cytometer and errors in the aspirated volume. Adding an antifoaming agent can avoid generating this part of the bubbles, which helps to reduce errors and improve the detection sensitivity. And through comparison, it was found that compared with other antifoaming agents (such as A504007 (non-ionic T-F composite fermentation antifoaming agent)), using Dow Corning-1520 is more helpful for improving the detection sensitivity of 12 cytokines. Therefore, the most preferred formula of the washing buffer is: Tris, NaCl, BSA, ProClin300, Tween-20, Dow Corning-1520.
[0318] Although the present invention is disclosed as above, the present invention is not limited thereto. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be subject to the scope defined by the claims.
Claims
1. A kit for detecting 12 cytokines based on a flow cytometer, characterized in that, it includes: an antibody solution conjugated with microspheres, a fluorescently labeled antibody solution, a microsphere buffer, a sample diluent, and a wash buffer; the antibody in the antibody solution conjugated with microspheres is Antibody 1, and the antibody in the fluorescently labeled antibody solution is Antibody 2; Antibody 1 includes IL-1β Antibody 1, IL-2 Antibody 1, IL-4 Antibody 1, IL-5 Antibody 1, IL-6 Antibody 1, IL-8 Antibody 1, IL-10 Antibody 1, IL-12p70 Antibody 1, IL-17A Antibody 1, IFN-γ Antibody 1, TNF-α Antibody 1, and IFN-α Antibody 1; Antibody 2 includes IL-1β Antibody 2, IL-2 Antibody 2, IL-4 Antibody 2, IL-5 Antibody 2, IL-6 Antibody 2, IL-8 Antibody 2, IL-10 Antibody 2, IL-12p70 Antibody 2, IL-17A Antibody 2, IFN-γ Antibody 2, TNF-α Antibody 2, and IFN-α Antibody 2; the amino acid sequence of the CDR3 region of the heavy chain of IL-17A Antibody 1 is as shown in Seq ID NO:193 or Seq ID NO:189, and the amino acid sequence of the CDR3 region of the light chain is as shown in Seq ID NO:223; the amino acid sequence of the CDR3 region of the heavy chain of IL-17A Antibody 2 is as shown in Seq ID NO:263 or Seq ID NO:261, and the amino acid sequence of the CDR3 region of the light chain is as shown in Seq ID NO:
279.
2. The kit according to claim 1, characterized in that, the amino acid sequence of the heavy chain of IL-17A Antibody 1 is as shown in Seq ID NO:116 or Seq ID NO:168, the amino acid sequence of the light chain is as shown in Seq ID NO:117, the amino acid sequence of the heavy chain of IL-17A Antibody 2 is as shown in Seq ID NO:118 or Seq ID NO:169, and the amino acid sequence of the light chain is as shown in SeqID NO:
119.
3. The kit according to claim 2, characterized in that, The amino acid sequence of the heavy chain of the IL-17A antibody 1 is shown in Seq ID NO:116, and the amino acid sequence of the light chain is shown in Seq ID NO:
117. The amino acid sequence of the heavy chain of the IL-17A antibody 2 is shown in Seq ID NO:118, and the amino acid sequence of the light chain is shown in Seq ID NO:119; or the amino acid sequence of the heavy chain of the IL-17A antibody 1 is shown in Seq ID NO:168, and the amino acid sequence of the light chain is shown in Seq ID NO:
117. The amino acid sequence of the heavy chain of the IL-17A antibody 2 is shown in Seq ID NO:118, and the amino acid sequence of the light chain is shown in Seq ID NO:119; or the amino acid sequence of the heavy chain of the IL-17A antibody 1 is shown in Seq ID NO:116, and the amino acid sequence of the light chain is shown in Seq ID NO:
117. The amino acid sequence of the heavy chain of the IL-17A antibody 2 is shown in Seq ID NO:169, and the amino acid sequence of the light chain is shown in Seq ID NO:119; or the amino acid sequence of the heavy chain of the IL-17A antibody 1 is shown in Seq ID NO:168, and the amino acid sequence of the light chain is shown in Seq ID NO:
117. The amino acid sequence of the heavy chain of the IL-17A antibody 2 is shown in Seq ID NO:169, and the amino acid sequence of the light chain is shown in Seq ID NO:
119.
4. The kit according to claim 3, characterized in that The antibody solution labeled with fluorescence is the antibody solution labeled with phycoerythrin; the microsphere buffer solution comprises 0.2-0.3% KH 2 PO 4 、3-4% Na 2 HPO 4 ·12H 2 O, 0.5-1.0% NaCl, 0.1-0.5% KCl, 2-4% BSA, 0.1-0.2% ProClin300, 0.05-0.1% Tween-20 and 0.1-0.3% PVP-k30.
5. The kit according to claim 3, characterized in that the washing buffer comprises 0.3-0.4% Tris, 0.8-1.2% NaCl, 1.5-3% BSA, 0.08-0.12% ProClin300, 0.05-0.1% Tween-20 and 0.01-0.02% Dow Corning-1520.
6. A preparation method of a kit for detecting 12 cytokines based on a flow cytometer, characterized in that it comprises the following steps: Step (1): Construct a recombinant vector containing the heavy and light chains of an antibody, express it through a eukaryotic expression system, and prepare a recombinant antibody. The recombinant antibody includes Antibody 1 and Antibody 2. Antibody 1 includes IL-1β Antibody 1, IL-2 Antibody 1, IL-4 Antibody 1, IL-5 Antibody 1, IL-6 Antibody 1, IL-8 Antibody 1, IL-10 Antibody 1, IL-12p70 Antibody 1, IL-17A Antibody 1, IFN-γ Antibody 1, TNF-α Antibody 1, and IFN-α Antibody 1; Antibody 2 includes IL-1β Antibody 2, IL-2 Antibody 2, IL-4 Antibody 2, IL-5 Antibody 2, IL-6 Antibody 2, IL-8 Antibody 2, IL-10 Antibody 2, IL-12p70 Antibody 2, IL-17A Antibody 2, IFN-γ Antibody 2, TNF-α Antibody 2, and IFN-α Antibody 2; the amino acid sequence of the CDR3 region of the heavy chain of IL-17A Antibody 1 is as shown in Seq ID NO:193 or Seq ID NO:189, and the amino acid sequence of the CDR3 region of the light chain is as shown in Seq ID NO:223; the amino acid sequence of the CDR3 region of the heavy chain of IL-17A Antibody 2 is as shown in Seq ID NO:263 or Seq ID NO:261, and the amino acid sequence of the CDR3 region of the light chain is as shown in Seq ID NO:279; Step (2): Using the recombinant antibody, prepare an antibody solution conjugated with microspheres and a fluorescently labeled antibody solution. The antibody in the antibody solution conjugated with microspheres is Antibody 1, and the antibody in the fluorescently labeled antibody solution is Antibody 2.
7. A method for detecting 12 cytokines based on a flow cytometer, characterized in that, using the kit according to any one of claims 1 to 5 for a one-step incubation method, including the following steps: Step (a): Take a test sample, and respectively add the antibody solution conjugated with microspheres, the fluorescently labeled antibody solution, and the microsphere buffer, and incubate; Step (b): Add the washing buffer to wash, centrifuge, and wait for detection.
8. The method according to claim 7, characterized in that, the test sample is one or both of a plasma sample and a serum sample.
9. Use of a group of recombinant antibodies for preparing a reagent for simultaneously detecting 12 cytokines in a blood sample based on a flow cytometer by a one-step incubation method, characterized in that, The recombinant antibody includes antibody 1 and antibody 2; antibody 1 includes anti-IL-1β antibody 1, anti-IL-2 antibody 1, anti-IL-4 antibody 1, anti-IL-5 antibody 1, anti-IL-6 antibody 1, anti-IL-8 antibody 1, anti-IL-10 antibody 1, anti-IL-12p70 antibody 1, anti-IL-17A antibody 1, anti-IFN-γ antibody 1, anti-TNF-α antibody 1 and anti-IFN-α antibody 1; antibody 2 includes anti-IL-1β antibody 2, anti-IL-2 antibody 2, anti-IL-4 antibody 2, anti-IL-5 antibody 2, anti-IL-6 antibody 2, anti-IL-8 antibody 2, anti-IL-10 antibody 2, anti-IL-12p70 antibody 2, anti-IL-17A antibody 2, anti-IFN-γ antibody 2, anti-TNF-α antibody 2 and anti-IFN-α antibody 2; the amino acid sequence of the CDR3 region of the heavy chain of anti-IL-17A antibody 1 is as shown in Seq ID NO:193 or Seq ID NO:189, and the amino acid sequence of the CDR3 region of the light chain is as shown in Seq ID NO:223; the amino acid sequence of the CDR3 region of the heavy chain of anti-IL-17A antibody 2 is as shown in Seq ID NO:263 or Seq ID NO:261, and the amino acid sequence of the CDR3 region of the light chain is as shown in Seq ID NO:
279.
10. Use of a group of recombinant antibodies for preparing a reagent for improving the accuracy of simultaneously detecting 12 cytokines in a blood sample by a flow cytometer, Characterized in that, The recombinant antibody includes antibody 1 and antibody 2; antibody 1 includes anti-IL-1β antibody 1, anti-IL-2 antibody 1, anti-IL-4 antibody 1, anti-IL-5 antibody 1, anti-IL-6 antibody 1, anti-IL-8 antibody 1, anti-IL-10 antibody 1, anti-IL-12p70 antibody 1, anti-IL-17A antibody 1, anti-IFN-γ antibody 1, anti-TNF-α antibody 1 and anti-IFN-α antibody 1; antibody 2 includes anti-IL-1β antibody 2, anti-IL-2 antibody 2, anti-IL-4 antibody 2, anti-IL-5 antibody 2, anti-IL-6 antibody 2, anti-IL-8 antibody 2, anti-IL-10 antibody 2, anti-IL-12p70 antibody 2, anti-IL-17A antibody 2, anti-IFN-γ antibody 2, anti-TNF-α antibody 2 and anti-IFN-α antibody 2; the amino acid sequence of the CDR3 region of the heavy chain of anti-IL-17A antibody 1 is as shown in Seq ID NO:193 or Seq ID NO:189, and the amino acid sequence of the CDR3 region of the light chain is as shown in Seq ID NO:223; the amino acid sequence of the CDR3 region of the heavy chain of anti-IL-17A antibody 2 is as shown in Seq ID NO:263 or Seq ID NO:261, and the amino acid sequence of the CDR3 region of the light chain is as shown in Seq ID NO:279.
Citation Information
Patent Citations
Kit for joint detection of cytokines and immune cells in perinatal umbilical cord blood and use method of kit
CN114636824A
Method and kit for simultaneously and quantitatively detecting twelve cell factors
CN115015561A