OsABCA2 gene mutants and their application in improving rice resistance to brown planthopper

Abstract

The present invention provides an OsABCA2 gene mutant and its use in improving rice resistance to brown planthoppers, belonging to the field of agricultural biotechnology. To enhance rice resistance to brown planthoppers, the present invention utilizes CRISPR / Cas9 gene editing technology to introduce a mutation at a specific location in the OsABCA2 gene, thereby obtaining rice plants bearing this mutation. Testing of these mutant rice plants for mutation type, insect resistance, and phenotype revealed that rice plants containing the OsABCA2 gene mutant exhibited significantly enhanced resistance to brown planthoppers. The use of this gene mutant promotes high rice yields by enhancing rice resistance to insects, thus possessing great agricultural production potential.

Description

Technical Field

[0001] The invention belongs to the field of agricultural science and technology, and in particular relates to an OsABCA2 gene mutant and an application thereof in improving the resistance of rice to brown planthoppers. Background Art

[0002] Gene-editing technologies, such as CRISPR / Cas9, offer a new avenue for targeted improvement of insect resistance in rice due to their high efficiency and precision. This technology enables precise site-specific editing of target genes through the assembly of guide RNAs and nucleases, thereby improving specific traits. This study focused on the rice defense response to brown planthopper infestation. Transcriptome analysis identified differentially expressed genes induced by brown planthopper feeding and revealed that OsABCA2, a member of the ABC transporter family, was significantly upregulated in response to insect infestation. Scientists have found that the ABC protein family is widely involved in plant stress tolerance, secondary metabolite transport, and immune signaling. Therefore, we hypothesized that OsABCA2 may play a key role in rice immune responses, particularly in insect resistance. To test this hypothesis, we used CRISPR / Cas9 technology to generate an OsABCA2 knockout mutant. Results showed that the OsABCA2 mutant exhibited significantly improved resistance to brown planthoppers compared to standard rice. This result reveals the negative regulatory role of OsABCA2 in the rice-brown planthopper interaction, provides a theoretical basis and technical support for analyzing the molecular mechanism of insect resistance and creating non-chemically dependent insect-resistant rice varieties, and is of great significance for promoting sustainable agricultural development. Summary of the Invention

[0003] To address the aforementioned deficiencies and shortcomings of the prior art, the present invention provides an OsABCA2 gene mutant and its use in improving rice resistance to brown planthoppers. By using gene editing technology to target and modify specific mutation sites in the OsABCA2 gene, mutant plants with significantly enhanced resistance are obtained. This mutant can be directly used in the breeding of rice varieties with high brown planthopper resistance, effectively increasing yield while improving crop resistance, providing a highly efficient technical approach for insect-resistant rice breeding.

[0004] To solve the above technical problems:

[0005] The first object of the present invention is to provide an OsABCA2 gene mutant, wherein the gene sequence of the mutation site of the OsABCA2 gene is shown in SEQ ID NO. 4.

[0006] Furthermore, the gene sequence of OsABCA2 is shown in SEQ ID NO.1 (7403 bp, including 5' / 3' regulatory regions, 16 exons and 15 introns), the corresponding mRNA sequence is shown in SEQ ID NO.2, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.3.

[0007] The second object of the present invention is to provide a use of the above-mentioned OsABCA2 gene mutant in improving the resistance of rice to brown planthoppers.

[0008] The third object of the present invention is to provide a use of the above-mentioned OsABCA2 gene mutant in breeding rice resistant to brown planthoppers.

[0009] Further, it is determined whether the rice plant contains the mutation site gene sequence shown in SEQ ID NO. 4.

[0010] Furthermore, the base sequences of specific primers for identifying whether plants contain the gene sequence of the mutation site in the OsABCA2 gene are shown in SEQ ID NO. 7 or SEQ ID NO. 8. Through specific primer amplification and sequencing comparison, it is possible to quickly identify whether the mutation site in wild-type rice is a mutant, thereby achieving efficient screening of resistant rice plants.

[0011] The fourth object of the present invention is to provide a recombinant vector or transgenic cell containing the above-mentioned OsABCA2 gene mutant as shown in SEQ ID NO. 9.

[0012] A fifth object of the present invention is to provide a method for breeding rice resistant to brown planthoppers, comprising the following steps:

[0013] Determine the mutation site of the OsABCA2 gene, the gene sequence of the mutation site is shown in SEQ ID NO. 4;

[0014] Agrobacterium EHA105 was transformed with pBWA(v)Hu-ylcas-abca2, and rice callus was infected to differentiate into T0 generation plants. Subsequently, an 820 bp target fragment was amplified using specific primers with base sequences as shown in SEQ ID NO. 7 and SEQ ID NO. 8. Positive homozygous mutants were screened by sequencing, and stable genetic strains were obtained after multiple generations of culture.

[0015] Beneficial technical effects achieved by the present invention include: providing an OsABCA2 gene mutant and its use in improving rice resistance to brown planthoppers. To enhance rice resistance to brown planthoppers, the present invention utilizes CRISPR / Cas9 gene editing technology to introduce a mutation at a specific location in the OsABCA2 gene, thereby obtaining rice plants bearing this mutation. Testing of these mutant rice plants for mutation type, insect resistance, and phenotype revealed that rice plants harboring the OsABCA2 gene mutant exhibited significantly enhanced resistance to brown planthoppers. The application of this gene mutant promotes high rice yields by enhancing rice resistance, thus possessing significant agricultural production potential.

[0016] On this basis, the present invention also provides a new method for breeding rice resistant to brown planthoppers. By detecting whether rice plants carry a specific mutation site gene sequence, it is possible to quickly screen out high-quality plants with strong resistance and promptly eliminate plants with poor resistance, thereby improving seed selection efficiency and saving significant breeding costs. This method makes the breeding process for rice resistant to brown planthoppers more efficient and accurate, providing a faster and more effective technical means for insect-resistant rice breeding in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a map of the recombinant vector pBWA(v)Hu-ylcas-abca2 of the present invention;

[0018] Figure 2 The mRNA expression levels of the OsABCA2 gene of the present invention at different time points after brown planthoppers feed on rice; "**" indicates a difference of more than 2 times between the treatment group and the control group;

[0019] Figure 3 The amino acid sequence of the protein expressed after the OsABCA2 gene mutation in the OsABCA2 gene mutant rice is shown in Figure 2. The gray shaded area indicates the same amino acid sequence.

[0020] Figure 4 Figure 4A shows the effect of OsABCA2 mutants on brown planthopper resistance in rice. 4B shows the effect on nymph survival, 4C shows the effect on egg production by female adults, 4D shows the feeding selectivity of abca2-6 plants on female adults, 4E shows the effect of abca2-6 plants on egg production, 4F shows the feeding selectivity of abca2-12 plants on female adults, and 4G shows the effect of abca2-12 plants on egg production. ** indicates a highly significant difference between the treatment and control groups.

[0021] Figure 5The data are the test statistics of rice growth and development indicators of OsABCA2 gene mutants, among which 5A is the effect on germination rate, 5B is the effect on plant height, and 5C is the growth phenotype of rice. DETAILED DESCRIPTION

[0022] The present invention will be further described below in conjunction with specific examples. The following examples are only used to more clearly illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention.

[0023] The present invention is further described below with reference to the accompanying drawings and embodiments.

[0024] Example 1 Detection of the mRNA expression level of the OsABCA2 gene at different time points when brown planthoppers feed on rice

[0025] Currently, no studies have reported on the response of the OsABCA2 gene to insect feeding on rice. This example examined the mRNA expression levels of the OsABCA2 gene at different time points during brown planthopper feeding on rice to verify its association with brown planthopper feeding. The experimental procedure is as follows:

[0026] Xiushui 11 rice varieties (from Jiaxing Academy of Agricultural Sciences) were selected and uniformly grown for approximately 50 days. Glass tubes (8 cm high, 4 cm in diameter) with small holes were placed at the base of the stems. Twenty egg-laden female brown planthoppers were placed inside the tubes for feeding, and the tube openings were sealed with breathable sponges. After feeding for 1, 3, 8, 24, and 48 hours, the outermost three layers of the leaf sheath were collected and quickly frozen in liquid nitrogen for RNA extraction. Each experiment was performed with three biological replicates, each consisting of five randomly selected plants. Reverse transcription was followed by quantitative PCR (reaction protocol: 95°C for 30 seconds, 95°C for 5 seconds, 60°C for 30 seconds, 40 cycles). The primers for the OsABCA2 gene were: forward primer (F) as shown in SEQ ID NO. 10: 5'-TTCAAGGAGTTCGCTCACCC-3'; reverse primer (R) as shown in SEQ ID NO. 11: 5'-ATGTGACGAAAGCCTCCCAG-3'. As an internal reference gene, the Osactin gene of rice was selected: the forward primer (F) is shown in SEQ ID NO. 12: 5'-CTGGTATTGCTGACCGTAT-3', and the reverse primer (R) is shown in SEQ ID NO. 13: 5'-GTTGGAAGGTGCTAAGGGA-3'.

[0027] The experiment used the control group that did not eat rice. The relative expression of OsABCA2 gene mRNA was calculated by the method. Figure 2As shown: After 1, 3, 8, 24, and 48 hours of feeding by brown planthoppers, the expression level of OsABCA2 gene was significantly higher than that of the control group, indicating that brown planthopper feeding significantly induced the expression of OsABCA2 gene in rice.

[0028] Example 2 Cultivation of OsABCA2 gene mutant plants

[0029] As shown in Example 1, brown planthoppers feeding on rice significantly increases the expression level of the OsABCA2 gene. Therefore, this example uses gene editing technology to mutate the OsABCA2 gene to improve rice resistance to brown planthoppers. The breeding process is as follows:

[0030] (1) Determine the gene sequence at the mutation site: The wild-type OsABC gene sequence (as shown in SEQ ID NO. 1) was searched through the Nipponbare rice genome database, and the mutation site (as shown in SEQ ID NO. 4) was determined using CRISPR / Cas9 technology.

[0031] (2) Construction of OsABCA2 gene mutant rice: The whole gene was synthesized into an sgRNA expression cassette, and the primer combination abca2-F (as shown in SEQ ID NO. 5) and abca2-R (as shown in SEQ ID NO. 6) was used to connect the expression cassette to the plant binary vector pBWA(v)Hu-ylcas carrying the Cas9 gene through the BsaI endonuclease to obtain the recombinant vector pBWA(v)Hu-ylcas-abca2 (partial vector sequence is shown in SEQ ID NO. 9), the spectrum of which is shown in the figure below. Figure 1 The correctly sequenced plasmid was then transfected with Agrobacterium tumefaciens EHA105, which then infected callus tissue from rice cultivar Nipponbare. After differentiation and rooting, the rice seedlings were transplanted into pots to obtain T0 generation rice.

[0032] (3) Mutant Detection: When T0 rice plants reached the 3-leaf stage, leaf DNA was extracted. The mutation site fragments were cloned using detection primers (as shown in SEQ ID NO. 7 and SEQ ID NO. 8) and sequenced for alignment. The sequencing results are shown in Table 1.

[0033] Table 1

[0034] Test seedling number Genotype analysis Mutation type abca2-3 <![CDATA[Allele1:CCGCCTA A CCGCAACGTCCCCGAC (Insert A) Allele 2: CCGCCTA T CCGCAACGTCCCCGAC (insert T)]]> base insertion heterozygous mutation abca2-4 Allele1:CCGCCTACCGCAACGTCCCCGACAllele2:CCGCCTACCGCAACGTCCCCGAC No mutation abca2-5 Allele1: CCGCCTA---------------------------GC (50bp deletion) Allele2: CCGCCTA---------------------------GC (50bp deletion) Homozygous base deletion mutation abca2-6 Allele1: CCGCCT-----------------------------GA (55bp deletion) Allele2: CCGCCT-----------------------------GA (55bp deletion) Homozygous base deletion mutation abca2-12 <![CDATA[Allele1:CCGCCT T ACCGCAACGTCCCCGAC (insert T) Allele 2: CCGCCT T ACCGCAACGTCCCCGAC (insert T)]]> Homozygous base insertion mutation abca2-18 Allele1: CCGCCT----------------------TT (49 bp deletion and T insertion) Allele2: CCGCCT----------------------TT (49 bp deletion and T insertion) Homozygous base deletion and insertion mutation abca2-24 Allele1:CCGCCTACCGCAACGTCCCCGACAllele2:CCGCCTACCGCAACGTCCCCGAC No mutation abca2-27 Allele1: CCGC--------------------------------------GA (58bp deletion) Allele2: CCGC--------------------------------------GA (58bp deletion) Homozygous base deletion mutation

[0035] The results are shown in Table 1: Excluding some browned seedlings during the genetic transformation process, a total of 8 rice seedlings were obtained in the T0 generation, with a mutation rate of 75% and a homozygous mutation rate of 62.5%. Target site analysis showed that one homozygous line (abca2-12) had a base insertion, three (abca2-5 / 6 / 27) had a base deletion, and one (abca2-18) had both insertions and deletions. After phenotypic screening, the homozygous mutants abca2-6 (deletion type) and abca2-12 (insertion type) that had no significant differences from the wild type (WT) were selected for multi-generation breeding. Both mutations resulted in frameshift mutations, which caused the protein translation to terminate prematurely (shortened from 968 amino acids to 63 / 131), and a sequence change occurred before the first functional domain (amino acid 186). The specific mutated amino acid sequences are shown in. Figure 3 .

[0036] Example 3 Determination of insect resistance of OsABCA2 gene mutant rice

[0037] The experiment was conducted using the T2 generation homozygous positive OsABCA2 gene mutant rice (abca2-6 and abca2-12) obtained in Example 2 and the parent rice (WT), comprising the following steps:

[0038] (1) Determination of honeydew secretion of brown planthopper: A pre-weighed Parafilm bag was fixed at the base of the rice stem, and two short-winged female adults were placed in each bag. After 48 hours, the insects were removed and weighed again, and the honeydew secretion of each female adult was calculated (WT was used as the control, n = 10). Figure 4 As shown in Figure 4A, the honeydew secretion of brown planthoppers in the rice mutants abca2-6 and abca2-12 was significantly lower than that in the WT.

[0039] (2) Determination of the survival rate of brown planthoppers: Using the cylindrical glass cover method, 20 third-instar nymphs were placed on the base of the rice stem and sealed with a sponge. Observation was continued for 7 days and the number of survivors was recorded (n = 10). Results Figure 4 As shown in Figure 4B: The nymph survival rate of the mutant rice abca2-6 and abca2-12 was significantly lower than that of the wild type (WT), confirming that the OsABCA2 gene mutation can cause massive death of brown planthoppers.

[0040] (3) Determination of the number of brown planthopper eggs: A cover was placed at the base of the rice stem, and one female adult and two male insects were placed in the cover. The top was sealed with a sponge. After 5 days, the number of eggs laid on each rice seedling was counted under a microscope. Results Figure 4 As shown in Figure 4C: The egg production of female adults in the rice mutants abca2-6 and abca2-12 was significantly lower than that in the wild type (WT), confirming that the OsABCA2 gene mutation significantly reduces the egg production of brown planthoppers.

[0041] (4) Determination of the feeding selectivity and egg-laying capacity of female brown planthoppers: OsABCA2 mutant and WT rice (50-day-old seedlings) were simultaneously exposed to 15 egg-bearing female adults, and the number of insects on the rice was counted at 1, 2, 4, 8, 12, 24, and 48 hours. Figure 4 As shown in Figures 4D and 4F, brown planthoppers showed a significant preference for feeding on WT plants. After 72 hours, the insects were removed and the stems were cut to microscopically count the number of eggs laid per plant. Figure 4 As shown in Figures 4E and 4G, the egg production in WT plants was significantly higher than that in mutant plants, indicating that the OsABCA2 gene mutation enhances rice resistance to feeding and egg laying by brown planthoppers.

[0042] Example 4 Detection of Phenotypic Differences in OsABCA2 Gene Mutants in Rice

[0043] The T2 homozygous mutants (abca2-6, abca2-12) and WT obtained in Example 2 were used as materials to determine the germination rate and plant height. Full seeds were selected and shaded for germination. After 5 days, the germination rate was calculated. Figure 5 As shown in 5A; the seedlings were transplanted to the greenhouse for 60 days and the plant height was measured. Figure 5 As shown in 5B, and take a photo. The result is as follows Figure 5 As shown in Figure 5C, there was no significant difference in germination rate and plant height between the mutant and WT, indicating that OsABCA2 gene knockout did not have a negative impact on rice growth phenotype.

[0044] Example 5: Breeding Method for Brown Planthopper-Resistant Rice

[0045] To identify whether a plant contains a mutation in the gene sequence at the mutation site, the specific detection primer sequence for the gene sequence at the mutation site is shown in SEQ ID NO. 7 or SEQ ID NO. 8. Specifically, DNA from mutant rice leaves is extracted according to the conventional DNA extraction kit operating procedures. The specific primer sequence shown in SEQ ID NO. 7 or SEQ ID NO. 8 is used to amplify a target fragment including the gene sequence at the mutation site. The fragment is 820 bp in size and then sequenced. Sequence alignment is then used to identify whether the plant to be tested is a mutant. If the gene sequence at the mutation site is not present, it indicates that the gene sequence at the mutation site has mutated and the plant to be tested is a mutant. Otherwise, it indicates that the plant to be tested is a non-mutant.

[0046] The present invention has been disclosed above with preferred embodiments, which are not intended to limit the present invention. Any technical solutions obtained by adopting equivalent replacement or equivalent transformation solutions fall within the protection scope of the present invention.

Claims

1. A OsABCA2 A gene mutant characterized by: OsABCA2 The gene sequence is shown in SEQ ID NO.1, OsABCA2 The gene sequence at the mutation site of the gene is shown in SEQ ID NO. 4, and the gene sequence after mutation is shown in SEQ ID NO. 14 or SEQ ID NO.

15.

2. according to claim 1 OsABCA2 Application of gene mutants in improving rice resistance to brown planthopper.

3. Utilize the method according to claim 1 OsABCA2 Application of gene mutants in breeding rice resistant to brown planthopper.

4. The use according to claim 3, characterized in that: Identify whether the rice plant contains the mutation site gene sequence shown in SEQ ID NO.

4.

5. The use according to claim 4, characterized in that: Identify whether the plant contains the OsABCA2 The base sequence of the specific primer for the gene sequence of the mutation site of the gene is shown in SEQ ID NO. 7 or SEQ ID NO.

8.

6. A method comprising the method according to claim 1 OsABCA2 Recombinant vector of gene mutant.

Images