Application of knocking out poplar aco gene in improving wood yield and method thereof

By knocking out the ACO gene in poplar using CRISPR/Cas9 technology, the problem of increasing timber yield in traditional breeding was solved, resulting in a significant increase in poplar stem height, stem diameter, and xylem content, and promoting secondary development of the wood.

CN120158480BActive Publication Date: 2026-06-26SOUTHWEST UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTHWEST UNIV
Filing Date
2025-04-30
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Traditional breeding methods cannot meet the challenges of long growth cycles and high heterozygosity in forest trees, resulting in insufficient demand for timber. Furthermore, there is a lack of research on the regulatory mechanism of aconitase in secondary development of timber.

Method used

The ACO gene in poplar was knocked out using CRISPR/Cas9 technology, and poplar was transformed using a CRISPR/Cas9 gene editing vector to obtain transgenic plants with ACO gene editing mutations, which promoted the activity of the cambium and xylem in poplar stems.

Benefits of technology

It increased the height, stem diameter, and xylem content of poplar trees, significantly increased timber production, and promoted secondary development of timber.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120158480B_ABST
    Figure CN120158480B_ABST
Patent Text Reader

Abstract

The application discloses knockout poplar ACO gene in the application of improving wood yield and a method thereof, an ACO knockout plant carrier is introduced into NL895 to obtain an ACO knockout transgenic plant; the stem xylem proportion in the knockout plant is significantly higher than that of WT, and the xylem layer number is also significantly increased; the result shows that the poplar stem cambium activity and xylem differentiation are promoted after the ACO is deleted, and the poplar development and utilization have important significance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the knockout of poplar trees. ACO The application of genes in increasing timber yield also involves methods to increase poplar timber yield. Background Technology

[0002] In the growth and development of higher plants, secondary vascular tissue provides essential mechanical support and material transport functions, thereby maintaining their normal life activities (Fischer). et al Unlike herbaceous plants, perennial trees can undergo secondary growth on top of their primary growth, ultimately leading to thickening of the stem. Secondary growth in trees depends on the continuous division and differentiation of cambium cells, which differentiate laterally to form secondary phloem and secondary xylem. The secondary xylem of forest trees is timber, widely used in papermaking, construction, and bioenergy, and is an important renewable resource with extremely significant economic value for human production and life (Plomion). et al (2001). With the rapid development of my country's economy, people's demand for timber is increasing day by day. However, due to the long growth cycle and high heterozygosity of trees, traditional breeding methods are unable to meet the growing demand for timber. Therefore, exploring key genes that regulate timber growth, analyzing the molecular regulatory network of secondary development in timber, and using molecular breeding methods to improve timber quality are considered to be one of the most effective ways to alleviate the contradiction between timber supply and demand.

[0003] Aconitate hydratase (ACO) catalyzes the isomerization of citrate to isocitrate, which contributes to oxidative stress tolerance and plays a role in respiration (Fedorin). et al (2024). Aconitase, a tricarboxylic acid cycle enzyme, has become a key component of stress-induced organelle signaling and a regulator of metabolic and redox balance in photosynthetic organisms. Aconitase mediates retrograde signaling in mitochondria and chloroplasts and helps activate the alternative oxidase (AOX) pathway in mitochondria. Studies have shown that... TZ1 Through with ACO Interactions and regulation of citric acid homeostasis negatively regulate root growth response to aluminum stress (Liu et al Aconitase-driven citrate metabolism plays a crucial role in providing reducing equivalents and metabolic precursors for biosynthetic pathways associated with stress acclimatization. In addition to enzymatic activity, aconitase also possesses non-canonical functions as a post-transcriptional regulator of specific gene transcripts. The various functions of aconitase under stress are promoted by regulating specific aconitase isoforms at multiple levels (Rahikainen, 2022). et al(2025). Currently, the effects of aconitase on plant stress response and signal transduction are relatively clear, but its regulatory mechanism on secondary wood development still needs further exploration. Summary of the Invention

[0004] In view of this, one of the objectives of the present invention is to provide a method for knocking down poplar trees. ACO The second objective of this invention is to provide a method for increasing poplar timber yield, which involves the application of genes in improving timber production.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] 1. Remove poplar trees ACO The application of genes in increasing timber yield, specifically in poplar trees. ACO The amino acid sequence encoded by the gene is shown in SEQ ID NO.2, which increases the height, stem diameter or xylem content of poplar trees in terms of increasing timber yield.

[0007] In some embodiments of the present invention, the poplar tree ACO The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0008] In some embodiments of the present invention, the poplar trees are knocked out. ACO The genetic approach uses CRISPR / Cas9 technology.

[0009] In some embodiments of the present invention, the poplar trees are knocked out. ACO The gene method specifically involves containing ACO Transform NL895 with a CRISPR / Cas9 gene editing vector containing the gene target sequence to obtain ACO Genetically modified plants with gene-edited mutations produce transgenic plants with increased wood yield.

[0010] In some embodiments of the present invention, the ACO The gene target sequences are shown in SEQ ID NO.3~4.

[0011] 2. A method to increase poplar timber yield, specifically, by adding ingredients containing... ACO Poplar trees were transformed with a CRISPR / Cas9 gene-editing vector containing the gene target sequence to obtain transgenic plants with gene-edited mutations. ACO The gene target sequences are shown in SEQ ID NO.3~4.

[0012] In some embodiments of the present invention, the method for transforming poplar trees employs Agrobacterium-mediated transformation.

[0013] In some embodiments of the present invention, the Agrobacterium is Agrobacterium GV3101. The beneficial effect of the present invention is that it provides a method for knocking out poplar trees. ACO The application and methods of genes in increasing timber yield, through... ACO The knockout plant vector was introduced into NL895, and the following results were obtained. ACO Knock out genetically modified plants; ACO The knockout transgenic plants showed increased plant height and stem diameter, and the proportion of xylem in the stems of the knockout plants was significantly higher than that of the WT plants, with a significant increase in the number of xylem layers and cambium layers; these results indicate that the deletion... ACO The activity of the cambium layer and the differentiation of xylem in poplar stems were promoted. Attached Figure Description

[0014] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration:

[0015] Figure 1 This is a vector map of the gDNA expression cassette.

[0016] Figure 2 For NL895 ACO Sequencing identification results of knockout positive plants.

[0017] Figure 3 For NL895 ACO Growth of knockout plant materials (A: Comparison of growth between knockout materials and wild type; B: Statistical analysis of plant height between knockout materials and wild type; C: Statistical analysis of stem diameter between knockout materials and wild type).

[0018] Figure 4 For NL895 ACO Phenotypic analysis of knockout plants (A: Toluidine blue staining of knockout material and wild type; B: Xylem layer number analysis of knockout material and wild type; C: Cambium layer number analysis of knockout material and wild type). Detailed Implementation

[0019] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0020] Example 1: Constructing a system containing ACO Knockout vectors and engineered bacteria for target gene sequences

[0021] Joint preparation: based on Nanjing Forestry University Populus 895 (NL895) ACO Gene sequences (shown in SEQ ID NO. 1~2) were designed to specifically knock out [the gene]. ACO The target sequence of the gene is as follows:

[0022] T1-F: 5'-AAATGCAGTGCAGGCTAATA-3' (SEQ ID NO.3);

[0023] T1-R: 5'-TATTAGCCTGCACTGCATTT-3' (SEQ ID NO. 4).

[0024] Primer sequences containing T1-F and T1-R target sequences and specific vector adapters were synthesized. The obtained primers were centrifuged at 8000 rpm for 2 minutes and dissolved in 1 / 5 TE buffer. KOD enzyme amplification was performed, and the PCR system is shown in Table 1 below:

[0025] Table 1. PCR system

[0026] Components 50 μL system 10×Buffer 5 μL dNTP 5 μL <![CDATA[MgSO4]]> 3 μL Primer-F 2 μL Primer-R 2 μL Temp 2 μL KOD enzyme 1 μL <![CDATA[H2O]]> 30 μL

[0027] Amplify using the following PCR procedure:

[0028] Pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 20 s, annealing at 55 ℃ for 30 s, extension at 68 ℃ for 10 s, for a total of 15 cycles; extension at 68 ℃ for 2 min; 16 ℃ forever.

[0029] After recovering the DNA fragments by alcohol precipitation, they were then digested with enzymes, as shown in Table 2 below:

[0030] Table 2. Enzyme digestion system

[0031] Components 20 μL system Buffer 2 μL BsaI 2 μL DNA 200 ng <![CDATA[H2O]]> To 20μL

[0032] The enzyme was ligated with the Baige CRISPR / Cas vector (catalog number BGK012), and the system is shown in Table 3 below:

[0033] Table 3. Enzyme-linked reaction system

[0034] Components Dosage 10×Buffer 5 μL Vector 500 ng Insert (the above enzyme digestion system) 5 μL T4 ligase 5 μL <![CDATA[H2O]]> To 50 μL

[0035] After ligation at 16 ℃ for 8 hours, E. coli DH5α was transformed to obtain bacteria containing... ACO The recombinant plant knockout vector targeting the gene was named WMC001-BGK012- ACO carrier ( Figure 1 The correctness of the gene was confirmed by sequencing by the Hi-TOM sequencing group of the China National Rice Research Institute.

[0036] WMC001-BGK012- ACO The vector was transformed into Agrobacterium tumefaciens GV3101, and positive clones were selected to obtain the vector containing WMC001-BGK012-. ACOThe engineered bacteria for the vector was named GV3101-WMC001-BGK012- ACO .

[0037] Example 2: Agrobacterium tumefaciens-mediated ACO Knockout vector transformation of Nanjing Forestry University 895 Yang

[0038] I. Two activation cultures of Agrobacterium

[0039] 1) Transfer GV3101-WMC001-BGK012- ACO The bacterial strain was streaked on YEP solid medium containing 40 mg / L rifampicin and 50 mg / L kanamycin and incubated at 28 ℃ for 36 h; all single colonies on the plate were scraped and inoculated into 50 ml of YEP+Rif+Kan double antibiotic liquid medium.

[0040] 2) Incubate at 28 ℃ with shaking at 200 rpm / min for 36-48 hours until the bacterial concentration reaches OD600=0.8-1.0;

[0041] 3) At a ratio of 1:1000, take 50 μL of the primary active solution and add it to 50 mL of fresh YEP+Rif+Kan dual-antibiotic liquid medium for secondary active solution culture;

[0042] 4) Incubate at 28 ℃ and 200 rpm / min for 12-16 hours with shaking until the bacterial concentration reaches OD600=0.3-0.4, then set aside for use.

[0043] II. Preparation of Agrobacterium infection solution

[0044] 1) Collect the bacterial culture using a 50 mL centrifuge tube at 4000 rpm / min for 8 min, and then collect the bacterial cells.

[0045] 2) Discard the supernatant of the culture medium, and resuspend the Agrobacterium using 40 mL of WPM resuspension containing AS. Pour the resuspension into a sterile glass bottle.

[0046] 3) Place the resuspension at 28 ℃ and shake at 200 rpm / min for 40 minutes to enhance the infection activity of Agrobacterium.

[0047] III. Preparation of Bladed Discs

[0048] 1) In a clean bench, sterilize the handles of scissors, tweezers, and scalpels by flaming them with the outer flame of an alcohol lamp for 15 seconds, then let them cool before use.

[0049] 2) Use scissors to cut 5-6 leaves from healthy wild-type Populus davidiana 895 tissue culture seedlings and place them in a petri dish. Add 1 / 3 volume of sterile water to the dish to keep the leaves moist;

[0050] 3) Insert the sterile scalpel blade into the handle, flame-heat it, and then allow it to cool. Use the blade to evenly cut the blade into 0.5 cm pieces. 2 A square leaf disc.

[0051] IV. Infection

[0052] 1) Use tweezers to place the leaf disc into the Agrobacterium resuspension, gently shake the glass bottle to make the resuspension evenly coat the leaf disc, and infect for 10 minutes;

[0053] 2) After the infection is complete, carefully remove the leaf disc with tweezers, place it on sterile paper, and absorb any excess infection solution from the leaf disc.

[0054] 3) Place the leaf disc flat on the co-culture plate, put it in a dark box, and incubate in the dark at 25 ℃ for 36-48 h.

[0055] V. Selection and Cultivation of Leaf Discs

[0056] 1) After dark culture, select appropriate plant resistance based on the vector and prepare a selective culture medium containing antibiotics;

[0057] 2) Transfer the leaf disc to selective culture medium in a clean bench to induce callus formation. Replace the leaf disc with fresh culture medium every seven days, continuing this process for 3-4 weeks until white or pale yellow callus grows at the edge of the leaf disc. The entire process is carried out in a dark chamber at 25°C.

[0058] VI. Callus induction and budding

[0059] Transfer the leaf discs from which callus has grown to a budding medium containing the corresponding antibiotic, and culture at 8000 Lux and 25 ℃ for 5-6 weeks, changing the medium every two weeks. During this period, the callus will grow and swell fully, and around the 5th week, buds will emerge from the callus, forming clusters of shoots.

[0060] VII. Inducing Rooting from Clustered Buds

[0061] When the clustered shoots grow to about 3-5 cm, cut them off with sharp scissors and insert them into rooting medium with tweezers. Incubate at 8000 Lux and 25°C for 7-10 days to obtain rooted seedlings. These are candidate transgenic plants, awaiting positive identification before transplanting into soil. The transgenic seedlings will be named... ACO-KO Plant.

[0062] Example 3 ACO-KO PCR molecular identification of transgenic plants

[0063] 1. Wild type and ACO-KO DNA extraction from genetically modified Nanlin 895 poplar

[0064] Genomic DNA was extracted from 10-15 transgenic resistant regenerated plants of Populus tomentosa 'Nanlin 895'. The method is as follows:

[0065] 1) Prepare CTAB buffer solution and preheat it in a 65 ℃ water bath for later use;

[0066] 2) Take approximately 0.5 g of wild-type and... ACO-KO The leaves of the transgenic Populus tomentosa were ground into powder in liquid nitrogen and added to 500 μL of the preheated CTAB extract solution and mixed well.

[0067] 3) Incubate in a 65 ℃ water bath for 45 min, gently shaking three times during the process to mix thoroughly;

[0068] 4) After the water bath, cool to room temperature, add an equal volume of chloroform:isoamyl alcohol (24:1), gently invert to mix, and then emulsify for 10 min. Centrifuge at 4 ℃, 12000 rpm / min for 10 min;

[0069] 5) Transfer the supernatant to a new sterile centrifuge tube, add an equal volume of isopropanol pre-cooled to -20 °C, and mix by inverting until a white flocculent precipitate is visible.

[0070] 6) Centrifuge at 4 ℃, 12000 rpm / min for 10 min. Discard the supernatant, wash the precipitate twice with 500 ml of 75% (V / V) ethanol, and wash again with 500 ml of anhydrous ethanol. Discard the liquid. Dry the precipitate in a rotary evaporator at 37 ℃ until it becomes translucent.

[0071] 7) Dissolve the precipitate in 25 μL of sterile water to obtain wild-type and ACO-KO Crude DNA extract from transgenic poplar leaves of Nanlin 895;

[0072] 8) Add approximately 1 μL of RNase to the crude DNA extract and enzymatically hydrolyze the RNA at 37 °C for 1 h;

[0073] 9) Store the DNA sample in a -20°C freezer for later use.

[0074] II. PCR amplification of vector-transformed plants

[0075] Since wild-type plants do not contain the exogenously introduced BGK012 vector sequence, positive plants were screened using primers WMC001-F and WMC001-R for vector BGK012 amplification. Wild-type DNA templates were used as negative controls. PCR amplification and gel electrophoresis imaging were performed on the DNA of transgenic plants to identify transgenic positive lines. ACO-KO Positive strains will have a bright and clear single band at around 500 bp, while wild types will not.

[0076] The specific primers designed using vector BGK012, WMC001-F and WMC001-R sequences are as follows:

[0077] WMC001-F: 5′-cctgggaatctgaaagaag-3′ (SEQ ID NO.5);

[0078] WMC001-R: 5′-gatagctgggcaatggaat-3′ (SEQ ID NO. 6).

[0079] The PCR reaction system is shown in Table 4 below. The reaction program is as follows: 94 ℃ pre-denaturation for 3 min, 1 cycle; 94 ℃ denaturation for 30 s, 58 ℃ annealing for 30 s, 72 ℃ extension for 1 min, for a total of 31 cycles; 72 ℃ extension for 10 min. The amplified products were detected by 1% agarose gel electrophoresis.

[0080] Table 4. PCR reaction system for identifying transgenic plants

[0081] Components Dosage <![CDATA[RNase Free dH2O]]> 4 μL GoTaqR Green Master Mix 5 μL WMC001-F 0.25 μL WMC001-R 0.25 μL Plant template DNA 0.5 μL

[0082] III. Identification of Positive Plants

[0083] After confirming the transfer into the BGK012 vector, further confirmation is needed to determine whether the target gene has been edited. This will be done using the target gene shown in SEQ ID NO. 1~2. ACO Based on the nucleotide sequence, design the following primers for PCR amplification:

[0084] ACO-F: ATGCCGACGCCGGTAACTAC (SEQ ID NO.7)

[0085] ACO-R: CTCTATCTGCATCCACGTG (SEQ ID NO.8)

[0086] The specific amplification system is shown in the previous step, "PCR Amplification of Vector-Transferred Plants". The amplified product was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing to confirm the sequence of the amplified gene. The results are as follows... Figure 2 As shown, the sequence of the amplified gene has a 1bp deletion of the A base at the sgRNA, which is a homozygous mutation.

[0087] Example 4, Yang 895 from Nanjing Forestry University ACO Phenotypic analysis of knockout plants

[0088] One-month-old tissue culture seedlings were transplanted into flowerpots and grown for three months in a greenhouse under long-day conditions (16 hours light / 8 hours darkness, light intensity 10000 Lux) at 25 ℃. This is beneficial for WT and... ACO-KOThe plant height and stem diameter of the transgenic poplar (plant number IT-3-9) were measured and statistically analyzed.

[0089] The results are as follows Figure 3 As shown, compared to WT plants, ACO-KO The plant height increased by 21.9%, and the stem diameter increased by 22.3%.

[0090] Example 5 ACO-KO Secondary development analysis of transgenic plants

[0091] For 3-month-old WT, ACO-KO Transgenic poplar trees were sectioned and observed. Results are as follows: Figure 4 As shown, knockout ACO After gene therapy, the xylem of NL895 poplar increased by 83.3%, and the cambium increased by 66.7%. The above-described embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention. The scope of protection of the present invention is defined by the claims.

Claims

1. Knockout ACO The application of genes in improving the height, stem diameter, and xylem content of Populus tomentosa 895 in Nanjing Forestry University is characterized by: The ACO The amino acid sequence encoded by the gene is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that: The knockout ACO The genetic approach uses CRISPR / Cas9 technology.

3. The application according to claim 2, characterized in that: The knockout ACO The gene method specifically uses a substance containing ACO The CRISPR / Cas9 gene editing vector containing the gene target sequence was transformed into Yang 895 from Nanjing Forestry University, and obtained... ACO Genetically modified plants with gene-edited mutations have increased plant height, stem diameter, and xylem content.

4. The application according to claim 3, characterized in that: The ACO The gene target sequences are shown in SEQ ID NO.3~4.

5. The application according to claim 4, characterized in that: The method for transforming Nanlin 895 poplar is Agrobacterium-mediated transformation.

6. The application according to claim 5, characterized in that: The Agrobacterium species in question is GV3101.