Application of engineered bacterium for synthesizing melanin in preparation of medicine for treating inflammatory bowel disease

By constructing and applying the engineered bacteria EcN-T that synthesizes melanin, the complications of inflammatory bowel disease and the cost of mass production of melanin in the prior art are solved, and significant UC relief effects are achieved, including repairing the intestinal mucosal barrier, regulating the intestinal flora and reducing the inflammatory response.

CN120168522APending Publication Date: 2025-06-20CHINESE PEOPLES LIBERATION ARMY ARMY SPECIAL MEDICAL CENTER
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510330964.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-20
Publication Date
2025-06-20

AI Technical Summary

Technical Problem

The prior art has complications in the treatment of inflammatory bowel disease, such as opportunistic infections, malignant tumors, autoimmune diseases and hepatotoxicity, and the scientific research of melanin is relatively expensive and difficult to produce on a large scale.

Method used

Using the engineered bacteria EcN-T that synthesizes melanin, a recombinant plasmid carrying the 6×His tagged tyrosinase gene was introduced into E. coli to produce melanin, which was used to treat inflammatory bowel disease.

Benefits of technology

EcN-T significantly reduced the ROS level induced by H2O2, improved cell survival, significantly alleviated the DSS-induced colonic inflammation, repaired the intestinal mucosal barrier, regulated the short-chain fatty acid levels and intestinal flora, reduced the polarization of M1 macrophages, improved the inflammatory factor levels and oxidative stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120168522A_ABST
    Figure CN120168522A_ABST
Patent Text Reader

Abstract

The invention relates to application of engineered bacteria for synthesizing melanin in preparation of drugs for treating inflammatory bowel diseases, the engineered bacteria are used for biosynthesis of melanin (at) EcN-T. The melanin (at) EcN-T prepared by the invention has excellent biocompatibility, oxidation resistance and anti-inflammatory characteristics. Experimental results show that the melanin (at) EcN-T nanoparticles have good ROS (reactive oxygen species) removal capability and biodegradability; oral administration of EcN-T can effectively up-regulate expression of tight junction related protein in colon tissue, regulate inflammatory response and relieve DSS induced colitis symptoms, and EcN or melanin does not show a protective effect on DSS induced colitis when being independently used; meanwhile, by oral administration of the EcN-T, beneficial bacteria can be increased, the abundance of harmful bacteria can be reduced, the level of SCFAs such as valeric acid, propionic acid and butyric acid can be increased, the EcN-T inhibits polarization of M1 macrophages and reduces expression of proinflammatory cytokines through glycolysis reprogramming dependent on HIF-1alpha, and the EcN-T has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to the application of an engineered bacterium for synthesizing melanin in the preparation of a drug for treating inflammatory bowel disease. Background Art

[0002] Ulcerative colitis (UC) is a chronic, idiopathic inflammatory disease characterized by recurrent and remitting mucosal inflammation that begins in the rectum and extends to the proximal regions of the colon. Although the pathogenesis of UC is not fully understood, oxidative stress, dysregulated immune responses, altered gut microbiota, genetic susceptibility, and environmental factors are all thought to be associated with its development. Current treatment options include 5-aminosalicylic acid drugs, thiopurine drugs, biologics targeting tumor necrosis factor (TNF-α) and integrins, and small molecule inhibitors targeting Janus kinases to achieve disease remission. However, frequent and long-term use of traditional small molecule therapeutic drugs or biologic-based immunosuppressive drugs may lead to serious complications such as opportunistic infections, malignancies, autoimmune diseases, and hepatotoxicity. Therefore, the treatment of UC still poses challenges and there is an urgent need to explore new treatment strategies.

[0003] Melanin, a biological pigment in the human body, is synthesized from tyrosine or 3,4-dihydroxyphenylalanine (DOPA) through a series of chemical reactions. It has excellent biocompatibility and biodegradability and possesses various biological functions such as anti-inflammatory, antioxidant damage, and anti-aging activities. There are research reports that oral administration of melanin can relieve colitis induced by dextran sulfate sodium (DSS) by regulating inflammatory factors and oxidative stress, maintaining the mucosal barrier, and restoring changes in the gut microbiota. Although melanin is widely present in nature, the melanin used in scientific research is expensive. Currently, commercially available melanin is mainly produced by chemical synthesis or extraction from brown pigments, which poses a great challenge for the large-scale production of melanin. Tyrosinase plays a key role in the biosynthesis of melanin, and many microorganisms have been developed for melanin production through tyrosinase. Compared with chemical methods, the biosynthetic method has the significant advantages of mild synthesis conditions, environmental friendliness, and good biocompatibility. In addition, the use of microorganisms to synthesize melanin has a lower cost, making it feasible for large-scale production.

[0004] Escherichia coli Nissle 1917 (EcN) is a genetically engineered probiotic with a good human safety record and is gradually becoming a favored vector due to its excellent biocompatibility, ideal targeting ability, and facultative anaerobic characteristics. EcN has received much attention in the treatment strategies of inflammatory bowel disease (IBD) and tumors. As a bacterial vector, the advantage of EcN is that it can express foreign proteins and, at the same time, as a natural capsule, slowly release drugs through its own colonization. In addition, EcN has significant probiotic properties in the treatment of intestinal diseases such as diarrhea and IBD, especially ulcerative colitis (UC). It not only shows antagonistic effects against a variety of intestinal pathogenic bacteria but also can regulate the secretion of immune factors in the body and enhance the immune ability of the host. Summary of the Invention

[0005] In view of the deficiencies in the prior art, the present invention proposes an application of an engineered bacterium synthesizing melanin in the preparation of a drug for treating inflammatory bowel disease.

[0006] The technical solution of the present invention is as follows:

[0007] Application of an engineered bacterium synthesizing melanin in the preparation of a drug for treating inflammatory bowel disease.

[0008] Furthermore, the engineered bacterium can repair the intestinal mucosal barrier.

[0009] Even further, the engineered bacterium can upregulate the tight junction complex to repair the intestinal mucosal barrier.

[0010] Even further, the engineered bacterium can upregulate the expression of the tight junction complex ZO-1, E-cadherin, and Occludin to repair the intestinal mucosal barrier.

[0011] Furthermore, the engineered bacterium can regulate the levels of short-chain fatty acids and the intestinal flora.

[0012] Even further, the engineered bacterium can regulate the levels of short-chain fatty acids propionic acid, butyric acid, and valeric acid and increase the proportions of the genera Bacteroides and Lactobacillus to relieve colitis.

[0013] Furthermore, the engineered bacterium can regulate the HIF-1α immune signaling pathway.

[0014] Even further, the engineered bacterium inhibits the polarization of M1 macrophages through HIF-1α-dependent glycolytic reprogramming, reduces the expression of pro-inflammatory factors, and enhances the expression of anti-inflammatory factors.

[0015] Furthermore, the inflammatory bowel disease is ulcerative colitis.

[0016] Even further, the ulcerative colitis is DSS-induced ulcerative colitis.

[0017] Furthermore, the administration route of the drug is oral administration.

[0018] Furthermore, the effective dosage of the drug is 1x10 9 CFU / time.

[0019] Furthermore, the dosage form of the drug includes one of injection, oral liquid, pill, powder, plaster, tablet, granule, powder or capsule.

[0020] Furthermore, the drug also includes pharmaceutically acceptable excipients, and the pharmaceutically acceptable excipients include one or more of diluents, wetting agents, binders, disintegrants, lubricants, color, flavor and odor regulators, solvents, solubilizers, cosolvents, emulsifiers, antioxidants, metal complexing agents, inert gases, preservatives, local anesthetics, pH regulators, isotonic regulators and isosmotic regulators.

[0021] Furthermore, the preparation method of the engineered bacteria for synthesizing melanin is as follows: inserting the tyrosinase gene carrying a 6×His tag downstream of the strong promoter pJ23119 to construct a recombinant plasmid expressing 6×His-tagged tyrosinase, then introducing the recombinant plasmid into bacteria to construct engineered bacteria, and co-culturing the engineered bacteria with L-tyrosine and Cu + to generate melanin.

[0022] Even further, the bacteria is Escherichia coli Nissle 1917.

[0023] Compared with the prior art, the present invention has at least the following advantages:

[0024] 1. The present invention relates to the application of engineered bacteria for synthesizing melanin in the preparation of drugs for treating inflammatory bowel disease. The engineered bacteria is the probiotic EcN-T overexpressing tyrosinase, which can be used for biosynthesizing melanin@EcN-T. The melanin@EcN-T prepared by the present invention has excellent biocompatibility, antioxidant and anti-inflammatory properties; experimental results show that the melanin@EcN-T nanoparticles exhibit high reactive oxygen species (ROS) scavenging ability and good biodegradability in an environment rich in hydrogen peroxide (H2O2). In vitro experiments show that melanin@EcN-T can significantly reduce the ROS level in the H2O2-induced RAW264.7 cell inflammation model and improve cell viability.

[0025] 2. The therapeutic effect of EcN-T was verified by constructing a DSS-induced colitis mouse model in the present invention. The results of animal experiments showed that the EcN-T treatment group exhibited significant UC remission effects, including weight recovery, reduction of disease activity index, protection of colon length, improvement of histological morphology, regulation of inflammatory factor levels, and alleviation of oxidative stress; compared with other treatment groups, EcN-T was more superior in improving UC symptoms.

[0026] 3. The engineered bacteria prepared in the present invention can repair the intestinal mucosal barrier. Experiments confirmed that the expressions of tight junction proteins ZO-1, E-cadherin, and Occludin in DSS-induced colitis mice were significantly decreased, resulting in impaired intestinal barrier function; EcN-T treatment effectively restored the expressions of these proteins, indicating that it repaired the intestinal barrier function by promoting the assembly of tight junction complexes; and compared with ordinary EcN and melanin, the effect of EcN-T in restoring the intestinal barrier was significantly better, which showed that the engineering transformation of EcN-T significantly improved its function.

[0027] 4. The engineered bacteria prepared in the present invention can regulate the levels of short-chain fatty acids and the intestinal flora. Experiments confirmed that the levels of SCFAs in the DSS-induced colitis mouse model were significantly decreased, while the EcN-T treatment group significantly improved the pathological state by restoring the levels of butyric acid, propionic acid, and valeric acid; in addition, the 16S rRNA sequencing results showed that EcN-T not only significantly increased the diversity of the intestinal microbiota (such as Shannon and Simpson indices), but also significantly improved the composition of the intestinal flora by increasing the proportions of beneficial bacteria such as Bacteroides and Lactobacillus, contributing to the restoration of intestinal homeostasis.

[0028] 5. The engineered bacteria prepared by the present invention can regulate the HIF-1α immune signaling pathway. Experiments have confirmed that the expression of glycolysis-related genes (such as HIF-1α, GLUT1, and PFKFB3) is significantly upregulated in a DSS-induced colitis mouse model, while EcN-T treatment significantly downregulates the expression of these genes. Further GO and KEGG analyses showed that EcN-T effectively alleviated the inflammatory response by regulating multiple key signaling pathways (such as the TNF signaling pathway, NF-κB signaling pathway, HIF-1 signaling pathway, etc.). In addition, immune infiltration analysis showed that compared with the DSS model group, EcN-T treatment significantly reduced the number of pro-inflammatory M1 macrophages in the colon tissue. Through in vitro co-culture experiments, the inhibitory effect of EcN-T on M1 macrophage polarization was further verified, and it was found that it achieved metabolic reprogramming of M1 macrophages by reducing glycolytic activity (such as lactate production and ECAR levels) and regulating the function of the tricarboxylic acid cycle (OCR level), thereby reducing the secretion of pro-inflammatory cytokines (IL-1β, TNF-α, IL-6) and significantly increasing the expression of the anti-inflammatory cytokine IL-10. These results indicate that EcN-T plays an immunomodulatory role by regulating the HIF-1α-dependent glycolytic metabolic pathway, thereby alleviating colonic inflammation. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the specific embodiments of the present invention, the drawings required for use in the specific embodiments or the description of the prior art will be briefly introduced below.

[0030] Figure 1 It is the plasmid map of Example 1 of the present invention;

[0031] Figure 2 、 Figure 3 It is the result diagram of the construction of the engineered probiotic in Example 1 of the present invention and the characterization of the properties of melanin@EcN-T;

[0032] Figure 4 It is that EcN-T in Example 2 of the present invention can alleviate DSS-induced intestinal inflammation;

[0033] Figure 5 It is the restoration function of EcN-T on the intestinal mucosal barrier in Example 3 of the present invention;

[0034] Figure 6 It is the regulatory effect of EcN-T on short-chain fatty acids and the intestinal microbiota in Example 4 of the present invention;

[0035] Figure 7 、 Figure 8 It is the research on the immunomodulatory effect and mechanism of EcN-T in Example 5 of the present invention. SPECIFIC EMBODIMENTS

[0036] The present invention will be further described in detail below. It is necessary to point out here that the following specific embodiments are only used to further illustrate the present invention and cannot be construed as limiting the protection scope of the present invention. Those skilled in the art can make some non-essential improvements and adjustments to the present invention based on the above application content.

[0037] The present invention generally and / or specifically describes the materials and test methods used in the experiments. The test methods or testing methods involved, unless otherwise specified, are all conventional methods; the reagents or instruments used, unless the manufacturer is specified, are all commercially available conventional products and are prepared or used by conventional methods.

[0038] Example 1 Construction of Engineered Probiotics and Characterization of melanin@EcN-T

[0039] To achieve genetic engineering modification of EcN-T (Escherichia coli overexpressing tyrosinase), in this example, the tyrosinase gene Tyr carrying a 6×His tag was inserted downstream of the strong promoter pJ23119 to construct a recombinant plasmid expressing 6×His-tagged tyrosinase. The sequence of the 6×His-tagged tyrosinase gene Tyr is shown in SEQ ID NO.1, and its plasmid map is as Figure 1 shown. Then, the plasmid was introduced into Escherichia coli by electroporation, and the electroporation conditions were 2500V. Then, the engineered bacterial liquid obtained after electroporation was inoculated into an LB liquid medium containing chloramphenicol (final concentration: 34 mg / ml), copper sulfate (CuSO4·5H2O, final concentration: 50 μg / ml), and tyrosine (final concentration: 0.8 mg / ml). After mixing, it was placed at 37°C and shaken at 150 rpm for culture. After overnight culture, the color change of the culture solution was observed. The bacterial liquid gradually changed from transparent or light yellow to black, indicating that the engineered bacteria successfully expressed tyrosinase and further catalyzed the production of melanin under the action of tyrosine and copper sulfate. This result verified the high expression of plasmid pCm231119-tyR in the EcN strain and also indicated that the electroporation and subsequent culture operations were successful. The synthesis schematic diagram of melanin@EcN-T is as Figure 2 shown in A.

[0040] SEQ ID NO.1: ATGGGTAATAAGTACCGTGTTCGTAAAAATGTGCTGCATCTGACC GATACCGAAAAACGCGATTTTGTTCGTACCGTTCTGATTCTGAAAGAAAAAGGCATCTATGATCGTTATATCGCATGGCATGGCGCAGCCGGCAAATTTCATACCCCGCCGGGTAGTGATCGCAATGCCGCCCATATGAGTAGTGCATTTCTGCCGTGGCATCGTGAATATCTGCTGCGTTTTGAACGTGATCTGCAGAGTATTAATCCGGAAGTGACCCTGCCGTATTGGGAATGGGAAACCGATGCCCAGATGCAGGACCCTAGTCAGAGCCAGATTTGGAGTGCAGATTTTATGGGTGGTAATGGCAATCCGATTAAGGATTTTATTGTGGATACCGGCCCGTTTGCAGCCGGTCGCTGGACCACCATTGATGAACAGGGTAATCCGAGTGGCGGCCTGAAACGCAATTTTGGCGCCACCAAAGAAGCCCCGACCCTGCCGACCCGTGATGATGTTCTGAATGCACTGAAAATTACCCAGTATGATACCCCGCCGTGGGATATGACCAGTCAGAATAGTTTTCGTAATCAGCTGGAAGGTTTTATTAATGGCCCGCAGCTGCATAATCGTGTGCATCGCTGGGTGGGCGGTCAGATGGGCGTTGTTCCGACCGCCCCGAATGATCCGGTTTTCTTTCTGCATCATGCAAATGTGGATCGTATTTGGGCCGTGTGGCAGATTATTCATCGCAATCAGAATTATCAGCCGATGAAAAATGGCCCGTTTGGTCAGAATTTTCGCGATCCGATGTATCCGTGGAATACCACCCCGGAAGATGTGATGAATCATCGTAAACTGGGTTATGTTTATGATATTGAACTGCGTAAAAGCAAACGCAGTAGTCACCATCACCATCACCATTGA

[0041] The harvested and lysed bacteria cultured for 24 hours were used to verify the expression of tyrosinase. The results of Western blot experiment confirmed the successful expression of tyrosinase with a molecular weight of 38 kDa( Figure 2 B). When 50 μg / mL -1 of CuSO4·5H2O and 0.8 mg / mL -1 of l-tyrosine were added to the culture medium and co-cultured with EcN-T, the color of the culture medium gradually deepened over time due to the partial release of tyrosinase by the bacteria( Figure 2 C).

[0042] To evaluate the yield of melanin, this example was quantified by absorbance measurement, and the results showed that the yield of melanin was 1.65 mg / mL-1 and tended to be stable after 48 hours( Figure 2 D). Transmission electron microscopy (TEM) observation showed that there was no significant change in the morphology of EcN-T compared with EcN( Figure 2 E). Scanning electron microscopy (SEM) analysis characterized the structure of melanin@EcN-T nanoparticles, and melanin@EcN-T was as Figure 1 shown in F. Dynamic light scattering (DLS) results showed that the average hydrodynamic diameter of melanin@EcN-T was 325.4 nm and the Zeta potential was -22.4 mV( Figure 2 G).

[0043] Fourier transform infrared spectroscopy (FT-IR) showed characteristic peaks near 1250 cm-1 (C=O) and 1600 cm-1 (C=C, C=N) for the melanin nanoparticles, indicating the presence of aromatic structures in melanin( Figure 3 A). Electron spin resonance (ESR) spectroscopy showed a typical broad single-line ESR signal( Figure 3 B). The absorbance of the melanin solution increased linearly with increasing concentration, and its regression equation was Y = 0.0035X + 0.0174, with a correlation coefficient R 2 = 0.9977 (492 nm, Figure 3 C).

[0044] Melanin has the ability to scavenge reactive oxygen species (ROS). To further verify the ROS scavenging ability of melanin@EcN-T constructed in this example, this example evaluated its scavenging effects on 2,2-diphenyl-1-picrylhydrazyl radical (DPPH), hydroxyl radical (·OH-), and superoxide radical (·O2 - -). As Figure 3 shown in D, melanin@EcN-T showed strong ROS scavenging ability, and the scavenging ability gradually increased with increasing concentration.

[0045] This example also explored the biodegradation mechanism of melanin@EcN-T. At the lesion site of inflammatory bowel disease (IBD), high concentrations of H2O2 can cause the degradation of melanin@EcN-T. As Figure 3 shown in E, as the concentration of H2O2 increases, the ultraviolet absorption spectrum of melanin@EcN-T gradually disappears, showing concentration-dependent fading. In addition, after reacting with H2O2 for one day, the high-concentration H2O2 group almost completely decomposed melanin@EcN-T. This phenomenon may be due to the conversion of melanin@EcN-T from a black form to a colorless or light-colored oxidation product, such as 5,6-dihydroxyindole-2-carboxylic acid, indicating that melanin@EcN-T has high biodegradability in an environment rich in H2O2 ( Figure 3 F).

[0046] In addition, to study its ability to scavenge intracellular ROS in this example, a 2,7-dichlorodihydrofluorescein diacetate (DCFH-DA) kit was used in this example. Fluorescence imaging and flow cytometry analysis showed that in RAW264.7 cells, the ROS level induced by H2O2 increased significantly. However, after adding melanin@EcN-T, the ROS level decreased significantly ( Figure 3 G). Using a 660 μM H2O2 solution, this example established an inflammation model in RAW264.7 cells to evaluate the therapeutic effect of melanin@EcN-T on inflammatory cells. As Figure 3 shown in H, under H2O2 stimulation, nearly half of the RAW264.7 cells in the positive control group died, indicating that the inflammation model was successfully established. During the model induction process, adding different concentrations of melanin@EcN-T could significantly improve cell viability. Compared with the positive control group, the differences between the groups were significant, and the cell viability increased with the increase in the concentration of melanin@EcN-T. These results indicate that melanin@EcN-T has broad-spectrum antioxidant capacity.

[0047] Example 2: EcN-T can alleviate DSS-induced intestinal inflammation

[0048] In this example, an animal experiment was conducted using mice with dextran sulfate sodium (DSS)-induced ulcerative colitis (UC) to evaluate the therapeutic effect of orally administered EcN-T. The model construction method in this example was that mice were continuously given a 3% (w / v) DSS solution for 7 days to induce acute inflammation, and then changed to drinking pure water. Starting from day 0 of the experiment, mice were orally administered EcN, EcN-T, melanin (Melanin), and pure water every other day for a total of four treatments ( Figure 4 A), and the dose of EcN-T was 1x10 9CFU / time. In in vivo experiments, the body weight of mice was measured daily, which is an important indicator for evaluating the treatment effect of UC. The results showed that the body weight of healthy mice continued to increase over time, while the body weight of all mice in the DSS treatment groups began to decline from the 4th day, indicating the onset of UC. In the control group, the downward trend of body weight in the DSS+EcN-T treatment group was alleviated from the 5th day and gradually recovered from the 9th day( Figure 4 B).

[0049] Furthermore, the severity of inflammation was evaluated by Disease Activity Index (DAI) scores, which include criteria such as weight loss, fecal blood loss, and fecal characteristics. The results showed that the DAI scores of the EcN-T treatment group were significantly lower than those of the DSS+EcN group, DSS+Mel group, and DSS group, suggesting a significant reduction in the degree of inflammation( Figure 4 C).

[0050] Changes in colon length and tissue damage are important indicators for evaluating the treatment effect of colitis. The experimental results showed that compared with the control group (7.52±0.22 cm), the colon length of the DSS-induced colitis mouse model group was significantly shortened (5.02±0.83 cm). The colon length of the EcN-T treatment group (6.47±0.21 cm) was significantly longer than that of the DSS-induced group, indicating that EcN-T treatment effectively reduced the DSS-induced colon shortening( Figure 4 D-E).

[0051] Colon tissue sections stained with H&E (hematoxylin-eosin) showed that DSS-induced colitis caused significant damage to the colon tissue of mice, including dilatation and congestion of the lamina propria blood vessels, degeneration and necrosis of epithelial cells, mucosal erosion, and diffuse mixed inflammatory cell infiltration in the lamina propria. In contrast, the morphology of the colon tissue in the EcN-T treatment group was similar to that of healthy mice( Figure 4 F). Histological scores showed that EcN-T treatment restored the integrity of the colonic epithelium and reduced inflammatory cell infiltration in the mucosa, suggesting that the colon tissue tended to recover to normal( Figure 4 G).

[0052] In this example, q-PCR was used to detect the levels of pro-inflammatory cytokines (IL-6, TNF-α, and IL-1β) and anti-inflammatory cytokine (IL-10) in the colon tissue. The results showed that the levels of IL-6, TNF-α, and IL-1β in the EcN-T treatment group were significantly decreased, while the level of IL-10 was significantly increased( Figure 4 H-K).

[0053] Finally, to evaluate the effect of EcN-T on oxidative stress, the activities of superoxide dismutase (SOD) and the content of malondialdehyde (MDA) in colon tissues were measured in this example. The results showed that compared with the control group, the SOD activity in the DSS-induced colitis mouse model group was significantly decreased ( Figure 4 L), while the MDA level was significantly increased ( Figure 4 M). In the EcN-T treatment group, the SOD activity was significantly increased and the MDA level was significantly decreased, showing significant differences compared with the DSS-induced colitis model group.

[0054] In summary, the EcN-T treatment group showed significant UC (colitis) remission effects, including weight recovery, decreased disease activity index, protection of colon length, improvement of histological morphology, regulation of inflammatory factor levels, and alleviation of oxidative stress. Compared with other treatment groups, EcN-T was more superior in improving UC symptoms.

[0055] Example 3 Engineering probiotic EcN-T restores intestinal mucosal barrier function

[0056] The intestinal barrier plays a crucial role in maintaining intestinal health and defending against external pathogens. In a healthy intestine, intestinal epithelial cells secrete a hydrated gel-like mucus, which acts as a physical barrier to separate the intestinal lumen contents from the underlying tissues, and at the same time regulates the intestinal microbiota through immunoglobulins and antimicrobial peptides in the mucus. However, at the lesion sites of inflammatory bowel disease (IBD), excessive reactive oxygen species (ROS) can damage the mucus layer, exposing epithelial cells to pathogens and environmental toxins, leading to the loss of intestinal permeability and structural integrity.

[0057] Tight Junctions (TJs) are an important part of the intestinal barrier, which are composed of adhesion proteins (such as E-cadherin), transmembrane tight junction proteins (such as Occludin), and peripheral membrane proteins (such as ZO-1). E-cadherin initiates the formation of intercellular adhesion junctions through cell-cell interactions. ZO-1, as a scaffold protein, connects the adhesion junctions with tight junctions by mediating protein-protein interactions, while Occludin regulates cell permeability and adhesion.

[0058] In this example, through immunofluorescence staining and its quantitative analysis, it was found that in the DSS-induced colitis mouse model group, the expressions of ZO-1, E-cadherin, and Occludin were significantly downregulated in the colon lesion tissues. While in the EcN-T treatment group, the expressions of ZO-1, E-cadherin, and Occludin were effectively restored, indicating that the intestinal barrier function was restored. Figure 5A-D). Further Western blot analysis also confirmed that EcN-T treatment could significantly upregulate the expression levels of ZO-1, E-cadherin, and Occludin in intestinal tissues. In contrast, no similar repair effects were observed in the mouse models orally administered with EcN or Melanin( Figure 5 E-H).

[0059] The experiments in this example fully demonstrated that EcN-T effectively restored and maintained intestinal barrier function by promoting the formation of tight junction complexes, and this mechanism is of great significance in alleviating DSS-induced intestinal barrier injury and ICD treatment.

[0060] Example 4 Regulation of Short-chain Fatty Acids (SCFAs) and Intestinal Microbiota by Engineered Probiotic EcN-T

[0061] The human intestinal microbiota, composed of bacteria, fungi / yeasts, and viruses, plays a key role in maintaining health and immune regulation. Changes in its composition are closely related to various diseases such as diabetes, obesity, colorectal cancer, and inflammatory bowel disease (IBD). Bacteria that digest dietary fiber can produce short-chain fatty acids (SCFAs), such as acetate, propionate, and butyrate, which are crucial for maintaining metabolic and immune balance as well as intestinal barrier integrity. Current treatment methods, such as prebiotics and probiotics, often have inconsistent effects, so the research on a new generation of probiotics targeting SCFA-producing bacteria has become an important direction for restoring gut-immune interactions.

[0062] SCFA levels can directly reflect the impact of colitis on mouse metabolism. As Figure 6 shown in A, in the DSS-induced colitis model group, SCFA levels decreased significantly, while in the EcN-T treatment group, SCFA levels were restored, specifically manifested as the regulation of valeric acid, propionic acid, and butyric acid levels, thus achieving the therapeutic effect( Figure 6 B-D).

[0063] To further explore the changes in the intestinal microbiota of different mouse groups, 16S rRNA sequencing analysis was performed on fecal samples in this example. The results showed that the EcN-T treatment group significantly increased the Shannon index and Simpson index, enhancing the diversity of the microbiota( Figure 6 E-F). Principal coordinate analysis (PCoA) revealed that compared with the DSS-induced colitis model group, EcN-T intervention had a significant impact on the overall microbial composition( Figure 6 G).

[0064] In further analysis at the genus level, it was found that the EcN-T treatment group achieved its therapeutic effect by increasing the proportion of beneficial bacteria (such as Bacteroides and Lactobacillus) while decreasing the proportion of harmful bacteria (such as Sutterella). Figure 6 H-I). In addition, linear discriminant analysis effect size (LEfSe) analysis showed that the abundances of beneficial bacteria such as Bacteroidia, Bacteroidales, Bacteroidetes, Bacteroidaceae, and Bacteroides were significantly increased in the EcN-T treatment group. Figure 6 J-K).

[0065] The research results of this example showed that EcN-T effectively improved colitis symptoms and restored intestinal homeostasis by regulating SCFA levels and the composition of the gut microbiota. This finding provides an important scientific basis for using engineered probiotics to treat inflammatory bowel disease and demonstrates its potential application value in metabolism and immune regulation.

[0066] Example 5 The role of engineered bacteria in immune regulation

[0067] In this example, transcriptomic analysis was further performed on the intestinal tissues of mice under different treatments. Venn diagram analysis showed significant transcriptomic differences among the healthy group, the DSS-induced colitis model group, and the EcN-T treatment group. Figure 7 A). Volcano plot analysis of gene expression between the DSS-induced colitis model group and the EcN-T treatment group showed significant differences, especially genes related to glycolysis, HIF-1a, GLUT1, and PFKFB3, which were significantly downregulated after EcN-T treatment. Figure 7 B). Gene ontology (GO) analysis revealed significant differences (p<0.05) in biological processes among mice under different treatments, including cell adhesion molecule binding, chemokine-mediated signaling pathways, glycolysis process, bicellular tight junctions, tricarboxylic acid cycle, vascular endothelial growth factor receptor signaling pathway, gluconeogenesis, JAK-STAT-mediated receptor signaling pathway, tumor necrosis factor-mediated signaling pathway, and apoptosis process. Figure 7 C). In addition, based on the log2FC of differentially expressed genes, Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis was performed on different treatment groups to further explore relevant signaling pathways. Figure 7D). As a widely used bioinformatics resource, KEGG covers data on genomes, biological pathways, diseases, drugs, and chemicals, and is of great significance for drug development and translational research. Analysis showed that the genes differentially expressed between the DSS-induced colitis model group and the EcN-T treatment group were enriched in 10 key pathways, including cell adhesion molecules, TNF signaling pathway, inflammatory bowel disease, HIF-1 signaling pathway, NF-kappa B signaling pathway, tight junctions, glycolysis / gluconeogenesis, Toll-like receptor signaling pathway, AMPK signaling pathway, and mTOR signaling pathway. To verify the differential gene expression in the colon tissues of mice in different treatment groups, Western blot analysis and q-PCR analysis were performed in this example ( Figure 7 E-F). The results showed that compared with the DSS-induced colitis model group, EcN-T treatment significantly downregulated the expression of HIF-1a, GLUT1, and PFKFB3, which was consistent with the results of the volcano plot analysis.

[0068] To further determine the major participating cell types, immune infiltration analysis of the transcriptome data of mouse colon tissues was performed using CIBERSORT in this example. The results showed that compared with the DSS-induced colitis model group, the number of M1 macrophages in the EcN-T treatment group was significantly reduced ( Figure 7 G). Immunofluorescence staining (double staining of F4 / 80+CD86) further confirmed that EcN-T treatment significantly reduced the number of M1 macrophages in mouse colon tissues ( Figure 7 H). To further verify the regulatory effect of EcN-T on the polarization of M1 macrophages, EcN-T was co-cultured with RAW264.7 cells by the Transwell method in this example. By measuring the extracellular acidification rate (ECAR) and oxygen consumption rate (OCR), the dynamic changes of glycolysis and the tricarboxylic acid (TCA) cycle were evaluated respectively. The results showed that LPS stimulation significantly increased the ECAR and OCR of macrophages polarized into the M1 phenotype, which was consistent with previous studies, while EcN-T treatment significantly reversed this phenomenon ( Figure 7 I-J). In addition, the production of lactate, a key product of glycolysis, was measured in this example, and it was found that the lactate level of macrophages under LPS stimulation was significantly increased, while EcN-T treatment significantly reduced lactate production ( Figure 7 K). ELISA analysis of inflammatory cytokines in the cell culture supernatant showed that the levels of pro-inflammatory cytokines IL-1b, TNF-a, and IL-6 were significantly reduced in the EcN-T co-culture group, while the level of anti-inflammatory cytokine IL-10 was significantly increased ( Figure 8A). Further flow cytometry analysis showed that LPS stimulation promoted the polarization of M0 macrophages to the M1 phenotype (marked by CD86 staining), while co - culture with EcN - T significantly inhibited this polarization process ( Figure 8 B). Finally, the expression levels of HIF - 1a, GLUT1, and PFKFB3 were analyzed by Western blot on the RAW264.7 cell line. The results showed that EcN - T treatment significantly down - regulated the expression levels of these proteins, which was consistent with the volcano plot and other experimental results. Figure 8 C - D).

[0069] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be covered within the scope of the claims and the description of the present invention.

Claims

1. The application of engineered bacteria that synthesize melanin in the preparation of drugs for the treatment of inflammatory bowel disease.

2. The use according to claim 1, characterized in that: The engineered bacteria are capable of repairing the intestinal mucosal barrier.

3. The use according to claim 1, characterized in that: The engineered bacteria are able to modulate short-chain fatty acid levels and intestinal flora.

4. The use according to claim 1, characterized in that: The engineered bacteria are capable of regulating the HIF-1α immune signaling pathway.

5. The use according to claim 1, characterized in that: The inflammatory bowel disease is ulcerative colitis.

6. The use according to claim 5, characterized in that: The drug is administered orally.

7. The use according to claim 5 or 6, characterized in that: The effective dose of the drug is 1x10 9 CFU / time.

8. The use according to claim 1, characterized in that: The preparation method of the engineered bacteria for synthesizing melanin is as follows: inserting a tyrosinase gene carrying a 6×His tag into the downstream of a strong promoter pJ23119, constructing a recombinant plasmid expressing 6×His-tagged tyrosinase, and then introducing the recombinant plasmid into bacteria to construct an engineered bacterium, and then incubating the engineered bacterium with L-tyrosine and Cu + Co-culture produces melanin.

9. The use according to claim 8, characterized in that: The bacterium is Escherichia coli Nissle 1917.