Zero-background carrier as well as preparation method and application thereof
By designing an optimized zero-background vector and combining homologous recombination technology, the problems of vector self-joining and background noise in traditional gene cloning are solved, and the success rate and assembly efficiency of short gene cloning are significantly improved.
Patent Information
- Application Number
- CN202510199494.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-24
- Publication Date
- 2025-06-20
AI Technical Summary
The existence of vector self-connection in traditional gene cloning technology leads to excessive false positive clones, making background noise difficult to control, especially for short gene cloning with low success rate.
A zero-background vector was designed, containing the optimized E. coli CcdB gene and corresponding promoter, and the common enzyme cleavage sites were optimized and removed through codons, and combined with homologous recombination technology to achieve efficient genome assembly and expression.
It effectively reduces the generation of false positive clones, improves the success rate of short gene clones, significantly improves the efficiency and positive rate of genome assembly, and reduces background noise.
Smart Images

Figure CN120173983A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology and relates to a zero-background vector, a preparation method thereof, and an application thereof. Background Art
[0002] In recent years, gene cloning has achieved fruitful results in agriculture, animal husbandry, and medicine. Its basic principle is to ligate an exogenous gene with a cloning vector in vitro, and then transform a host cell to screen for transformants containing the recombinant plasmid with the target gene.
[0003] With the development of modern biotechnology, gene cloning plays a crucial role in many fields such as life science research, medical diagnosis and treatment, and agricultural breeding. However, there are many problems in traditional gene cloning technology.
[0004] Traditional gene cloning steps include: selecting a target gene and designing related primers; PCR amplifying the target gene fragment with the primers; selecting a suitable cloning vector (such as a resistance gene, restriction enzyme site, etc.) for faithful amplification, and ligating the PCR fragment into the cloning vector (generally, the PCR product using Taq enzyme will carry an A at the end, which can be ligated to a linear vector with a T at each end under the action of Solution 1). In the traditional gene cloning process, a significant problem is the phenomenon of vector self-ligation. When the vector is cut with a restriction endonuclease, in the ligation reaction step, the sticky ends or blunt ends of the vector itself are prone to reconnect under the action of the ligase, resulting in a large number of false-positive clones. This false-positive result will consume a large amount of time and resources in the subsequent screening and identification processes, seriously affecting the efficiency of gene cloning.
[0005] At the same time, for the problem of background noise in gene cloning, conventional methods are difficult to effectively eliminate. Background noise mainly comes from the insertion of non-target gene fragments or the non-specific binding of the vector to other impurities. The presence of these non-target genes or impurities in the cloning system makes the cloning of the true target gene complex and difficult.
[0006] In addition, when cloning some short genes, traditional techniques face greater challenges. Due to their short length, short genes are more likely to be lost or misligated during operations such as extraction and ligation. Existing gene cloning techniques lack effective means specifically targeting their characteristics when dealing with short genes, resulting in a low success rate of short gene cloning. Summary of the Invention
[0007] Based on this, the present application provides a zero-background vector, a preparation method thereof, and an application thereof to solve the technical problems in the prior art that background noise is difficult to effectively eliminate, there are a large number of false-positive clones, and the success rate of short gene cloning is relatively low.
[0008] The technical solution of the present application to solve the above technical problems is as follows:
[0009] A zero-background vector, comprising an optimized Escherichia coli CcdB gene and a corresponding Escherichia coli promoter, and the nucleotide sequence of the optimized Escherichia coli CcdB gene is shown in SEQ ID NO.1.
[0010] Preferably, for the above zero-background vector, the Escherichia coli promoter includes any one of lac promoter, CAT promoter, Tac promoter, Trp promoter, Tet promoter, T5 promoter, Ptac promoter, Pl promoter, LacUV5 promoter, araBAD promoter.
[0011] A preparation method of a zero-background vector as described above, comprising the following steps:
[0012] S10. Optimization and synthesis of the Escherichia coli CcdB gene: Optimize the codons of the Escherichia coli CcdB gene, erase common restriction sites, obtain the optimized Escherichia coli CcdB gene, and perform total gene synthesis on the optimized Escherichia coli CcdB gene to obtain a gene fragment;
[0013] S20. Addition of the Escherichia coli CcdB gene promoter: Perform PCR amplification on the gene fragment to obtain a CcdB gene with an Escherichia coli promoter;
[0014] S30. Insert the CcdB gene with an Escherichia coli promoter into the target plasmid: Design PCR primers according to the target plasmid. Both the 5' end and 3' end of the PCR product have 20bp homologous arms. Perform PCR amplification. The PCR amplification system and procedure are the same as in step S20, except that the primers are replaced with the primers designed according to the target plasmid, and the template is replaced with the target plasmid; Extract the target plasmid and digest it with enzymes to obtain a linearized target plasmid; Perform homologous recombination on the linearized target plasmid and the PCR product with homologous arms, and transform the ligated target plasmid into the first Escherichia coli competent cells. After successful PCR identification and sequencing identification, obtain a target plasmid containing the Escherichia coli CcdB gene and its promoter, that is, the zero-background vector.
[0015] Preferably, in the preparation method of the zero-background vector, in step S20, the PCR system is as follows: 12.5 μL of 2×Phanta Max Mater Mix polymerase, 1 μL of CcdB-1F, 1 μL of CcdB-R, 1 μL of the gene fragment, and finally supplemented to 25 μL with ddH2O; the PCR amplification program is: pre-denaturation at 95°C for 1 cycle of 3 min, then denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 30 s, for a total of 35 cycles; finally, extension at 72°C for 5 min to end; take the PCR product as the template for the second-round PCR, and perform PCR using CcdB-2F and CcdB-R according to the above system and program; the sequences of CcdB-1F, CcdB-2F, and CcdB-R are shown in SEQ ID NO.2 to SEQ ID NO.4.
[0016] Preferably, in the preparation method of the zero-background vector, in step S30, the first Escherichia coli competent cells include any one of DB3.1 and ccdB Survival competent cells.
[0017] Preferably, in the preparation method of the zero-background vector, in step S30, the method for digesting the target plasmid with restriction enzymes is 2 μL of digestion buffer, 1 μg of the target plasmid, 1 μg of restriction enzyme, and supplemented to 20 μL with double-distilled water, and digested at 37°C for 4 h.
[0018] An application of the zero-background vector as described above in the high-efficiency assembly of small fragment genes.
[0019] A method for high-efficiency assembly of small fragment genes, using the zero-background vector as described above, includes the following steps:
[0020] T10. Treat the zero-background vector with restriction enzymes to obtain a linearized zero-background vector;
[0021] T20. Divide the small fragment gene into multiple small fragment gene segments, each of the small fragment gene segments not exceeding 59 bp and containing a 5'-end 20-bp homologous arm and a 3'-end 20-bp homologous arm; synthesize the small fragment gene segments into double-stranded small fragment genes; wherein, the length of the small fragment gene is between 0 and 50 bp;
[0022] T30. Connect the double-stranded small fragment genes to the linearized zero-background vector and transform them into the second Escherichia coli competent cells to obtain a target plasmid with small fragment genes.
[0023] Preferably, in the method for high-efficiency assembly of small fragment genes, in step T20, the specific method for synthesizing the small fragment gene segments into double-stranded small fragment genes is:
[0024] Synthesize the small fragment gene segment into single-stranded DNA, dilute the synthesized single-stranded DNA to 100 μM with double-distilled water, take 1 μL of each fragment into a centrifuge tube, heat to 95 °C and slowly anneal to room temperature to obtain the double-stranded small fragment gene.
[0025] Preferably, in the high-efficiency assembly method of the above small fragment gene, in step T30, the second Escherichia coli competent cell includes any one of competent cells such as DH5α, TOP10, Stbl2, Stbl3, JM109, and XL10-Gold.
[0026] This application adopts the above technical solution and has at least the following effects:
[0027] A zero-background vector provided by this application includes an optimized Escherichia coli CcdB gene and a corresponding Escherichia coli promoter. The nucleotide sequence of the optimized Escherichia coli CcdB gene is shown in SEQ ID NO.1. The zero-background vector constructed by the present invention can be applied to any plasmid vector; both cloning vectors and expression vector plasmids have high ligation efficiency and positive rate. The ligation product can be directly transformed into common Escherichia coli strains, so that a target gene cloning vector can be effectively prepared; the target plasmid inserted into the zero-background vector has high insertion efficiency for short fragments and can also be used for the insertion of long fragments.
[0028] The high-efficiency assembly method of small fragment genes provided by this application adopts the above zero-background vector, realizes the high-efficiency expression of genes by optimizing codons and removing common restriction sites and combining with promoters, thereby effectively eliminating the problem of vector self-ligation. The design of the target gene fragment is achieved by adding restriction sites or homologous arms to achieve efficient ligation with the vector. During the gene assembly process, whether it is the insertion of small fragments or larger gene fragments, this method can ensure high-efficiency assembly effects, especially in the cloning of small fragment genes, which can significantly improve its efficiency and positive rate while reducing the generation of false-positive clones. In the experiment, competent Escherichia coli was used for transformation screening, combined with agar plate colony counting, PCR and sequencing verification to ensure high positive rate and insertion accuracy. Compared with traditional methods, this method has significant improvements in background control, small fragment gene cloning efficiency and operational simplicity. It is widely applicable to fields such as molecular cloning, gene editing and vector construction, providing an efficient tool for related research. Brief Description of the Drawings
[0029] Figure 1Design idea for small fragment genes; Step 1: Design of small gene fragments (the target gene is divided into multiple fragments, each fragment ≤ 59 bp), and synthesis of 20 bp homologous arms at the 5' and 3' ends and single-stranded DNA; Step 2: Annealing of double-stranded DNA (heating to 95 °C and cooling by 1 °C per minute to room temperature to form double-stranded DNA); Step 3: Homologous recombination ligation (ligation of double-stranded DNA and linearized plasmid through homologous arms); Step 4: Transformation of the plasmid into competent cells and screening for positive clones.
[0030] Figure 2 Regarding the expression effects of different promoters in different competent cells, the effects of different promoters on the growth of Escherichia coli were compared through plate colony counting; (a) shows the plate colony counting after the lac promoter was transferred into different competent cells; (b) shows the plate colony counting after the tet promoter was transferred into different competent cells; (c) shows the plate colony counting after the tac promoter was transferred into different competent cells; (d) shows the plate colony counting after the cat promoter was transferred into different competent cells.
[0031] Figure 3 Shows the colony distribution on agar plates after different promoters were transferred into different competent cells.
[0032] Figure 4 Is the agarose gel electrophoresis diagram for double digestion verification of whether the target gene was inserted into the lentiCRISPR v2-puro-CcdB plasmid, showing the band results of the double digestion products; M: DNA Marker (bp); 1: Plasmid with the inserted target gene; 2: Original plasmid control.
[0033] Figure 5 Is the bar graph of plate colony counting for inserting foreign genes into the lentiCRISPR v2-puro-CcdB plasmid by different methods; Plate colony counting results after inserting foreign genes by the three-fragment homologous recombination method; Plate colony counting results after inserting foreign genes by the two-fragment homologous recombination method; Plate colony counting results after inserting foreign genes by T4 DNA ligase.
[0034] Figure 6 Is the plate colony diagram for inserting foreign genes into the lentiCRISPR v2-puro-CcdB plasmid by different methods; (a) is the control group for inserting foreign genes by the three-fragment homologous recombination method; (b) is the control group for inserting foreign genes by the two-fragment homologous recombination method; (c) is the control group for inserting foreign genes by 4 DNA ligase; (d) is the experimental group for inserting foreign genes by the three-fragment homologous recombination method; (e) is the experimental group for inserting foreign genes by the two-fragment homologous recombination method; (f) is the experimental group for inserting foreign genes by T4 DNA ligase.
[0035] Figure 7Detection of the positive rate of the target gene of the lentiCRISPRv2-puro-CcdB plasmid; M: DNA Marker (bp); 1-20: Bacterial sample; N: Negative control; (a) Results of the three-fragment homologous recombination method of lentiCRISPR v2-puro-CcdB; (b) Results of the two-fragment homologous recombination method of lentiCRISPR v2-puro-CcdB; (c) Results of lentiCRISPR v2-puro-CcdB T4 DNA ligase; (d) Results of the lentiCRISPR v2-puro-CcdB negative control.
[0036] Figure 8 Agarose gel electrophoresis diagram for double digestion verification of whether the target gene is inserted into the pLKO.1-puro-CcdB plasmid; M: DNA Marker (bp); 1: Plasmid with the inserted target gene; 2: Original plasmid control.
[0037] Figure 9 Histogram of plate colony statistics for inserting foreign genes into the pLKO.1-puro-CcdB plasmid by different methods; Plate colony statistics results after inserting foreign genes by the three-fragment homologous recombination method; Plate colony statistics results after inserting foreign genes by the two-fragment homologous recombination method; Plate colony statistics results after inserting foreign genes by T4 DNA ligase.
[0038] Figure 10 Plate colony diagrams of inserting foreign genes into the pLKO.1-puro-CcdB plasmid by different methods; (a) Control group for inserting foreign genes by the three-fragment homologous recombination method; (b) Control group for inserting foreign genes by the two-fragment homologous recombination method; (c) Control group for inserting foreign genes by T4 DNA ligase; (d) Experimental group for inserting foreign genes by the three-fragment homologous recombination method; (e) Experimental group for inserting foreign genes by the two-fragment homologous recombination method; (f) Experimental group for inserting foreign genes by T4 DNA ligase.
[0039] Figure 11 Detection of the positive rate of the target gene of the pLKO.1-puro-CcdB plasmid; M: DNA Marker (bp); 1-20: Bacterial sample; N: Negative control; (a) Results of the three-fragment homologous recombination method of pLKO.1-puro-CcdB; (b) Results of the two-fragment homologous recombination method of pLKO.1-puro-CcdB; (c) Results of pLKO.1-puro-CcdB T4 DNA ligase; (d) Results of the pLKO.1-puro-CcdB negative control.
[0040] Figure 12Agarose gel electrophoresis diagram for double digestion verification of whether the target gene is inserted into the pET28a-CcdB plasmid; M: DNA Marker (bp); 1: Plasmid with the target gene inserted; 2: Original plasmid control.
[0041] Figure 13 Bar chart of plate colony statistics for inserting foreign genes into the pET28a-CcdB plasmid by different methods; Colony statistics results after inserting foreign genes by the two-fragment homologous recombination method; Colony statistics results after inserting foreign genes by T4 DNA ligase.
[0042] Figure 14 Plate colony diagrams of inserting foreign genes into the pET28a-CcdB plasmid by different methods; (a) Control group for inserting foreign genes by the two-fragment homologous recombination method; (b) Control group for inserting foreign genes by T4 DNA ligase; (c) Experimental group for inserting foreign genes by the two-fragment homologous recombination method; (d) Experimental group for inserting foreign genes by T4 DNA ligase.
[0043] Figure 15 Detection of the positive rate of the target gene of the pET28a-CcdB plasmid; M: DNA Marker (bp); 1 - 20: Bacterial sample; N: Negative control; (a) Results of the two-fragment homologous recombination method of pET28a-CcdB; (b) Results of pET28a-CcdB T4 DNA ligase; (c) Results of the pET28a-CcdB negative control. Detailed implementation manners
[0044] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other. The following will further describe the technical solutions of the present invention with reference to the drawings of the embodiments of the present invention. The present invention is not limited to the following specific implementation manners.
[0045] Please refer to Figures 1 to 15, in a specific embodiment of the present application, a zero-background vector includes an optimized Escherichia coli CcdB gene and a corresponding Escherichia coli promoter. The nucleotide sequence of the optimized Escherichia coli CcdB gene is shown in SEQ ID NO.1. Preferably, the Escherichia coli promoter includes any one of the lac promoter, CAT promoter, Tac promoter, Trp promoter, Tet promoter, T5 promoter, Ptac promoter, Pl promoter, LacUV5 promoter, and araBAD promoter. Experiments show that all the promoters exhibit strong lethal effects in the DB3.1 strain and are suitable for subsequent experiments. Since the lac promoter is relatively commonly used, the lac promoter is preferentially selected as the expression control element. The zero-background vector constructed by the present invention can be applied to any plasmid vector; both cloning vectors and expression vector plasmids have high ligation efficiency and positive rates, and the ligation products can be directly transformed into common Escherichia coli strains, thereby effectively preparing the target gene cloning vector; the target plasmid inserted into the zero-background vector has high insertion efficiency for short fragments and can also be used for the insertion of long fragments.
[0046] In a specific embodiment of the present application, a preparation method of a zero-background vector as described above includes the following steps:
[0047] S10. Optimization and synthesis of the Escherichia coli CcdB gene: Optimize the codons of the Escherichia coli CcdB gene, erase common restriction enzyme sites, obtain the optimized Escherichia coli CcdB gene, and perform whole gene synthesis on the optimized Escherichia coli CcdB gene to obtain a gene fragment; specifically, submit the Escherichia coli CcdB gene (GenBank: MK492260) to www.novopro.cn / tools / codon-optimization.html for codon optimization. The optimization object is Escherichia coli, and all common restriction enzyme sites are erased as much as possible. The obtained nucleotide sequence is shown in SEQ ID NO.1, and this sequence is submitted to Shanghai Sangon Biotech for whole gene synthesis. By optimizing codons and removing common restriction enzyme sites, combined with the promoter, efficient expression of the gene can be achieved, thereby effectively eliminating the problem of vector self-ligation. Among them, SEQ ID NO.1 is:
[0048] ATGCAGTTCAAAGTTTACACTTACAAACGCGAAAGCCGTTACCGCCTGTTTGTAGATGTACAGAGCGACATCATTGATACTCCGGGTCGTCGCATGGTTATTCCACTGGCGTCTGCCCGCCTGCTGTCCGATAAAGTATCTCGCGAACTGTACCCGGTGGTTCACATCGGTGACGAATCTTGGCGCATGATGACCACCGACATGGCGTCTGTTCCGGTGTCCGTTATTGGCGAAGAGGTAGCTGATCTGAGCCACCGCGAGAACGACATCAAGAACGCGATCAACCTGATGTTCTGGGGTATCTAA。
[0049] S20. Addition of the promoter of the Escherichia coli CcdB gene: The gene fragment was subjected to PCR amplification to obtain the CcdB gene with an Escherichia coli promoter; further, the PCR system was as follows: 12.5 μL of 2×PhantaMax Master Mix polymerase, 1 μL of CcdB-1F, 1 μL of CcdB-R, 1 μL of the gene fragment, and finally supplemented to 25 μL with ddH2O; the PCR amplification program was: pre-denaturation at 95 °C for 1 cycle of 3 min, then denaturation at 95 °C for 15 s, annealing at 60 °C for 15 s, and extension at 72 °C for 30 s, for a total of 35 cycles; finally, extension was carried out at 72 °C for 5 min to end; the PCR product was taken as the template for the second round of PCR, and PCR was carried out using CcdB-2F and CcdB-R according to the above system and program; the sequences of CcdB-1F, CcdB-2F, and CcdB-R are shown in SEQ ID NO.2 to SEQ ID NO.4.
[0050] S30. Insert the CcdB gene with an E. coli promoter into the destination plasmid: Design PCR primers according to the destination plasmid. The 5' and 3' ends of the PCR product have 20-bp homologous arms. Conduct PCR amplification. The PCR amplification system and procedure are the same as in step S20, except that the primers are replaced with the primers designed according to the destination plasmid, and the template is replaced with the destination plasmid; Extract the destination plasmid and digest it with enzymes to obtain a linearized destination plasmid; Perform homologous recombination on the linearized destination plasmid and the PCR product with homologous arms, and transform the ligated target plasmid into the first E. coli competent cells. After successful PCR identification and sequencing identification, obtain the destination plasmid containing the E. coli CcdB gene and its promoter, that is, the zero-background vector. Further, the first E. coli competent cells include any one of DB3.1 and ccdB Survival competent cells. The method for digesting the destination plasmid with enzymes is 2 μL of enzyme digestion buffer, 1 μg of target plasmid, 1 μg of restriction endonuclease, and double-distilled water is added to make up to 20 μL, and digest at 37 °C for 4 h.
[0051] In another specific embodiment of the present application, an application of the zero-background vector as described above in the high-efficiency assembly of small fragment genes.
[0052] In yet another specific embodiment of the present application, a method for high-efficiency assembly of small fragment genes, using the zero-background vector as described above, includes the following steps:
[0053] T10. Treat the zero-background vector with a restriction endonuclease to obtain a linearized zero-background vector;
[0054] The method for treating with a restriction endonuclease is: 2 μL of 10× enzyme digestion buffer, 1 μg of recombinant plasmid, 1 μL of AgeI, 1 μL of EcoRI, and double-distilled water is added to make up to 20 μL, and digest at 37 °C for 1 h. The required enzymes need to be determined according to the enzyme digestion sites of the target plasmid.
[0055] T20. Divide the small fragment gene into multiple small fragment gene segments, each of the small fragment gene segments does not exceed 59 bp, and contains a 20-bp homologous arm at the 5' end and a 20-bp homologous arm at the 3' end; Synthesize the small fragment gene segments into double-stranded small fragment genes; wherein, the length of the small fragment gene is between 0 and 50 bp;
[0056] Further, the specific method for synthesizing the small fragment gene segments into double-stranded small fragment genes is: Synthesize the small fragment gene segments into single-stranded DNA, dilute the synthesized single-stranded DNA with double-distilled water to 100 μM, take 1 μL of each fragment into a centrifuge tube, heat to 95 °C and slowly anneal to room temperature to obtain the double-stranded small fragment genes.
[0057] Specifically, the small fragment gene is divided into multiple segments, and each segment does not exceed 59 bp. If the homologous recombination method is used for ligation, the small fragment gene segment needs to contain a 20-bp homologous arm at the 5' end and a 20-bp homologous arm at the 3' end. The small fragment gene segments are synthesized, and the synthesis principle diagram is shown in the appendix Figure 1 ; if the T4 DNA ligase is used for ligation, the small fragment gene segment needs to contain restriction enzyme sites at the 5' end and the 3' end. The designed small fragment gene is submitted to Shanghai Sangon Biotech for synthesizing single-stranded DNA. The synthesized single-stranded DNA is diluted to 100 μM with double-distilled water. 1 μL of each fragment is taken into a centrifuge tube, heated to 95 °C and slowly annealed to room temperature to obtain double-stranded small fragment genes.
[0058] T30. The double-stranded small fragment genes are ligated to the linearized zero-background vector and transformed into the second Escherichia coli competent cells to obtain the target plasmid carrying the small fragment gene.
[0059] Preferably, the second Escherichia coli competent cells include any one of DH5α, TOP10, Stbl2, Stbl3, JM109, and XL10-Gold competent cells.
[0060] Specifically, if the homologous recombination method is used, 0.06 pmol of double-stranded small fragment genes, 0.03 pmol of linearized target plasmid, and double-distilled water are added to make up to 5 μL, and 5 μL of homologous recombination enzyme is added. The ligation is carried out at 50 °C for 30 min. If the T4 DNA ligase is used for ligation, the double-stranded small fragment genes need to undergo a restriction enzyme reaction. The reaction system and procedure are as follows: 1 μg of recombinant plasmid, 1 μL of KpnI, 1 μL of EcoRI, 2 μL of 10× restriction enzyme buffer, and double-distilled water is added to make up the total reaction volume to 20 μL. The reaction system is reacted at 37 °C for 1 h. 0.06 pmol of double-stranded small fragment genes, 0.03 pmol of linearized target plasmid, and double-distilled water are added to make up to 5 μL, and 5 μL of T4 DNA ligase is added. The ligation is carried out at 16 °C for 60 min. After the reaction is completed, the ligation product is transformed into any one of the competent cells of Escherichia coli DH5α, TOP10, Stbl2, Stbl3, JM109, and XL10-Gold. After agarose gel electrophoresis, the target plasmid carrying the small fragment gene is obtained.
[0061] It should be noted that in the above embodiments, the process temperatures and process times involved are all a temperature or time adopted during the experiment. Those skilled in the art can make reasonable adjustments within the error range based on the process temperatures and process times provided by the present invention, and all should be included within the protection scope of the present invention.
[0062] The following further illustrates the technical solutions and technical effects of the present invention through specific experimental examples.
[0063] Example 1: Influence of Different Promoters on the Expression of Escherichia coli CcdB Gene
[0064] 1. Construction of pUC19-lac-CcdB Plasmid
[0065] The Escherichia coli CcdB gene (GenBank: MK492260) was submitted to www.novopro.cn / tools / codon-optimization.html for codon optimization. The optimization species was Escherichia coli, and all common restriction sites were erased as much as possible. The obtained nucleotide sequence is shown in SEQ ID NO.1, and this sequence was submitted to Sangon Biotech (Shanghai) Co., Ltd. for gene synthesis. The obtained gene fragment was subjected to PCR amplification, and the primer sequences are shown in SEQ ID NO.2 to SEQ ID NO.4. The PCR amplification system is as follows:
[0066] Reagent Dosage 2×PhantaMax Master Mix 12.5 μL CcdB-1F 1 μL CcdB-R 1 μL Synthesized CcdB gene 1 μL ddH2O Up to 25 μL
[0067] The PCR program is as follows:
[0068]
[0069] Among them, SEQ ID NO.1 is:
[0070] ATGCAGTTCAAAGTTTACACTTACAAACGCGAAAGCCGTTACCGCCTGTTTGTAGATGTACAGAGCGACATCATTGATACTCCGGGTCGTCGCATGGTTATTCCACTGGCGTCTGCCCGCCTGCTGTCCGATAAAGTATCTCGCGAACTGTACCCGGTGGTTCACATCGGTGACGAATCTTGGCGCATGATGACCACCGACATGGCGTCTGTTCCGGTGTCCGTTATTGGCGAAGAGGTAGCTGATCTGAGCCACCGCGAGAACGACATCAAGAACGCGATCAACCTGATGTTCTGGGGTATCTAA.
[0071] SEQ ID NO.2 is:
[0072] CcdB-1F: 5’-tccggctcgtatgttgtgtggacacatgcagttcaaagtttacacttacaaacgc-3’;
[0073] SEQ ID NO.3 is:
[0074] CcdB-2F: 5'-tttacactttatgcttccggctcgtatgttgtgtgg-3';
[0075] SEQ ID NO.4 is:
[0076] CcdB-R: 5'-ttagataccccagaacatcaggttga-3'.
[0077] Take 1 μL of the PCR product as the template for the second-round PCR amplification. The reaction system is the same as the first-round system except that the primers are replaced with CcdB-2F and CcdB-R (SEQ ID NO.2), and the PCR program is the same as the first-round program. After subjecting the second-round PCR product to 1% agarose gel electrophoresis at 110 V for 30 min, use a gel recovery kit to excise and recover the gene fragment amplified by PCR to obtain a lac-CcdB gene fragment with a size of 305 bp.
[0078] To obtain the gene sequence of the resistance gene fragment and the origin of replication ori of the Escherichia coli plasmid, perform PCR amplification on the pUC19 plasmid (the target plasmid in this example). The PCR amplification system and program are the same as the above, replace the primers with pUC19-CcdB-F and pUC19-CcdB-R, and replace the template with the pUC19 plasmid.
[0079] The above primer sequences are:
[0080] pUC19-CcdB-F: 5'-tgatgttctggggtatctaacgaaagggcctcgtgatacg-3'
[0081] pUC19-CcdB-R: 5'-ccggaagcataaagtgtaaatcactcaaaggcggtaatacgg-3'.
[0082] After subjecting the PCR product to 1% agarose gel electrophoresis at 110 V for 30 min, the gel extraction kit was used to excise and recover the gene fragment amplified by PCR, obtaining an Amp-ori gene fragment with a size of 1,975 bp. Take 0.06 pmol of the lac-CcdB gene fragment and 0.03 pmol of the Amp-ori gene fragment into a centrifuge tube, add double-distilled water to make up to 5 μL, add 5 μL of homologous recombinase, and incubate at 50 °C for 30 min. The ligation product was ligated and transformed into Escherichia coli DB3.1 competent cells, spread on an LB agar plate with ampicillin resistance, and cultured overnight (16 - 18 h) in a 37 °C incubator. Then, multiple monoclonal strains were randomly selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. After sequencing and identification as positive, the pUC19-lac-CcdB plasmid (the zero-background vector in this example) was obtained.
[0083] 2. Lethal effects of different CcdB promoters on Escherichia coli competent cells
[0084] To replace lac in the pUC19-lac-CcdB plasmid with the Tet promoter, Tac promoter, and CAT promoter, using the pUC19-lac-CcdB plasmid as a template, the primers were Tet-CcdB-F and Tet-CcdB-R; Tac-CcdB-F and Tac-CcdB-R; CAT-CcdB-F and CAT-CcdB-R, respectively. The PCR reaction program was the same as that for obtaining the Amp-ori gene fragment described above. After subjecting the PCR product to 1% agarose gel electrophoresis at 110 V for 30 min, the gel extraction kit was used to excise and recover the gene fragment amplified by PCR. After cyclization with KLD cyclase, it was transformed into Escherichia coli DB3.1 competent cells. Five monoclonal strains were randomly selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. After sequencing and identification, the pUC19-Tet-CcdB, pUC19-Tac-CcdB, and pUC19-CAT-CcdB plasmids were obtained. The pUC19-Tet-CcdB, pUC19-Tac-CcdB, and pUC19-CAT-CcdB plasmids were amplified in Escherichia coli DB3.1 competent cells, and the plasmids were extracted and purified.
[0085] The above primer sequences are as follows:
[0086] Tet-CcdB-F: 5’-cgattagctttaattgtggacacatgcagttcaaagt-3’;
[0087] Tet-CcdB-R: 5’-atgataagctgtcaatcactcaaaggcggtaatacgg-3’;
[0088] Tac-CcdB-F: 5'-cggctcgtataatgtgtggacacatgcagttcaaagt-3';
[0089] Tac-CcdB-R: 5'-atgattaattgtcaatcactcaaaggcggtaatacgg-3';
[0090] CAT-CcdB-F: 5'-ctcactataggtgtggacacatgcagttcaaagt-3';
[0091] CAT-CcdB-R: 5'-tcgtattatcactcaaaggcggtaatacgg-3'.
[0092] Competent Escherichia coli cells (DH5α, TOP10, Stbl3, JM109, Turbo, XL10-Gold) were prepared by chemical methods. DB3.1 competent cells were used as a control to ensure that they were treated under the same conditions. The competent cells were taken out from the -80 °C refrigerator and melted on ice for 5 min to maintain their transformation efficiency. 20 ng of each of the obtained plasmids (pUC19-Tet-CcdB, pUC19-Tac-CcdB, pUC19-CAT-CcdB) was added to 100 μL of different competent cells (DB3.1 and DH5α, TOP10, Stbl3, JM109, Turbo, XL10-Gold) respectively and gently mixed. Heat shock transformation was carried out. The tubes were quickly heated in a 42 °C water bath (about 45 s), and then immediately placed on ice to cool for 2 min to promote the entry of the plasmid into the competent cells. 1 mL of antibiotic-free LB medium was added to each tube, and the cells were resuscitated and cultured on a 37 °C shaker for 1 h. All the transformed bacteria were centrifuged and resuspended, and then spread evenly on agar plates containing ampicillin and incubated for 16 - 18 h. The transformation of each competent cell and the control group should be repeated at least three times to ensure the reliability of the experimental results.
[0093] The results showed that a large number of evenly distributed colonies grew on the DB3.1 plate. The colonies were plump and white, indicating that as the control group, DB3.1 grew normally and was not affected by the lethal effect of CcdB. There were almost no colonies growing on the plates of DH5α, TOP10, Stbl3, JM109, Turbo and XL10-Gold, indicating that these strains were sensitive to the lethal effect of CcdB. After carrying the CcdB plasmid, the survival rates of DH5α, TOP1, Stbl3, JM109, Turbo and XL10-Gold were extremely low, showing a strong lethal effect. Statistical analysis was performed on the growth of each host strain ( Figure 2) Select the optimal promoter based on the growth data of different plates. By measuring the number of monoclonal colonies on each plate and performing a one-way analysis of variance (ANOVA) on the data, the results showed that the growth differences among different host strains were statistically significant (P<0.01). The specific data showed that the average number of colonies of the DB3.1 strain was 1,357.08±7.45, while the number of colonies of other competent cells was all lower than 5.00±2.17. This indicates that all promoters showed a strong lethal effect in the DB3.1 strain and are suitable for subsequent experiments. Since the lac promoter is relatively commonly used, in the following experiments, the lac promoter was selected as the expression control element.
[0094] Example 2: Construction and application of the zero-background vector lentiCRISPR v2-puro-CcdB
[0095] 1. Construction of the lentiCRISPR v2-puro-CcdB plasmid
[0096] To insert the lac-CcdB fragment into the lentiCRISPR v2-puro plasmid (the target plasmid in this example), the lentiCRISPR v2-puro plasmid was digested with BsmBI in a 55°C water bath, and the digested product was recovered by cutting and gel extraction using 1% agarose gel electrophoresis at 110V for 30 min. To obtain the lac-CcdB gene fragment containing homologous arms, the pUC19-lac-CcdB plasmid was subjected to PCR amplification. The PCR amplification system and procedure were the same as described above, and the primers were replaced with lenti-lac-CcdB-F and lenti-lac-CcdB-R. A 399-bp PCR product was obtained by cutting and gel extraction using 1% agarose gel electrophoresis at 110V for 30 min. This PCR product is the lac-CcdB gene fragment. Take 0.06 pmol of the lac-CcdB gene fragment and 0.03 pmol of the lentiCRISPR v2-puro gene fragment into a centrifuge tube, add double-distilled water to make up to 5 μL, add 5 μL of homologous recombinase, and incubate at 50°C for 30 min. The ligation product was transformed into Escherichia coli DB3.1 competent cells, and multiple monoclonal strains were randomly selected, expanded in culture, and the plasmids were extracted.
[0097] Take 1 μg of the recombinant plasmid, 1 μL of KpnI, 1 μL of EcoRI, 2 μL of 10× digestion buffer, and supplement with double-distilled water to a total reaction volume of 20 μL. Incubate the reaction system at 37 °C for 1 h. Perform 1% agarose gel electrophoresis at 110 V for 30 min. If the insertion is successful, two bands, 12,659 bp and 693 bp, corresponding to the plasmid vector and the lac-CcdB fragment, respectively, should be visible. Based on the electrophoresis results, confirm the correctness of the recombinant plasmid, and the band sizes are consistent with the 693 bp expectation. Figure 4 ) It indicates that the lentiCRISPRv2-puro-CcdB plasmid (the zero-background vector in this example) was successfully constructed.
[0098] 2. Insertion of a 20-bp foreign gene by three-fragment homologous recombination
[0099] Amplify the lentiCRISPR v2-puro-CcdB plasmid in large quantities and extract the plasmid. After single digestion with BsmBI, precipitate the DNA. After the digestion is completed, add 1 / 10 volume of 3 M sodium acetate aqueous solution and 3 volumes of absolute ethanol, let it stand at -20 °C for 20 min, then centrifuge at 12,000 rpm for 5 min. After washing twice with 80% ethanol aqueous solution, dissolve the precipitate with double-distilled water to obtain the digested lentiCRISPR v2-puro-CcdB plasmid. At the same time, set the original plasmid lentiCRISPR v2-puro as the control group.
[0100] To obtain the insertion fragment containing the target gene, specific primers containing the target gene, gRNA-F and gRNA-R, need to be designed. For the lentiCRISPR v2-puro plasmid, the inserted target gene is usually a 20-bp Guide RNA. Therefore, only the Guide RNA sequence needs to be filled into the above primers. For example, if the Guide RNA sequence is gRNA, then gRNA-F and gRNA-R are gRNA1-F and gRNA1-R, respectively. At the same time, the fixed primers EF1a-R and U6-F corresponding to gRNA-F and gRNA-R need to be synthesized.
[0101] To amplify the inserted fragment containing the target gene, the lentiCRISPR v2-puro-CcdB plasmid needs to be PCR amplified. The PCR amplification system and procedure are the same as described above, and the primers are replaced with gRNA-F and EF1a-R; U6-F and gRNA-R. After PCR, precipitate the PCR product according to the method described above to obtain the PCR product containing the target gene. Take 0.06 pmol of the PCR product (amplified by gRNA-F and EF1a-R primers), 0.06 pmol of the PCR product (amplified by U6-F and gRNA-R primers), and 0.03 pmol of the lentiCRISPR v2-puro-CcdB gene fragment (recovered after digestion with BsmBI) into a centrifuge tube, add double-distilled water to make up to 5 μL, add 5 μL of homologous recombinase, and incubate at 50 °C for 30 min. Then ligate the ligation product and transform it into competent Escherichia coli Stbl3 cells, and spread it on an agar plate containing ampicillin resistance, and culture overnight. At the same time, set up a control group, replace the lentiCRISPR v2-puro-CcdB gene fragment with the lentiCRISPR v2-puro gene fragment (recovered after digestion with BsmBI), perform the ligation reaction using the same PCR products (gRNA-F / EF1a-R and U6-F / gRNA-R), use the same steps and system, spread it on an agar plate containing ampicillin resistance, and culture overnight.
[0102] After culturing the transformed agar plate at 37 °C for 12 - 16 h, a clear colony distribution was formed. By digitally imaging and collecting the agar plate, the obtained image was imported into the analysis software ImageJ (version 1.54g, National Institutes of Health, USA, http: / / imagej.net / ij) to automatically count the number of growing colonies ( Figure 5 ). The experimental results showed that the number of colonies on the experimental group plate was significantly more than that of the control group, indicating that the plasmid containing the target gene was successfully transformed into the competent cells. Further verification by PCR showed that the target gene insertion fragment was detected in all positive colonies, indicating that the foreign gene was successfully inserted into the target plasmid.
[0103] 3. Insertion of a 20-bp foreign gene by the two-fragment homologous recombination method
[0104] To obtain the insertion fragment containing the target gene, specific single-stranded DNA primers for the target gene, gRNA-F and gRNA-R, need to be designed. The design method is as described above. At the same time, two single-stranded DNA primers, Scaffold-R and U6b-F, need to be synthesized. The concentration of the synthesized single-stranded DNA primers needs to be diluted to 100 μM. To obtain the insertion fragment containing the target gene, the four single-stranded DNA primers need to be annealed to obtain a single-stranded DNA. The specific method is as follows: Take 1 μL of each of the four single-stranded DNA primers into a centrifuge tube, add DNA annealing buffer to make the final concentration 1×, and place it in a PCR instrument. The PCR program is 95 °C for 2 min; decrease by 1 °C every 90 s until it reaches 25 °C; 4 °C ∞. The obtained double-stranded DNA is the target fragment containing the foreign gene. After verification by 1% agarose gel electrophoresis, precipitation is carried out according to the above method to obtain the gene fragment containing the target gene. Take 0.06 pmol of the gene fragment and 0.03 pmol of the lentiCRISPR v2-puro-CcdB gene fragment (recovered after digestion with BsmBI) into a centrifuge tube, carry out homologous recombination according to the above method, ligate the ligation product and transform it into competent Escherichia coli Stbl3, and spread it on an agar plate containing ampicillin resistance, and culture overnight. At the same time, set up a control group, replace the lentiCRISPR v2-puro-CcdB gene fragment with the lentiCRISPR v2-puro gene fragment (recovered after digestion with BsmBI), carry out a ligation reaction using the same gene fragment, spread it on an agar plate containing ampicillin resistance, and culture overnight.
[0105] After culturing the transformed agar plates at 37 °C for 12 - 16 h, obvious colony distributions were formed. The plate images were analyzed and counted using Image J (version 1.54g, National Institutes of Health, USA, http: / / imagej.net / ij) software. As Figure 6 b and Figure 6 e show: Only 4 colonies were formed in the control group, indicating that the empty plasmid without the inserted target fragment was rarely successfully transformed; while 1,398 colonies were formed in the experimental group, and the number increased significantly. Compared with the control group, the sharp increase in the number of colonies in the experimental group indicates that the double-stranded small fragment gene was successfully inserted into the target plasmid through homologous recombination, thereby constructing a functional recombinant plasmid. Further verification by PCR amplification, randomly select colonies from the experimental group, and the insertion of the target fragment was detected in all of them, indicating that the foreign gene was efficiently inserted and the recombinant plasmid was successfully constructed.
[0106] 4. Insert a 20-bp foreign gene using T4 DNA ligase
[0107] To obtain the inserted fragment containing the target gene, specific single-stranded DNA primers gRNAt4-F and gRNAt4-R containing the target gene need to be designed. For example, if the inserted target gene is gRNA1, then gRNAt4-F and gRNAt4-R are gRNA1t4-F and gRNA1t4-R respectively. The concentration of the synthesized single-stranded DNA primers needs to be diluted to 100 μM. Anneal gRNA1t4-F and gRNA1t4-R according to the aforementioned method to synthesize double-stranded DNA. To improve the ligation efficiency of T4 DNA ligase, the synthesized double-stranded DNA enzyme needs to be phosphorylated at the 5'-end using T4 polynucleotide kinase. The phosphorylated double-stranded DNA fragment is precipitated and then dissolved in double-distilled water. Take 0.06 pmol of the gene fragment and 0.03 pmol of the lentiCRISPR v2-puro-CcdB gene fragment (recovered after digestion with BsmBI) into a centrifuge tube, add an equal volume of T4 DNA ligase, and place it in a 16 °C water bath for 1 h for ligation. Transform the ligation product into Escherichia coli Stbl3 competent cells, spread it on an agar plate containing ampicillin resistance, and culture it overnight. At the same time, set up a control group.
[0108] After the transformed agar plate was cultured at 37 °C for 12 - 16 h, colonies were formed. Analyze the image of the agar plate using Image J (version 1.54g, National Institutes of Health, USA, http: / / imagej.net / ij) software, as Figure 6 c and Figure 6 shown in f: There were only 3 colonies in the control group, indicating that the transformation efficiency of the plasmid without the target gene fragment was extremely low; 134 colonies were formed in the experimental group, and the number of colonies increased significantly. The significantly higher number of colonies in the experimental group than in the control group indicated that the target small fragment gene was successfully inserted into the plasmid by homologous recombination. Further analysis found that the colonies in the experimental group were evenly distributed and the number was stable. Multiple randomly selected colonies were verified by plasmid extraction and PCR, and the inserted fragment of the target gene was detected, confirming the successful construction of the recombinant plasmid.
[0109] 5. Detection of the positive rate of the target gene
[0110] For the plates constructed by the above different methods, randomly pick 20 monoclonal colonies from each plate into LB medium containing ampicillin resistance and culture them at 37 °C for 4 h. The monoclonal colonies are identified by colony PCR, and the primers used are EF1a-R and U6-F. The reaction program and system are the same as those described above. The size of the positive clone is 917 bp ( Figure 7) The results showed that the positive rates of colony PCR were as follows: the number of positive clones by the three - fragment homologous recombination method was 18, and the positive rate was 90%; the number of positive clones by the two - fragment homologous recombination method was 19, and the positive rate was 95%; the number of positive clones by the T4 DNA ligase method was 12, and the positive rate was 60%. In the negative control group, no positive clones were detected. Further, randomly selected colonies were sequenced for verification. 10 colonies with positive colony PCR on each plate were randomly selected for sequencing. The sequencing positive rates showed that for the three - fragment, two - fragment homologous recombination methods and the T4 ligase method, the positive rates of the colonies with positive colony PCR in sequencing were all 100%.
[0111] The primer sequences in this example are as follows:
[0112] lenti - lac - CcdB - F: 5’ - gtggaaaggacgaaacaccggagacgtttacactttatgcttccggctcg - 3’;
[0113] lenti - lac - CcdB - R: 5’ - gctatttctagctctaaaacagagacgttagataccccagaacatcaggttgat - 3’;
[0114] gRNA - F: 5’ - target gene + gttttagagctagaaatagc - 3’;
[0115] gRNA - R: 5’ - reverse complement of target gene + cggtgtttcgtcctttccaca - 3’;
[0116] gRNA: 5’ - gatgattacatgaaagaagt - 3’;
[0117] gRNA1 - F: 5’ - gatgattacatgaaagaagtcggtgtttcgtcctttccaca - 3’;
[0118] gRNA1 - R: 5’ - acttctttcatgtaatcatccggtgtttcgtcctttccaca - 3’;
[0119] EF1a - R: 5’ - aaaggcggagccagtacacg - 3’;
[0120] U6 - F: 5’ - atccagtttggttaattaaggtaccgagg - 3’;
[0121] Scaffold-R: 5'-gctatttctagctctaaaac-3';
[0122] U6b-F: 5'-tgtggaaaggacgaaacaccg-3';
[0123] gRNAt4-F: 5'-caccg + target gene - 3';
[0124] gRNAt4-R: 5'-reverse complement of target gene + caaa - 3';
[0125] gRNA1: 5'-gatgattacatgaaagaagt-3';
[0126] gRNA1t4-F: 5'-caccggatgattacatgaaagaagt-3';
[0127] gRNA1t4-R: 5'-acttctttcatgtaatcatccaaa-3'.
[0128] Example 3: Construction and Application of Zero-background Vector pLKO.1-puro-CcdB
[0129] 1. Construction of pLKO.1-puro-CcdB Plasmid
[0130] To construct the zero-background vector pLKO.1-puro-CcdB plasmid, first perform enzymatic digestion on the pLKO.1-puro plasmid (the target plasmid in this example). Treat the pLKO.1-puro plasmid with EcoRI in a 37°C water bath, then separate it by 1% agarose gel electrophoresis (110V, 30 min), and cut and recover the enzymatic digestion product. To introduce the lac-CcdB gene fragment, use the pUC19-lac-CcdB plasmid as a template, design primers pLKO.1-lac-CcdB-F and pLKO.1-lac-CcdB-R, and perform PCR amplification. After separating the amplification product by 1% agarose gel electrophoresis, cut and recover it to obtain a 397bp lac-CcdB gene fragment.
[0131] Place 0.06 pmol of the lac-CcdB gene fragment and 0.03 pmol of the pLKO.1-puro plasmid fragment in a centrifuge tube, add double-distilled water to make up the total volume to 5 μL, then add 5 μL of homologous recombination enzyme, and incubate at 50°C for 30 min to complete the ligation reaction. Subsequently, transform the ligation product into Escherichia coli DB3.1 competent cells, randomly select monoclonal strains, expand the culture, and extract the plasmid.
[0132] To verify the correctness of the recombinant plasmid, a double digestion experiment was carried out. 1 μg of the recombinant plasmid was taken, 1 μL of AgeI, 1 μL of EcoRI, and 2 μL of 10× digestion buffer were added, and double-distilled water was added to make up to 20 μL. The total reaction system was incubated at 55 °C for 1 h. The digestion products were analyzed by 1% agarose gel electrophoresis (110 V, 30 min). The results showed that the plasmid with the successfully inserted lac-CcdB gene should exhibit two bands, corresponding to the linearized plasmid (containing the lac-CcdB fragment) and the cleavage site of the original plasmid respectively. The electrophoresis results indicated that the band size was consistent with the expected 352 bp (see Figure 8 ), and the pLKO.1-puro-CcdB plasmid (the zero-background vector in this example) was successfully constructed.
[0133] 2. Insertion of a 48-bp foreign gene by three-fragment homologous recombination
[0134] The constructed pLKO.1-puro-CcdB plasmid was amplified in large quantities and the plasmid was extracted. After single digestion with EcoRI, the digestion products were separated by 1% agarose gel electrophoresis. The electrophoresis results were observed under ultraviolet light, and the target DNA band (7378 bp) was carefully cut out. The cut agarose gel was placed in a pre-cooled centrifuge tube, and a universal DNA purification and recovery kit (DP214, Tiangen Biotech Co., Ltd., Beijing, China, https: / / www.tiangen.com) for the purification of genomic DNA was used to recover the DNA according to the kit instructions. The recovered DNA was dissolved in an appropriate amount of double-distilled water and reserved. Subsequently, 1 / 10 volume of 3 M sodium acetate solution and 3 volumes of absolute ethanol were added to the recovered digestion products, and after standing at -20 °C for 20 min, centrifuged at 12,000 rpm for 5 min. After washing twice with 80% ethanol solution, the precipitate was dissolved with double-distilled water to obtain the pLKO.1-puro-CcdB digested plasmid, and at the same time, the original plasmid pLKO.1-puro-CcdB was set as a control group.
[0135] To insert the 48-bp foreign gene, primers gRNAp-F and gRNAp-R were designed. Using the pLKO.1-puro-CcdB plasmid as a template, PCR amplification was carried out using the primer pairs gRNAp-F / cPPT-R and U6p-F / gRNAp-R to obtain a PCR fragment containing the 48-bp target gene. Subsequently, 0.06 pmol of the amplification product and 0.03 pmol of the pLKO.1-puro-CcdB plasmid fragment recovered by BsmBI digestion were placed in a centrifuge tube, double-distilled water was added to 5 μL, 5 μL of homologous recombinase was added, and the ligation reaction was completed by incubating at 50 °C for 30 min. The ligation product was transformed into Escherichia coli Stbl3 competent cells and spread on an agar plate containing ampicillin, and cultured overnight at 37 °C.
[0136] After culturing at 37 °C for 12 - 16 h, obvious colony distributions appeared on the agar plates. The images were analyzed and counted using Image J (version 1.54g, National Institutes of Health, USA, http: / / imagej.net / ij) software ( Figure 9 ), as Figure 10 shown in Figure 10 a and
[0137] 3. Insertion of 48 bp foreign gene by two - fragment homologous recombination method
[0138] To further verify the applicability of the zero - background vector, the 48 bp foreign gene was inserted by the two - fragment homologous recombination method. Single - strand DNA primers gRNAp - F, gRNAp - R and auxiliary primers PKLO - R, U6a - F were designed, diluted to 100 μM, and annealed to form double - strand DNA according to the annealing method in Example 2. 0.06 pmol of the double - strand DNA fragment and 0.03 pmol of the pLKO.1 - puro - CcdB plasmid fragment (recovered after digestion with EcoRI) were placed in a centrifuge tube, added with double - distilled water to 5 μL, 5 μL of homologous recombinase was added, and the mixture was ligated at 50 °C for 30 min. The ligation product was transformed into Stbl3 competent cells, spread on an agar plate containing ampicillin, and cultured overnight at 37 °C.
[0139] After culturing at 37 °C for 12 - 16 h, the colony distributions on the agar plates were digitally imaged and imported into Image J (version 1.54g, National Institutes of Health, USA, http: / / imagej.net / ij) software for analysis and counting ( Figure 9 ). As Figure 10 shown in Figure 10 b and
[0140] 4. Insertion of 48 bp foreign gene using T4 DNA ligase
[0141] Insert the 48-bp exogenous gene gRNAp1 using T4 DNA ligase. The designed primers are gRNAp1-F and gRNAp1-R, which are annealed to form double-stranded DNA, and the 5'-end is phosphorylated with T4 polynucleotide kinase. Place 0.06 pmol of the double-stranded DNA fragment and 0.03 pmol of the pLKO.1-puro-CcdB plasmid fragment (recovered after digestion with EcoRI) in a centrifuge tube, add an equal volume of T4 DNA ligase, and ligate at 16 °C for 1 h. The ligation product is transformed into Stbl3 competent cells, spread on an agar plate containing ampicillin, and cultured overnight at 37 °C. After culturing at 37 °C for 12 - 16 h, obvious colony distributions appeared on the agar plate. After image acquisition and import into Image J (version 1.54g, National Institutes of Health, USA, http: / / imagej.net / ij) software for analysis and counting( Figure 9 ) as Figure 10 shown in Figure 10 c and
[0142] f: The number of colonies on the experimental group plate was 136, while there were only 5 colonies in the control group. The number of colonies in the experimental group was significantly higher than that in the control group, indicating that the T4 DNA ligase method has good results in inserting exogenous genes and successfully completed the insertion of the target gene.
[0143] To evaluate the positive rates of plasmids constructed by different methods, 20 monoclonal colonies were randomly selected for colony PCR identification using the primers cPPT-R and U6p-F, and the target gene band size was 806 bp. Further sequencing verification was performed on the samples positive for colony PCR, and the final positive rate was calculated based on the sequencing results. The results showed that the positive rates of colony PCR cultured by the homologous recombination method (three-fragment and two-fragment) were 60% and 70% respectively. Further sequencing verification showed that the sequencing positive rates of the samples positive for colony PCR were all 100%. In contrast, the positive rate of colony PCR cultured by the T4 DNA ligase method was 45%, and the sequencing verification showed that the sequencing positive rate of the samples positive for colony PCR was also 100%.
[0144] The primer sequences in this example are as follows:
[0145] pLKO.1-lac-CcdB-F: 5'-tcttgtggaaaggacgaaacaccggttttacactttatgcttccg-3';
[0146] pLKO.1-lac-CcdB-R: 5'-ccatttgtctcgaggtcgagaattcttagataccccagaacatcaggttgatcg-3';
[0147] gRNAp-R: 5'-Reverse complementary of target gene + gtttcgtcctttccacaaga-3';
[0148] gRNAp-F: 5'-Target gene + ctcgacctcgagacaaatgg-3';
[0149] gRNAp1: 5'-cccttctgacatctcctacatctcgagatgtaggagatgtcagaaggg-3';
[0150] gRNAp1-R: 5'-cccttctgacatctcctacatctcgagatgtaggagatgtcagaaggggtttcgtcctttccacaaga-3';
[0151] gRNAp1-F: 5'-cccttctgacatctcctacatctcgagatgtaggagatgtcagaaggggtttcgtcctttccacaaga-3';
[0152] cPPT-R: 5'-tgtaatttgtttttgtaattc-3';
[0153] U6p-F: 5'-ggccgcccccttcaccgagg-3';
[0154] PKLO-R: 5'-ccatttgtctcgaggtcgag-3';
[0155] U6a-F: 5'-tcttgtggaaaggacgaaac-3'.
[0156] Example 4: Construction and Application of Zero-background Vector pET28a-CcdB
[0157] 1. Construction of pET28a-CcdB Plasmid
[0158] To construct the zero-background vector pET28a-CcdB plasmid, first, perform enzymatic digestion on the pET28a plasmid (the target plasmid in this example). Digest the pET28a plasmid with EcoRI in a 37°C water bath. Subsequently, separate the digestion products by 1% agarose gel electrophoresis (110V, 30 min), and cut and recover the gel to obtain the linearized plasmid fragment. To introduce the lac-CcdB gene fragment, use the designed primers pET28a-lac-CcdB-F and pET28a-lac-CcdB-R to perform PCR amplification on the pET28a plasmid. The amplification products are separated by 1% agarose gel electrophoresis and recovered, and a 398bp lac-CcdB gene fragment is successfully obtained.
[0159] Place 0.06 pmol of the lac-CcdB fragment and 0.03 pmol of the pET28a plasmid fragment in a centrifuge tube, add double-distilled water to make up the total volume to 5 μL, and add 5 μL of homologous recombination enzyme. Incubate at 50°C for 30 min to complete the ligation reaction. Subsequently, transform the ligation products into Escherichia coli DB3.1 competent cells, randomly select monoclonal strains for large-scale culture, and extract the plasmid.
[0160] To verify the correctness of the recombinant plasmid, a double enzymatic digestion experiment was carried out. The reaction system and conditions were the same as described above. Use EcoRI and SacI for double enzymatic digestion, and analyze by 1% agarose gel electrophoresis (110V, 30 min). The results showed that the plasmid with the successfully inserted lac-CcdB gene should exhibit two bands, corresponding to the linearized plasmid and the original plasmid cleavage sites respectively. The electrophoresis results showed that the band sizes were consistent with the expected 363bp (see Figure 12 ), confirming the successful construction of the pET28a-CcdB plasmid (the zero-background vector in this example).
[0161] 2. Insertion of a 738bp foreign gene by the two-fragment homologous recombination method
[0162] Amplify and extract a large amount of the pET28a-CcdB plasmid. After digesting the plasmid with EcoRI and SacI, precipitate the DNA to obtain the pET28a-CcdB digested plasmid. At the same time, set the original plasmid pET28a as the control group. To obtain the Toxoplasma gondii GAP45 foreign gene fragment, design specific primers TgGAP45-F and TgGAP45-R, and use Toxoplasma gondii cDNA as a template to perform PCR amplification. The amplification products are separated by 1% agarose gel electrophoresis and then cut and recovered to obtain a 778bp Toxoplasma gondii GAP45 gene fragment.
[0163] Take 0.03 pmol of the digested pET28a-CcdB plasmid and 0.06 pmol of the Toxoplasma gondii GAP45 gene fragment and place them in a centrifuge tube. Add double-distilled water to make up to 5 μL, then add 5 μL of homologous recombination enzyme, and incubate at 50 °C for 30 min to complete the ligation reaction. Transform the ligation product into competent Escherichia coli DH5α cells, spread them on an agar plate containing kanamycin, and culture overnight at 37 °C.
[0164] The experimental results were analyzed and counted for the colony distribution images using Image J (version 1.54g, National Institutes of Health, USA, http: / / imagej.net / ij) software ( Figure 13 ), showing ( Figure 14 a and Figure 14 c) that the number of colonies in the experimental group was 1,538, while there were only 3 colonies in the control group. The huge difference in the number of colonies between the experimental group and the control group indicates that a 738-bp foreign gene was successfully inserted by this method, and a functional recombinant plasmid was constructed. Further, 20 colonies from the experimental group were randomly selected for colony PCR identification. The primers T7 and T7t were used to verify the insertion of the target gene. The size of the positive band was 1057 bp, and the colony PCR positive samples were sequenced to verify the positive rate. The results were as Figure 15 shown. The positive rate of colony PCR by the homologous recombination method was 80%, and the positive rate verified by sequencing was 100%.
[0165] 3. Insertion of a 738-bp foreign gene using T4 DNA ligase
[0166] To insert the foreign gene, the previously obtained Toxoplasma gondii GAP45 gene fragment was digested with two restriction enzymes. The restriction enzymes used were EcoRI and SacI. After digestion, the Toxoplasma gondii GAP45 gene fragment was precipitated. Take 0.03 pmol of the digested pET28a-CcdB plasmid and 0.06 pmol of the digested Toxoplasma gondii GAP45 gene fragment and place them in a centrifuge tube. Add double-distilled water to make up to 5 μL, then add 5 μL of T4 DNA ligase, and incubate at 16 °C for 60 min to complete the ligation reaction. Transform the ligation product into competent Escherichia coli DH5α cells, spread them on an agar plate containing kanamycin, and culture overnight at 37 °C.
[0167] The agar plate colony distribution images were analyzed and counted using Image J (version 1.54g, National Institutes of Health, USA, http: / / imagej.net / ij) software ( Figure 13 ), and the results showed that the number of colonies in the experimental group was 137, while there were only 6 colonies in the control group ( Figure 14 b and Figure 14d). The number of colonies in the experimental group was significantly higher than that in the control group. Further, 20 colonies from the experimental group were randomly selected for colony PCR identification. The size of the positive clone band was 1057 bp, the positive rate of colony PCR was 90%, and the positive samples of colony PCR were verified by sequencing, and the sequencing positive rate reached 100%.
[0168] In this example, the primer sequences are as follows:
[0169] pET28a-lac-CcdB-F: 5'-aaatgggtcgcggatccgaattctgatttacactttatgcttccggctcgta-3';
[0170] pET28a-lac-CcdB-R: 5'-cggccgcaagcttgtcgacggagctcttagataccccagaacatcaggttgatcgc-3';
[0171] TgGAP45-F: 5'-tgggtcgcggatccgaattcatgggaaacgcgtgcaag-3';
[0172] TgGAP45-R: 5'-caagcttgtcgacggagctctcagttcaacaagggtgcatcc-3';
[0173] T7: 5'-taatacgactcactataggg-3';
[0174] T7t: 5'-tgctagttattgctcagcgg-3'.
[0175] The present invention has made an innovative design on the basis of traditional gene cloning technology, significantly improving the efficiency of small fragment gene assembly and effectively solving the problem of high background noise in traditional methods:
[0176] First of all, the biggest innovation of this method lies in the optimization design of the CcdB gene and the construction of a zero-background vector, which completely solves the false positive problem caused by vector self-ligation. In traditional gene cloning, a large number of false positive clones are often generated due to vector self-ligation or non-specific fragment insertion, bringing a huge burden to subsequent screening. The present invention has achieved strict control of background noise by introducing the lethal gene CcdB and combining it with a promoter (such as the lac promoter). In addition, for the assembly operation of gene fragments, modern efficient technologies such as Golden Gate cloning and homologous recombination are adopted to further improve the assembly efficiency.
[0177] Secondly, the experimental results fully verified the efficiency and universality of this method. In the experiment, the expression effects of different promoters on Escherichia coli competent cells were compared. The results showed that the lac promoter performed best in the design of zero-background vectors. It could not only effectively express the CcdB gene but also minimize the background noise caused by non-specific expression. In addition, in the experiment of inserting foreign genes, both homologous recombination and T4 DNA ligase showed good insertion effects. Among them, the homologous recombination method showed higher efficiency in the assembly of short gene fragments, while the T4 DNA ligase method, although with fewer colonies, had a higher positive rate and was more suitable for application scenarios with higher precision requirements.
[0178] From the perspective of application, the present invention has important value in aspects such as the rapid construction of gene editing vectors, the efficient insertion of functional short gene fragments, and the precise expression of small fragments. For example, in the CRISPR system, this method can quickly construct gRNA vectors, thus accelerating the process of gene editing experiments. In addition, the efficiency and precision of the zero-background vector enable it to have broad application prospects in fields such as industrial production, vaccine research and development, and protein engineering.
[0179] In summary, by constructing a zero-background vector and optimizing the gene cloning process, the present invention improves the assembly efficiency of short gene fragments while significantly reducing the false positive rate. It is of great significance in gene editing and molecular cloning and provides a reliable and efficient technical tool for related research.
[0180] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention and are not intended to limit the implementation manners of the present invention. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation manners here. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A zero background carrier, characterized in that: The zero-background vector comprises an optimized Escherichia coli CcdB gene and a corresponding Escherichia coli promoter. The nucleotide sequence of the optimized Escherichia coli CcdB gene is shown in SEQ ID NO.
1.
2. The zero background carrier as claimed in claim 1, characterized in that The E. coli promoter includes any one of a lac promoter, a CAT promoter, a Tac promoter, a Trp promoter, a Tet promoter, a T5 promoter, a Ptac promoter, a Pl promoter, a LacUV5 promoter, and an araBAD promoter.
3. A method for preparing a zero-background carrier as claimed in claim 1 or 2, characterized in that: The following steps are involved: S10. Optimization and synthesis of the Escherichia coli CcdB gene: codon optimization of the Escherichia coli CcdB gene was performed to remove common restriction sites to obtain an optimized Escherichia coli CcdB gene, and the optimized Escherichia coli CcdB gene was subjected to full gene synthesis to obtain a gene fragment; S20. Addition of the promoter of the Escherichia coli CcdB gene: amplifying the gene fragment by PCR to obtain the CcdB gene with the promoter of Escherichia coli; S30. Insert the CcdB gene with the Escherichia coli promoter into the target plasmid: design PCR primers according to the target plasmid, and the 5' and 3' ends of the PCR product both have 20bp homology arms, and perform PCR amplification. The PCR amplification system and procedure are the same as step S20, except that the primers are replaced with primers designed according to the target plasmid, and the template is replaced with the target plasmid; extract the target plasmid and cut it with enzymes to obtain a linearized target plasmid; perform homologous recombination on the linearized target plasmid and the PCR product with the homology arms, and transform the connected target plasmid into the first Escherichia coli competent cell. After successful PCR identification and sequencing identification, the target plasmid containing the Escherichia coli CcdB gene and its promoter, i.e., the zero background vector, is obtained.
4. The method for preparing a zero background carrier according to claim 3, characterized in that: In step S20, the PCR system is: 12.5 μL of 2×Phanta Max MaterMix polymerase, 1 μL of CcdB-1F, 1 μL of CcdB-R, and 1 μL of the gene fragment, and finally supplemented to 25 μL with ddH2O; the PCR amplification program is: 1 cycle of pre-denaturation at 95°C for 3 minutes, then denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds and extension at 72°C for 30 seconds, for a total of 35 cycles; finally, extension at 72°C for 5 minutes is performed; the PCR product is taken as the second round of PCR template, and PCR is performed using CcdB-2F and CcdB-R according to the above system and program; the sequences of CcdB-1F, CcdB-2F and CcdB-R are shown in SEQ ID NO.2 to SEQ ID NO.
4.
5. The method for preparing a zero-background carrier according to claim 3, characterized in that: In step S30, the first competent E. coli comprises any one of competent cells of DB3.1 and ccdB Survival.
6. The method for preparing a zero-background carrier according to claim 3, characterized in that: In step S30, the target plasmid is digested by 2 μL of digestion buffer, 1 μg of target plasmid, 1 μg of restriction endonuclease, and double distilled water to 20 μL, and digested at 37° C. for 4 hours.
7. Use of the zero-background vector as claimed in claim 1 in the high-efficiency assembly of small-fragment genes.
8. A method for high-efficiency assembly of small gene fragments, using the zero-background vector as claimed in claim 1, characterized in that: The following steps are involved: T10. treating the zero background vector with restriction endonuclease to obtain a linearized zero background vector; T20. Divide the small gene fragment into a plurality of small gene fragment segments, each of which is no longer than 59 bp and comprises a 20 bp homology arm at the 5' end and a 20 bp homology arm at the 3' end; synthesize the small gene fragment segments into double-stranded small gene fragments; wherein the length of the small gene fragments is between 0 and 50 bp; T30. Connect the double-stranded small fragment gene to the linearized zero-background vector and transform it into the second competent E. coli to obtain the target plasmid carrying the small fragment gene.
9. The method for high-efficiency assembly of small gene fragments according to claim 8, characterized in that: In step T20, the small gene fragment segments are synthesized into double-stranded small gene fragments as follows: The small gene fragment segments were synthesized into single-stranded DNA, and the synthesized single-stranded DNA was diluted to 100 μM with double distilled water. 1 μL of each fragment was taken into a centrifuge tube, heated to 95° C. and slowly annealed to room temperature to obtain the double-stranded small gene fragment.
10. The method for high-efficiency assembly of small gene fragments according to claim 8, characterized in that: In step T30, the second competent E. coli comprises any one competent cell of DH5α, TOP10, Stbl2, Stbl3, JM109, and XL10-Gold.