SNP (Single Nucleotide Polymorphism) molecular marker associated with sea-island cotton fiber strength and application

Through genome-wide correlation analysis, SNP marker sequences related to the strength of island cotton fibers were found, which solved the problem of difficulty in improving the strength of island cotton fibers, achieved a significant improvement in the strength of island cotton fibers, and provided an effective method for fiber strength screening and breeding.

CN120174140AActive Publication Date: 2025-06-20ZHEJIANG UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510507450.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-22
Publication Date
2025-06-20
Estimated Expiration
2045-04-22

AI Technical Summary

Technical Problem

The existing technology is difficult to effectively explore and utilize genes related to the strength of island cotton fibers, which makes it difficult to improve the strength of island cotton fibers. The genetic basis of Xinjiang island cotton is relatively narrow, making it more difficult to screen genes.

Method used

Through genome-wide association analysis (GWAS), SNP marker sequences related to island cotton fiber strength were found, specifically located at the sites Gbar_D09_44519309 and Gbar_D09_44520064 of the gene Gbar_D09G018120, providing relevant SNP marker sequences and primer pairs, and early prediction and screening of fiber strength was performed by PCR amplification method.

Benefits of technology

By utilizing this SNP marker sequence, the strength of island cotton fibers can be significantly improved. The individual fiber strength of genotype AT is preferably significantly higher than that of GC genotype individuals, providing an effective tool for island cotton fiber strength polymer breeding and parental screening.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120174140A_ABST
    Figure CN120174140A_ABST
Patent Text Reader

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker associated with sea-island cotton fiber strength and application, and belongs to the technical field of molecular markers. According to the invention, the SNP molecular marker related to the fiber strength is obtained, and the fiber strength character is mainly similar to that of GbarD0944519309 (Ggt; a) and GbarD0944520064 (Cgt; the gene GbarD09G018120 is related to the change of a basic group (T, T), and the gene GbarD09G018120 is used as the SNP molecular marker obviously related to the fiber strength. The invention finds that the fiber strength of a material carrying AT basic groups is obviously higher than that of a material carrying GC basic groups, so that the SNP molecular marker can be used for pyramiding breeding, parent screening and the like of sea-island cotton fiber strength traits, and the SNP molecular marker can be used for identifying the strength traits of the sea-island cotton fibers in various stages of cotton development through a specific primer PCR (Polymerase Chain Reaction) amplification method. And on the basis of whether the SNP base mutation is contained or not, the excellent parents are rapidly screened in batches.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and particularly relates to an SNP molecular marker associated with the fiber strength of sea-island cotton and its application. Background Art

[0002] Cotton is one of the most important economic crops in the world, providing 81% of the global natural fibers and being the main raw material for the textile industry. Currently, upland cotton and sea-island cotton are the two most important allopolyploid cultivated cotton species, and more than 97% of the fiber production comes from these two cotton species. Compared with upland cotton, sea-island cotton has longer, finer, and stronger fibers, but lower yield. Cultivating high-quality and high-yield sea-island cotton varieties is necessary for the current textile industry. Therefore, it is of great significance to explore genes related to fiber quality in sea-island cotton.

[0003] Compared with upland cotton, sea-island cotton has better fiber quality and lower yield. There is less research on genes related to fiber quality and yield in sea-island cotton, and true effective selection sites or genes still need further functional verification. In addition, due to fewer backbone parents and a relatively narrow genetic basis in Xinjiang sea-island cotton, it is more difficult to screen genes related to cotton fiber strength. Summary of the Invention

[0004] The present invention provides an SNP molecular marker associated with the fiber strength of sea-island cotton and its application, laying a foundation for molecular marker-assisted selection and precise breeding to improve fiber strength, and promoting the production of Xinjiang sea-island cotton.

[0005] The present invention provides an SNP marker sequence related to the fiber strength of sea-island cotton. The SNP marker sequence is located in the gene Gbar_D09G018120, and there are polymorphisms G or A at the site Gbar_D09_44519309 of the gene Gbar_D09G018120, and polymorphisms C or T at the site Gbar_D09_44520064.

[0006] In a preferred embodiment of the present invention, the dominant genotype of the gene Gbar_D09G018120 is AT.

[0007] The present invention also provides a primer pair for detecting the above SNP marker sequence, including a first primer pair composed of an upstream primer with a nucleotide sequence as shown in SEQ ID No.1 and a downstream primer as shown in SEQ ID No.2; and also including a second primer pair composed of an upstream primer with a nucleotide sequence as shown in SEQ ID No.3 and a downstream primer as shown in SEQ ID No.4.

[0008] The present invention also provides a biological detection product containing the above SNP marker sequence or the above primer pair.

[0009] In a preferred embodiment of the present invention, it includes a detection kit or a gene chip.

[0010] The present invention also provides the use of the above SNP marker sequence, the above primer pair or the above biological detection product in the early prediction and / or screening of the fiber strength of sea-island cotton.

[0011] The present invention also provides the use of the above SNP marker sequence, the above primer pair or the above biological detection product in molecular marker-assisted breeding of cotton.

[0012] The present invention also provides a method for predicting the fiber strength of sea-island cotton, comprising the following steps: using the genomic DNA of a sample to be tested as a template, mixing it with the primer pair designed according to the above SNP marker sequence, the above primer pair or the above biological detection product to form an amplification system, performing PCR amplification, and predicting the fiber strength of the sample to be tested according to the genotype of the PCR amplification product.

[0013] In a preferred embodiment of the present invention, the procedure of the PCR amplification includes: pre-denaturation at 94 °C for 5 min; denaturation at 98 °C for 10 s, annealing at (Tm - 5) °C for 5 s, extension at 68 °C for 1 - 10 s / kb, for 25 - 45 cycles.

[0014] In a preferred embodiment of the present invention, the fiber strength of individuals with the AT genotype of the SNP molecular marker is significantly higher than that of individuals with the GC genotype.

[0015] Beneficial effects: The present invention uses 240 Gossypium barbadense varieties from all over the world as materials. Through a scheme of 1 experimental site over 4 years with 2 replicates for each material, a method of genome resequencing using the Illumina HiSeqPE150 sequencing platform is adopted for variant detection, and a total of 3,110,663 high-quality SNPs are obtained for genome-wide association analysis (GWAS). Through GWAS analysis, SNP molecular markers related to fiber strength that appear repeatedly in at least 2 environments are obtained. The present invention discovers that the fiber strength trait is mainly related to the changes in the bases of Gbar_D09_44519309 (G>A) and Gbar_D09_44520064 (C>T), and the gene Gbar_D09G018120 where Gbar_D09_44519309 and Gbar_D09_44520064 with different haplotypes are located is used as the SNP marker sequence significantly related to fiber strength. The present invention also verifies 240 Gossypium barbadense materials in 2018, 2022, and 2023. The fiber strength of the materials carrying AT bases in the BLUE value is significantly higher than that of the materials with GC bases. Therefore, the SNP marker sequence described in the present invention can be used for pyramiding breeding and parental screening of Gossypium barbadense fiber strength traits, etc. At each stage of cotton development, through the method of PCR amplification using specific primers, excellent parents can be quickly and batch-screened based on whether the SNP base mutation is present. Description of the Drawings

[0016] Figure 1 It is a distribution density map of SNPs of 240 Gossypium barbadense;

[0017] Figure 2 It is a Manhattan plot and qq plot of FS-GWAS in 2017 based on SNPs;

[0018] Figure 3 It is a Manhattan plot and qq plot of FS-GWAS in 2018 based on SNPs;

[0019] Figure 4 It is a Manhattan plot and qq plot of FS-GWAS in 2022 based on SNPs;

[0020] Figure 5 It is a Manhattan plot and qq plot of FS-GWAS in 2023 based on SNPs;

[0021] Figure 6 It is a Manhattan plot and qq plot of FS-GWAS based on the BLUE (breeding value) of SNPs;

[0022] Figure 7Local Manhattan plot and linkage map for SNP loci Gbar_D09_44519309 and Gbar_D09_44520064;

[0023] Figure 8 Gene structure diagram of Gbar_D09G018120;

[0024] Figure 9 Protein structure prediction map of Gbar_D09G018120;

[0025] Figure 10 Expression level map of Gbar_D09G018120 in different tissues of cotton;

[0026] Figure 11 Graph of relative expression level changes of Gbar_D09G018120 gene in H232 and H51 materials;

[0027] Figure 12 Phenotype statistical chart of fiber strength of 240 Gossypium barbadense materials in each year;

[0028] Figure 13 Statistical chart of average FS of Gossypium barbadense materials with AT and GC haplotypes. Detailed implementation

[0029] The present invention provides an SNP marker sequence related to the fiber strength of Gossypium barbadense. The SNP marker sequence is located in the gene Gbar_D09G018120, and there is polymorphism G or A at the locus Gbar_D09_44519309 of the gene Gbar_D09G018120, and polymorphism C or T at the locus Gbar_D09_44520064.

[0030] The present invention uses 240 Gossypium barbadense varieties from all over the world as materials. Through a plan of 4 years at 1 test site and 2 replicates for each material, the materials are planted in Sanya, Hainan. The method of genome resequencing using the Illumina HiSeqPE150 sequencing platform is used for variant detection, and a total of 3,110,663 high-quality SNPs are obtained for genome-wide association analysis (GWAS). Through GWAS analysis, SNP molecular markers related to fiber strength that appear repeatedly in at least 2 environments are obtained.

[0031] Table 1 Gossypium barbadense varieties used in the present invention for screening SNP molecular markers

[0032]

[0033]

[0034]

[0035]

[0036]

[0037] In the present invention, the fiber strength trait of Gossypium barbadense is mainly related to the base changes of Gbar_D09_44519309 (G>A) and Gbar_D09_44520064 (C>T), and SNP marker sequences significantly related to fiber strength are obtained. The two SNP loci of the present invention are respectively at the 44519309th and 44520064th bases of the 9th chromosome of the D sub-genome of Gossypium barbadense, located on the exon of the gene Gbar_D09G018120, and the dominant genotype of the gene Gbar_D09G018120 is AT.

[0038] The present invention also provides a primer pair for detecting the above SNP marker sequences, including a first primer pair composed of an upstream primer with a nucleotide sequence as shown in SEQ ID No.1 and a downstream primer as shown in SEQ ID No.2; and also includes a second primer pair composed of an upstream primer with a nucleotide sequence as shown in SEQ ID No.3 and a downstream primer as shown in SEQ ID No.4.

[0039] The sequences of the first primer pair (Gbar_D09_44519309 amplification primer) of the present invention and the amplification products are as follows:

[0040] Gbar_D09_44519309_F (SEQ ID No.1): GTGACTACTTCATAACAAAACG;

[0041] Gbar_D09_44519309_R (SEQ ID No.2): GGAGAATATCAGTGTGCCTA;

[0042] Gbar_D09_44519309 amplification product (SEQ ID No.5), and the degenerate base R in this sequence represents A / G:

[0043] GTGACTACTTCATAACAAAACGATAATATAAGTGATTAAAACGTAATATTTTAAACATAAGTGACTAAAATATAATTTRAGATAAATAAAAGTAATTATTTTTATAATTTAGCCTAAAATATTATGCAGACTACATCAACTCAACAGCTGCTTGTATATATCATGATAAACACGCATCAAATTCAAAATTTTACGGTATATGGGAAAAGAAATCCCAGCTGAATGAATTACATATTTTTGAGGACCAAAACCAAAATTATATCAAAATTTTACCTCAACCCCATTAGATTTCTGCATAGCAGGCTGCGTGAACAAACTCCGAGAACTCCTTAGGCACACTGATATTCTCC;

[0044] The sequences of the second primer pair (amplification primers for Gbar_D09_44520064) and the amplification products in the present invention are as follows:

[0045] Gbar_D09_44520064_F (SEQ ID No.3): TCCATTGTTCCGACTTG;

[0046] Gbar_D09_44520064_R (SEQ ID No.4): CGGTTACTGATGTGTTCAT;

[0047] The amplification product of Gbar_D09_44520064 (SEQ ID No.6), and the degenerate base Y in this sequence represents C / T:

[0048] TCCATTGTTCCGACTTGAACCCGTACACGTCAGCGCTCCCATCAAATTGACCTTGGCTCTCCGTTCTGTATCCACTCACCACCCAGAACTCCTCTTCCCCAATCACTACACCTTCACATTCGTCTCGCTCTTGACTCAACTCCCCCAACTCAGCCCACTCGTCCGTTCTCAGATCGTAAACCCAAGCGGTTCTTGACGCATTCTTGTTCTCGTCATGCCCGCCCGCAACAAAAACCCGACCTCCACATGCCCCGATTGCAAAGAAGGATCTTYTTGAAGGCATATCCTTCCCTTGTCTCCATTGCTGAGTCACGAAATCGTAGATGAACACATCAGTAACCG。

[0049] The present invention also provides a biological detection product comprising the above SNP marker sequence or the above primer pair.

[0050] Based on the SNP marker sequence or the above primer pair, the present invention can design primers, reagents, kits, and even gene chips containing the SNP molecular marker for use in biological detection of corresponding traits for detecting the fiber strength of Gossypium barbadense.

[0051] The present invention also provides the application of the above SNP marker sequence, the above primer pair, or the above biological detection product in the early prediction and / or screening of the fiber strength of Gossypium barbadense.

[0052] The SNP marker sequence of the present invention can be detected at various stages of cotton development. For example, in the examples, it is amplified by the method of PCR amplification using the above specific primers, and excellent individual plants are rapidly and batch-screened based on whether there are two base mutations in the SNP marker sequence, such as for screening parents with trait aggregation, and for screening individuals with corresponding high-strength fiber traits for subsequent experiments or research.

[0053] The present invention also provides the application of the above SNP marker sequence, the above primer pair, or the above biological detection product in molecular marker-assisted breeding of cotton.

[0054] The present invention does not particularly limit the method of the molecular marker-assisted breeding. Using the SNP marker sequence of the present invention, molecular marker-assisted breeding can be carried out based on conventional operations.

[0055] The present invention also provides a method for predicting the fiber strength of sea-island cotton fibers, comprising the following steps: using the genomic DNA of a sample to be tested as a template, mixing it with a primer pair designed according to the above SNP marker sequence, the above primer pair or the above biological detection product to form an amplification system, performing PCR amplification, and predicting the fiber strength of the sample to be tested according to the genotype of the PCR amplification product.

[0056] The present invention does not particularly limit the method for extracting genomic DNA of the sample to be tested, including using conventional methods in the art to extract genomic DNA from sample tissues. For example, using leaves as tissues and extracting genomic DNA by the CTAB method.

[0057] The present invention uses the above primer pair and genomic DNA to configure a PCR amplification system. Calculated by 50 μL, it includes: Flash KOD DyeMix 25 μL, 1.5 μL of 10 μM upstream primer, 1.5 μL of 10 μM downstream primer, DNA template ≥ 5 μL, and the balance of ddH2O. After the PCR amplification system is prepared, the present invention performs PCR amplification. The procedure of the PCR amplification includes: pre-denaturation at 94 °C for 5 min; denaturation at 98 °C for 10 s, annealing at (Tm - 5) °C for 5 s, extension at 68 °C for 1 - 10 s / kb, for 25 - 45 cycles.

[0058] In a preferred embodiment of the present invention, it is determined whether it belongs to the dominant genotype according to whether the site of the amplification product contains the sequence of AT. The fiber strength of individuals with the AT genotype of the SNP molecular marker is significantly higher than that of individuals with the GC genotype.

[0059] To further illustrate the present invention, the following examples are used to describe in detail a SNP molecular marker and its application related to the fiber strength of sea-island cotton provided by the present invention, but they should not be construed as limiting the protection scope of the present invention.

[0060] Example 1 Population Materials and Phenotypic Statistics

[0061] 1. Selection of Population Materials and Field Experiment Design

[0062] The present invention mainly collected a total of 240 sea-island cotton materials (Table 1) from Xinjiang, China and other countries and regions for the investigation of fiber strength, including 220 main cultivated varieties independently cultivated in Xinjiang since the end of the 20th century, 3 perennial semi-wild sea-island cotton germplasms, and 17 varieties from abroad, covering representative varieties in Central Asia, the United States, and Egypt.

[0063] This group was planted in Yazhou District, Sanya, Hainan (HN, 18.23°N, 109.50°E) in 2017, 2018, 2022, and 2023 according to a completely randomized block design with two replicates. Field daily management was carried out by local conventional methods. Among them, various germplasm resources and field management methods have been published in the article, see: Yu J., Hui Y., Chen J., Yu H., Gao X., Zhang Z., Li Q., Zhu S. & Zhao T. (2021) Whole-genome resequencing of 240 gossypium barbadense accessions reveals genetic variation and genes associated with fiber strength and lint percentage. Theoretical and Applied Genetics 134(10): 3249-3261. https: / / doi.org / 10.1007 / s00122-021-03889-w.

[0064] 2. Identification of fiber strength traits and statistical analysis of phenotypic data

[0065] During the boll-opening period in March, 50 cotton bolls located in the middle of the plant and with normal and complete boll-opening were randomly picked from each row. After air-drying, they were ginned with a leather roller gin, and 20 g of fibers were randomly selected and sent to the Cotton Quality Supervision and Inspection Testing Center of the Ministry of Agriculture and Rural Affairs. The fiber strength traits were detected according to the standard of GB / T 20392-2006 "HVI Cotton Fiber Physical Test Method".

[0066] The best linear unbiased estimate (BLUE) of the fiber strength for each year was estimated using the lme4 package in R language. The model is:

[0067] FS = lmer(FS ~ Sample + (1|Rep) + (1|Year:Rep) + (1|Year)); Equation I;

[0068] In Equation I, the fixed factor is Sample, and the random factors are Year + Rep + Year:Rep.

[0069] Example 2 Obtaining SNPs

[0070] 1. Library construction and sequencing

[0071] Collect the young leaf tissues of each material in the population, extract the genomic DNA of the samples by the CTAB method, and use agarose gel electrophoresis and ultraviolet absorption method to determine the purity and integrity of the DNA. The qualified DNA samples are sequenced by Novogene Co., Ltd. in Beijing. With the help of a Covaris crusher, the samples are randomly fragmented to form fragments with a length of about 350 bp. Subsequently, a series of operations such as end repair, addition of polyA tails, ligation of sequencing adapters, purification, and real-time PCR amplification are carried out in sequence to complete the preparation of the entire library. The constructed library is sequenced using the Illumina HiSeqPE150 sequencing platform, and the average sequencing depth of the sequencing results reaches 10.85×, generating a total of 6.3 Tb of raw data.

[0072] 2. Genotyping and filtering

[0073] Using the high-quality Gossypium barbadense genome (Gossypium barbadense(AD2)'3-79'genome HAU_v2_a1, https: / / www.cottongen.org / species / Gossypium_barbadense / HAU-AD2_genome_v2.0) as the reference genome for variant detection.

[0074] First, use fastp to filter the fastq files with the parameters "-c -n 15 -u 50 -q 15". Use the bwa software to build an index for the reference genome, align the filtered fastq files to the reference genome to obtain the sam format file, and use the samtools and sambamba software to convert the sam file to the bam format, sort and remove duplicate fragments. Use the gatk software to identify SNP and Indel variants, and filter the SNP variants with the criteria of "QUAL<60, QD<20.0, FS>10.0, MQ<30.0, MQRankSum<-1.65, and ReadPosRankSum<-8.0". Finally, use vcftools to filter out SNP sites with a minor allele frequency less than 0.05 and a missing rate greater than 20%, and retain 3,110,663 high-quality SNPs ( Figure 1 ), for subsequent genome-wide association analysis.

[0075] Example 3 Genome-wide association analysis of fiber strength traits in Gossypium barbadense

[0076] For the phenotypic data of sea island cotton fiber strength obtained in Example 1, using the SNP variation information obtained in Example 2, a univariate linear mixed model (Univariate Linear Mixed Model) of GEMMA (Genome-wide Efficient Mixed Model Association algorithm) was used for association analysis.

[0077] y = Wα + xβ + u + e; u ∼ MVN n (0, λτ -1 K), e ∼ MVN n (0, τ -1 I n ); Equation II;

[0078] In Equation II, y represents the phenotypic data, W is the covariate matrix, such as the PCA matrix, α is the coefficient vector corresponding to the covariates (including the intercept term), x is the marker genotype vector, and β represents the genotype typing information of each material at each SNP locus. u is the random effect vector, which follows a multivariate normal distribution with a mean of 0 and a covariance matrix of λτ -1 K, and K is the kinship matrix (used to consider the genetic correlation and population structure between individuals and avoid false positive associations caused by factors such as population stratification) to correct the population analysis. λ is the variance component ratio, and τ -1 is the residual variance. e is the error vector, which follows a multivariate normal distribution with a mean of 0 and a covariance matrix of τ -1 I n and represents the influence of other factors on the phenotype except for genotype, covariates, and random effects.

[0079] The CMplot software package in R language was used to draw the Manhattan plot and qq plot (quantile - qualtile plot) to represent the P - value situation and association effect of each SNP ( Figures 2 - 6 ).

[0080] Taking - log(P)>4 in at least two environments as the threshold, it was found through analysis that two SNPs ( Figure 7 ) tightly linked in the same LD region on chromosome Gbar_D09: Gbar_D09_44519309 (G>A), Gbar_D09_44520064 (C>T) were significantly correlated with the sea island cotton fiber strength, and the P - values of each SNP in each year are shown in Table 2.

[0081] Table 2 GWAS values of SNP loci in each year

[0082] -log10(Pvalue) 2017 2018 2022 2023 BLUE Gbar_D09_44519309 0.11 3.72 4.37 0.87 5.09 Gbar_D09_44520064 0.12 1.5 2.55 0.19 3.39

[0083] The two SNPs of the present invention are located at positions 44519309 and 44520064 on chromosome 9 of the D subgenome of Gossypium barbadense, and are located on the exon of the gene Gbar_D09G018120( Figure 8 ), among which Gbar_D09_44520064 has a non-synonymous mutation, changing from G to A, resulting in the amino acid changing from arginine (ARG, R) to lysine (LYS, K)( Figure 9 ). The protein structure was predicted online using the I-TASSER website (https: / / zhanggroup.org / I-TASSER / ), and the results showed that the non-synonymous mutation led to a change in the protein structure of Gbar_D09G018120( Figure 9 ). Gbar_D09_44519309 is a synonymous mutation, changing from C to T. The homologous gene of this gene in Arabidopsis thaliana is AT2G44130 (KMD3), which encodes a member of the F-box protein family and controls phenylpropanoid biosynthesis. After querying, it is recorded in http: / / cotton.zju.edu.cn that the expression level of Gbar_D09G018120 reaches a peak at the 20th day of fiber development( Figure 10 ).

[0084] Moreover, the fiber strength of the materials carrying AT bases in the 240 Gossypium barbadense materials in 2018, 2022, 2023 and the BLUE value was significantly higher than that of the materials with GC bases( Figure 12 ).

[0085] Example 4 Verification of SNP loci Gbar_D09_44519309 and Gbar_D09_44520064

[0086] 1. Identify the expression levels of the gene Gbar_D09G018120 where Gbar_D09_44519309 and Gbar_D09_44520064 with different haplotypes are located. Select two Gossypium barbadense materials: H237 (REF-GC, low fiber strength) and H51 (ALT-AT, high fiber strength), hang tags one day before flowering, collect fiber samples at 15 days, 20 days and 25 days after flowering, with 3 replicates at each time point, and perform fluorescence quantitative analysis.

[0087] Extract the RNA of cotton fibers using the plant tissue RNA extraction kit (DP452) from TIANGEN Company, and measure the RNA concentration using an ultraviolet spectrophotometer. If the sample 260 / 280 is between 1.9 and 2.1 and 260 / 230 is greater than 2, it indicates that the quality of the RNA meets the requirements for the next analysis.

[0088] The cDNA was synthesized using the FastKing cDNA First Strand Synthesis Kit (Genome-removed) (KR116-02) from TIANGEN Biotech (Beijing) Co., Ltd., and then the HieffqPCR SYBR Green Master Mix (No Rox) (11201ES08) qPCR enzyme from YEASEN Biotech Co., Ltd. was added. The qPCR reaction was carried out using a fluorescence quantitative PCR instrument. The quantitative analysis primers used in this invention are shown below:

[0089] F (SEQ ID No.7): GAACAAGAATGCGTCAAGAACC;

[0090] R (SEQ ID No.8): TTGAACCCGTACACGTCAGC;

[0091] Primers for the internal reference gene GbUBQ7:

[0092] GbUBQ7_F (SEQ ID No.9): GAAGGCATTCCACCTGACCAAC;

[0093] GbUBQ7_R (SEQ ID No.10): CAAGCACAAGAAGAAGAAGGTCAAG.

[0094] The qPCR results are as Figure 11 shown. The relative expression level of the gene in the fibers of the material H232 with low fiber strength at 25 days after flowering was significantly higher than that in the material H51 with higher fiber strength. It indicates that the SNP marker sequences Gbar_D09_44519309 and Gbar_D09_44520064 are closely related to the expression level of the gene Gbar_D09G018120 during the thickening stage of fiber development, and Gbar_D09G018120 may be an important candidate gene involved in regulating cotton fiber strength.

[0095] 2. Using the SNP variant data from the published article (Zhao N., Wang W., Grover C. E., Jiang K., Pan Z., Guo B., Zhu J., Su Y., Wang M., Nie H., Xiao L., Guo A., Yang J., Cheng C., Ning X., Li B., Xu H., Adjibolosoo D., Aierxi A., Li P., Geng J., Wendel J. F., Kong J. & Hua J. (2022) Genomic and GWAS analyses demonstrate phylogenomic relationships of gossypium barbadense in china and selection for fibre length, lint percentage and fusarium wilt resistance. Plant Biotechnology Journal 20(4): 691 - 710. https: / / doi.org / 10.1111 / pbi.13747) and the fibre strength phenotypic data of 282 Gossypium barbadense samples, including 199 samples with Gbar_D09_44519309(G) and Gbar_D09_44520064(C), and 83 samples with Gbar_D09_44519309(A) and Gbar_D09_44520064(T) (Table 3), we conducted haplotype - phenotype analysis.

[0096] Table 3 Haplotypes and fibre strength phenotypes of 282 samples

[0097]

[0098]

[0099]

[0100]

[0101] The phenotypic results are as Figure 13As shown, the average fiber strength of the variety containing Gbar_D09_44519309(G) and Gbar_D09_44520064(C) is 37.82 cN / tex, and the average fiber strength of the variety containing Gbar_D09_44519309(A) and Gbar_D09_44520064(T) is 42.89 cN / tex. The fiber strength of ALT-AATT is significantly higher than that of REF-GGCC (p = 1.8×10 -22 ).

[0102] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SNP marker sequence associated with fiber strength of Sea Island cotton, characterized in that: The SNP marker sequence is located in the gene Gbar_D09G018120, and there is a polymorphism G or A at the site Gbar_D09_44519309 of the gene Gbar_D09G018120, and there is a polymorphism C or T at the site Gbar_D09_44520064.

2. The SNP marker sequence according to claim 1, characterized in that: The dominant genotype of the gene Gbar_D09G018120 is AT.

3. A primer pair for detecting the SNP marker sequence according to claim 1 or 2, characterized in that: It includes a first primer pair consisting of an upstream primer with a nucleotide sequence as shown in SEQ ID No.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID No.2; and a second primer pair consisting of an upstream primer with a nucleotide sequence as shown in SEQ ID No.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID No.

4.

4. A biological detection product comprising the SNP marker sequence of claim 1 or 2 or the primer pair of claim 3.

5. The biological detection product according to claim 4, characterized in that: Including detection kits or gene chips.

6. Use of the SNP marker sequence according to claim 1 or 2, the primer pair according to claim 3, or the biological detection product according to claim 4 or 5 in the early prediction and / or screening of fiber strength of Sea Island Cotton.

7. Use of the SNP marker sequence according to claim 1 or 2, the primer pair according to claim 3, or the biological detection product according to claim 4 or 5 in cotton molecular marker-assisted breeding.

8. A method for predicting fiber strength of sea island cotton, characterized in that: The method comprises the following steps: using the genomic DNA of the sample to be tested as a template, mixing it with a primer pair designed according to the SNP marker sequence of claim 1 or 2, a primer pair according to claim 3, or a biological detection product according to claim 4 or 5 to form an amplification system, performing PCR amplification, and predicting the fiber strength of the sample to be tested based on the genotype of the PCR amplification product.

9. The prediction method according to claim 8, characterized in that: The PCR amplification procedure includes: pre-denaturation at 94° C. for 5 min; denaturation at 98° C. for 10 s, annealing at (Tm-5)° C. for 5 s, and extension at 68° C. for 1-10 s / kb, for 25-45 cycles.

10. The prediction method according to claim 8, characterized in that: The fiber strength of individuals with AT genotype of the SNP molecular marker is significantly higher than that of individuals with GC genotype.

Citation Information

Patent Citations

  • Molecular markers from sea island cotton Hai 1 and related to cotton fiber strength and application of molecular markers

    CN103497949A

  • Fiber strength related molecular mark from gossypium barbadense and application thereof

    CN105483248A

  • Sea-island cotton fiber strength QTL closely linked InDel molecular marker and application thereof

    CN118726643A