Application of siGmfb in preparation of medicine for treating fatty liver diseases related to metabolic dysfunction

Abstract

The invention relates to application of siGmfb in preparation of a medicine for treating metabolic dysfunction related fatty liver diseases. The siGmfb can reach the liver through a GalNAc delivery system, so that the GMFB is specifically knocked down by the liver. A GalNAc delivery path is only effective on liver cells expressed by ASGPR, and no effective delivery path exists in other cells / tissues. The small nucleic acid drug siGmfb targeted liver knocks down GMFB, so that the fat content is remarkably reduced, and the muscle content is increased; the area under an insulin tolerance experiment curve is obviously reduced, the impaired insulin tolerance of obese mice is improved, and the insulin sensitivity is increased. The small nucleic acid drug siGmfb is utilized to target the liver to knock down GMFB, obesity and related metabolic diseases are improved, and the small nucleic acid drug siGmfb has the potential of target treatment of chronic diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the application of siGmfb in the preparation of a drug for treating fatty liver diseases associated with metabolic dysfunction. Background Art

[0002] Metabolic dysfunction-associated fatty liver disease (MAFLD) is a chronic progressive disease that affects approximately 1 billion people worldwide and is growing closely with the prevalence of obesity and type 2 diabetes mellitus (T2DM). MAFLD is characterized by excessive liver fat accumulation (5% or more of liver body weight) and is associated with obesity / overweight and insulin resistance, along with metabolic disorders such as type 2 diabetes and obesity. It can progress asymptomatically to cirrhosis and subsequently to hepatocellular carcinoma, with few approved drug options to date. As the etiology of MAFLD is very complex and also affects extrahepatic organs, the optimal drug treatment for MAFLD should reduce liver steatosis, fibrosis, and inflammation.

[0003] Small nucleic acid drugs are a new category of drugs, such as siRNA drugs, which mainly act on cytoplasmic mRNA, recognize and inhibit target mRNA through base complementarity, and achieve the purpose of regulating protein expression to treat diseases. In theory, small nucleic acid drugs have the characteristics of being more widely druggable than protein drugs, and they also have the potential to overcome undruggable protein targets; the degradation of targeted mRNA caused by siRNA can be repeated, so it has the potential to be effective for a long time with a single dose, which can improve patient compliance. The realization of the GalNAc covalently linked delivery system is a major breakthrough in the development of small nucleic acid drugs. This technology solves the three major pain points in the development of small nucleic acid drugs: poor targeting, serious off-target effects, and poor stability, bringing major breakthroughs in the field of liver targeting.

[0004] GMFB (glia maturation factor beta) is an acidic cytoplasmic protein first isolated and purified from bovine brain. It is highly conserved in evolution and is closely related to neurodegeneration and neuroinflammation.

[0005] Currently, there is no study using small nucleic acid drugs to target GMFB to intervene in MAFLD-related metabolic diseases. Summary of the invention

[0006] Based on the lack of effective treatment methods for metabolic dysfunction associated fatty liver disease (MAFLD) in the prior art, the present invention provides the use of siGmfb in the preparation of a drug for treating metabolic dysfunction associated fatty liver disease.

[0007] The object of the present invention can be achieved by the following technical solutions:

[0008] First, the present invention provides the use of siGmfb in the preparation of a drug for treating fatty liver diseases related to metabolic dysfunction. The siGmfb is a kind of siRNA, which is a double-stranded RNA composed of a complementary sense strand and an antisense strand. The sense strand is the nucleic acid sequence shown in SEQ ID NO: 1, and the antisense strand is the nucleic acid sequence shown in SEQ ID NO: 2.

[0009] Among them, the nucleic acid sequence of the sense strand is as follows: GAAGAAUGGUUACGUGAGAAAdTdT;

[0010] The nucleic acid sequence of the antisense strand is as follows: UUUCUCACGUAACCAUUCUUCdTdT.

[0011] Here, the siGmfb refers to siRNA targeting humans.

[0012] Among them, siGmfb can reach the liver through the GalNAc delivery system to achieve liver-specific knockdown of GMFB.

[0013] The GalNAc delivery pathway is only effective in liver cells expressing ASGPR, and there is no effective delivery pathway in other cells / tissues.

[0014] The present invention uses the small nucleic acid drug siGmfb to reduce liver lipid deposition. In particular, siGmfb can cause targeted degradation of Gmfb mRNA, and uses it as a targeted drug for the treatment and intervention of liver lipid deposition.

[0015] Furthermore, in an embodiment of the present invention, there is provided the use of the siGmfb in the preparation of a drug for treating liver lipid deposition caused by obesity.

[0016] Furthermore, in an embodiment of the present invention, there is provided the use of the siGmfb in the preparation of a drug for treating and reducing the liver fat content caused by obesity.

[0017] Furthermore, in an embodiment of the present invention, there is provided the use of the siGmfb in the preparation of a drug for treating and reducing the liver fat content caused by obesity and increasing muscle content.

[0018] Furthermore, in an embodiment of the present invention, there is provided the use of the siGmfb in the preparation of a drug for improving the body fat ratio of obese individuals.

[0019] Furthermore, in an embodiment of the present invention, there is provided the use of the siGmfb in the preparation of a drug for increasing insulin sensitivity.

[0020] The present invention further provides the use of Gmfb in screening for drugs for treating fatty liver diseases related to metabolic dysfunction.

[0021] The present invention also provides the use of a reagent for detecting the expression level of the Gmfb gene in the preparation of a product for diagnosing fatty liver diseases related to metabolic dysfunction.

[0022] Furthermore, the present invention also provides the use of a reagent for detecting the expression level of the Gmfb gene in the preparation of a product for diagnosing liver lipid deposition.

[0023] In one embodiment of the present invention, the product includes: a probe that specifically recognizes the Gmfb gene; or primers that specifically amplify the Gmfb gene; or an antibody or ligand that specifically binds to the protein encoded by the Gmfb gene.

[0024] The present invention first designed siGmfb for mice. Among them, siGmfb for mice is a kind of siRNA, which is a double-stranded RNA composed of a sense strand and an antisense strand that are complementary to each other. The sense strand is the nucleic acid sequence shown in SEQ ID NO: 3, specifically GAACAAGCUAGUCCAGACUGC, and the antisense strand is the nucleic acid sequence shown in SEQ ID NO: 4, specifically AGUCUGGACUAGCUUGUUCUU.

[0025] The RNA system modified with N-acetylgalactosamine GalNAc was used to achieve targeted delivery. Then, obese mice were intervened with the small nucleic acid drug siGmfb. After one month of treatment, the glucose homeostasis of the normal obese mouse group and the mouse group intervened with the high dose (2OD / time) of the small nucleic acid drug siGmfb was observed through an insulin tolerance test. It was found that targeted knockdown of GMFB in the liver by the small nucleic acid drug siGmfb significantly reduced the area under the insulin tolerance test curve, improved the impaired insulin tolerance of obese mice, and increased insulin sensitivity. The results of magnetic resonance body composition analysis showed that targeted knockdown of GMFB in the liver by the small nucleic acid drug siGmfb significantly reduced the fat content and increased the muscle content. This indicates that the small nucleic acid drug is a promising targeted therapeutic drug, and Gmfb can be used as a therapeutic target for metabolic diseases such as obesity.

[0026] The present invention found that siGmfb can reach the liver through the GalNAc delivery system to achieve liver-specific knockdown of GMFB (the sequences of the two strands of human siGmfb after homologous screening are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively, and the sequences of the two strands of mouse siGmfb are shown in SEQ ID NO: 3 and SEQ ID NO: 4 respectively). The GalNAc delivery pathway is only effective in liver cells expressing ASGPR, and there is no effective delivery pathway in other cells / tissues.

[0027] The present invention found that the small nucleic acid drug siGmfb targeted liver knockdown of GMFB significantly reduced fat content and increased muscle content; significantly reduced the area under the curve of the insulin tolerance test, improved the impaired insulin tolerance of obese mice, and increased insulin sensitivity.

[0028] The present invention utilizes the small nucleic acid drug siGmfb to target the liver and knock down GMFB, thereby improving obesity and related metabolic diseases, and has the potential to target and treat chronic diseases.

[0029] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0030] 1) Small nucleic acid drugs are promising targeted therapeutic drugs. Since small nucleic acid drugs act on the mRNA link of the central dogma and take effect before protein translation, they are theoretically more druggable than protein drugs and have the potential to conquer protein targets that are not druggable. At the same time, small nucleic acids take effect on mRNA sequences, so the design direction is clear and the drug development cycle is short. In addition, the degradation of targeted mRNA caused by siRNA can be repeated, so it has the potential to be effective for a long time with a single dose, which can improve patient compliance.

[0031] 2) The small nucleic acid drug siGmfb achieves liver-specific knockdown of GMFB via the GalNAc delivery pathway.

[0032] 3) The small nucleic acid drug siGmfb targeted liver GMFB knockdown significantly reduced fat content and increased muscle content, indicating that the small nucleic acid drug siGmfb targeted interference with liver GMFB may improve the body fat ratio of obese patients.

[0033] 4) The small nucleic acid drug siGmfb targeted liver knockdown of GMFB significantly reduced the area under the curve of the insulin tolerance test, improved the impaired insulin tolerance of obese mice, and increased insulin sensitivity.

[0034] 5) Small nucleic acid drug siGmfb targeted liver knockdown of GMFB significantly reduced liver lipid deposition. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 : The results of magnetic resonance imaging (MRI) body composition analysis showed that the small nucleic acid drug siGmfb targeted liver knockdown of GMFB significantly reduced fat content and increased muscle content.

[0036] Figure 2 : Small nucleic acid drug siGmfb targeted liver knockdown of GMFB significantly improved the impaired insulin tolerance and increased insulin sensitivity in obese mice.

[0037] Figure 3:The small nucleic acid drug siGmfb targets the liver to knockdown GMFB, significantly reducing liver lipid deposition.

[0038] Figure 4 Verification of the knockdown efficiency of siGmfb in mice.

[0039] Figure 5 Verification of the knockdown efficiency of siGmfb in humans. Specific implementation manners

[0040] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0041] Example 1

[0042] In the following examples, mice were raised in a SPF-level environment at the Animal Center of Tongji University. The results of magnetic resonance body composition data were analyzed by the Animal Platform of the Chinese Academy of Sciences.

[0043] Example 1

[0044] The small nucleic acid drug siGmfb targets the liver to knockdown GMFB, significantly reducing fat content and increasing muscle content.

[0045] Intervention of the small nucleic acid drug siGmfb in obese mice (the targets of the small nucleic acid drug siGmfb are shown in Table 1): Six-week-old mice were fed a high-fat diet for 8 weeks to establish an obese mouse model. Then the mice were divided into 2 groups: a normal obese mouse group and a high-dose (2 OD / time) intervention group of the small nucleic acid drug siGmfb. Obese mice in the intervention group were subcutaneously injected with the small nucleic acid drug siGmfb once a week according to the dose, and the control group was injected with PBS. Samples were collected after 4 injections for one month of intervention.

[0046] Table 1 Candidate targets of mouse siGmfb after homologous screening

[0047]

[0048] Magnetic resonance detection was performed on each group of mice to analyze body composition: After one month of intervention with the small nucleic acid drug siGmfb in mice, magnetic resonance detection was performed on obese mice to measure fat content and muscle content, and the data was visually analyzed. The results showed that the fat content in the siGMFB intervention group was significantly reduced and the muscle content was significantly increased (the results are shown in Figure 1 ).

[0049] Example 2 The small nucleic acid drug siGmfb targets the liver to knockdown GMFB, significantly improving the impaired insulin tolerance of obese mice and increasing insulin sensitivity.

[0050] After one month of intervention with the small nucleic acid drug siGmfb in obese mice, an insulin tolerance test was conducted. The specific operation is as follows: Each mouse was intraperitoneally injected with insulin (1 IU / kg), and then the blood glucose concentration was measured at the mouse tail at 0, 15, 30, 60, 90, and 120 min. (The results are shown in Figure 2 ).

[0051] In Example 3, the small nucleic acid drug siGmfb targeted the liver to knockdown GMFB, which significantly reduced liver lipid deposition. HE staining of the mouse liver showed that there were many white lipid droplets of different sizes in the liver of mice on a high-fat diet, and the lipid droplets in the liver of mice injected with siGMFB were significantly reduced (The results are shown in Figure 3 ).

[0052] In Example 4, total proteins were extracted from the livers of mice injected with siGMFB and the livers of obese mice. 30 μg was taken for Western blotting. The antibodies were rabbit anti-GMFB polyclonal antibody (Sangon D123834) and mouse anti-ACTB (HRP-Conjugate) monoclonal antibody (Sangon D190826). The results showed that the intensity of the gmfb band in the siGMFB intervention group was significantly reduced (The results are shown in Figure 4 ).

[0053] Example 5: HepG2 (hepatocyte cell line) grew in 10% fetal bovine serum / DMEM-high glucose / penicillin / streptomycin. HepG2 cells were transfected with siGMFB at a final concentration of 30 nM. Cells were collected 48 hours after transfection, lysed with a protein lysate, and 30 μg was taken for Western blotting. The antibodies were rabbit anti-GMFB polyclonal antibody (Sangon D123834) and mouse anti-ACTB (HRP-Conjugate) monoclonal antibody (Sangon D190826). The results showed that the intensity of the GMFB band in hepatocytes transfected with siGMFB was significantly reduced (The results are shown in Figure 5 ).

[0054] The above description of the embodiments is for the convenience of those of ordinary skill in the art to understand and use the invention. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative labor. Therefore, the present invention is not limited to the above embodiments, and the improvements and modifications made by those skilled in the art without departing from the scope of the present invention according to the disclosure of the present invention should be within the protection scope of the present invention.

Claims

1. The use of siGmfb in the preparation of a drug for treating fatty liver disease associated with metabolic dysfunction, characterized in that: The siGmfb is a siRNA, which is a double-stranded RNA composed of a complementary sense strand and an antisense strand, wherein the sense strand is the nucleic acid sequence shown in SEQ ID NO: 1, and the antisense strand is the nucleic acid sequence shown in SEQ ID NO:

2.

2. The use according to claim 1, characterized in that: The siGmfb is used in preparing a drug for treating liver lipid deposition caused by obesity.

3. The use according to claim 1, characterized in that: The siGmfb is used in preparing a drug for treating and reducing liver fat content caused by obesity.

4. The use according to claim 1, characterized in that: The siGmfb is used in the preparation of a drug for treating obesity-induced reduction of liver fat content and increase of muscle content.

5. The use according to claim 1, characterized in that: The use of the siGmfb in preparing a drug for improving the body fat ratio of obese individuals.

6. The use according to claim 1, characterized in that: The application of the siGmfb in preparing a drug for increasing insulin sensitivity.

7. Application of Gmfb in screening drugs for the treatment of fatty liver disease associated with metabolic dysfunction.

8. Use of a reagent for detecting the expression level of the Gmfb gene in the preparation of a product for diagnosing fatty liver disease associated with metabolic dysfunction.

9. The use according to claim 8, characterized in that: Application of a reagent for detecting the expression level of the Gmfb gene in the preparation of a product for diagnosing liver lipid deposition.

10. The use according to claim 8, characterized in that: The product includes: a probe that specifically recognizes the Gmfb gene; or a primer that specifically amplifies the Gmfb gene; or an antibody or ligand that specifically binds to the protein encoded by the Gmfb gene.

Images