Rice nicotinamide synthase coding gene OsNAS1 and application of rice nicotinamide synthase coding gene OsNAS1 in influence of rice potassium transport and low potassium tolerance

Abstract

The invention discloses an application of a rice nicotinamide synthase coding gene OsNAS1. The sequence of the gene is as shown in SEQ ID NO. 1. The gene can influence the potassium transport in the rice body and reduce the potassium sensitivity of the rice under low-potassium treatment. A large number of experiments show that the rice nicotinamide synthase encoding gene OsNAS1 has a new biological function in the aspect of potassium nutrition, and after the gene is knocked out, potassium transport in rice can be changed, and the tolerance of seedlings to low potassium is enhanced.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology and relates to the genetic engineering application of the rice nicotinamide synthase encoding gene OsNAS1. Background Technology

[0002] K + It is the most abundant cation in living plant cells, accounting for approximately 2%-10% of the plant's dry weight. (Et., 2014; Adams and Shin, 2014; Leigh and Wyn Jones, 1984). Compared to nitrogen and phosphorus, the relatively low availability of potassium in soil limits crop production, thus threatening food security and agricultural sustainability. Improving plant nutrient use efficiency offers a possible way to overcome the effects of potassium deficiency. Studying the molecular mechanisms by which plants sense, absorb, translocate, and utilize potassium is an important prerequisite for improving crop nutrient use efficiency.

[0003] Potassium utilization efficiency (KUE) in rice is a typical quantitative trait controlled by multiple genes (Rengel and Damon, 2008; Yang et al., 2003). Genome-wide association analysis (GWA) is a method that uses all single nucleotide polymorphisms (SNPs) within a population to associate with a specific phenotypic value, thereby identifying loci significantly associated with that trait. In this study, 208 rice accessions from different geographical regions were treated with different potassium levels at the seedling stage. The dry weight and KUE of different parts of the rice plant were measured and statistically analyzed. + By combining traits such as potassium concentration with genome-wide association analysis, key loci involved in the formation of potassium use efficiency traits were screened. At the same time, dominant haplotypes of candidate genes were analyzed to elucidate the possible working mechanisms of dominant haplotypes, in an attempt to provide a certain theoretical and experimental basis for breeding potassium-efficient rice materials. Summary of the Invention

[0004] The purpose of this invention is to provide information on the effect of OsNAS1 on potassium transport in rice and its application in tolerance to low potassium levels.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] The application of the rice nicotinamide synthase encoding gene OsNAS1 in influencing rice's tolerance to low potassium environments and potassium transport, the genomic nucleotide sequence of the nicotinamide synthase encoding gene OsNAS1 is shown in SEQ ID NO.1.

[0007] Furthermore, the CDS sequence of the transcript encoded by the rice nicotinamide synthase gene OsNAS1 is shown in SEQ ID NO.2.

[0008] As a preferred embodiment of the present invention, knocking out OsNAS1 under low potassium treatment reduces the sensitivity of rice seedlings to low potassium treatment, and the root-shoot ratio (root dry weight / above-ground dry weight) of the mutant is significantly increased.

[0009] As a further preferred embodiment of the invention, knocking out OsNAS1 affects the K in rice. + Distribution, in low K + Under treatment, K in the roots of mutant plants + The total amount was significantly higher than that of the wild type, and the amount of K in the leaf sheath was also significantly higher. + The total amount was significantly lower than that of the wild type, with no obvious difference in the leaves.

[0010] As a further preferred embodiment of the present invention, knocking out OsNAS1 may affect the K in rice. + Transshipment, low K + Under treatment, K in the xylem sap of mutant materials + The concentration decreased to 85-94% of the wild type, indicating that OsNAS1 may affect potassium levels in rice. + The transport from the roots to the above-ground parts.

[0011] Beneficial effects of the present invention

[0012] 1. This invention, through systematic research, reports for the first time the biological function of the rice nicotinamide synthase encoding gene OsNAS1 in potassium transport and potassium tolerance in rice.

[0013] 2. Compared to the wild-type Zhonghua 11 material, the knockout material osnas1 performs better at low K. + Under the treatment, the biomass root-shoot ratio (root dry weight / above-ground dry weight) increased to 110%.

[0014] 3. Knockout material Osnas1 at low K + After processing, K in the root + With increased concentration, the potassium content in the roots was significantly higher than that in the wild type, while the opposite was true for the aboveground parts.

[0015] 4. Low K + Under treatment, K was removed from the xylem sap of the Osnas1 material. + Concentration and K + The overflow rate has decreased to some extent, to about 85-94% of that of the wild type. Attached Figure Description

[0016] Figure 1 K in roots and aboveground parts + Manhattan plot and QQ scatter plot of total amount in germplasm resource population;

[0017] Figure 2 Different K supply+ The effect of OsNAS1 mutation on rice (ZH11) growth under certain conditions;

[0018] Figure 3 Different K supply + Under certain conditions, the OsNAS1 mutation affects the K in rice (ZH11). + The effect of content;

[0019] Figure 4 Different K supply + Under certain conditions, the OsNAS1 mutation affects the K in rice. + The impact of transshipment. Detailed Implementation

[0020] Example 1. Genome-wide association analysis

[0021] This study utilized 208 rice germplasm resources to conduct normal potassium supply testing during the seedling stage. + (1mM K + ) and low K + (0.1mMK + After 4 weeks of treatment, biomass and potassium levels were measured. + Differences in K content were observed. Using 208 rice accessions from a germplasm resource population under normal K supply... + and low K + K in the roots and aboveground parts + The total data, combined with 2,338,386 known high-quality SNP markers, were analyzed using a mixed linear model (MLM) and GWAS analysis with TASSEL 5.2.3 software. Manhattan plots and QQ plots were then generated based on the association analysis results. Figure 1 As shown, a multi-trait repeat site is associated near Chr_310.9Mb, which is located at low K. + K in the root under processing + Total amount, normal supply of K + Treatment of aboveground parts K + Total amount and at low K + Treatment of aboveground parts K + The -log10(P) values ​​in the total values ​​are 5.95, 5.01, and 5.47, respectively, and R0 2 The percentages were 26.6%, 20.3%, and 21.6%, respectively. LD analysis revealed that the LD region was approximately 130 kb. Using Nipponbare IRGSP-1.0 as the rice reference genome and combining it with rice annotation databases, 25 genes were found within this region. qRT-PCR analysis of these 25 genes revealed a K+ deficiency. + The expression of LOC_Os03g19427 in roots and shoots was suppressed, which was observed in K-deficient plants. + The expression levels of K under normal supply are respectively+ Approximately 30% and 20% of the results were obtained. Ultimately, the gene was selected as being related to rice K. + Further research was conducted on candidate genes associated with the content, namely the gene OsNAS1 that encodes nicotinamide (NA) synthase.

[0022] Example 2. Preparation of Osnas1 knockout materials

[0023] The osnas1 mutant was purchased from Biogle Genetics (http: / / biogle.cn / user), with the target sequence: GATCCGAGGACGTCAGGCGTGG. The selected mutant materials were BG100019D05 and BG100904H12, and were subsequently named osnas1-zh1 and osnas1-zh2, respectively. The wild type is the japonica rice variety ZH11.

[0024] The primer sequences for mutant identification are as follows:

[0025] OsNAS1-PCR F:ATGGAGGCTCAGAACCAAGA

[0026] OsNAS1-PCR R:TTAGACGGACAGCTCCTGTT

[0027] The osnas1-zh1 sequence was identified as having a 5bp deletion, and the deleted sequence is as follows:

[0028] TCAGG

[0029] The mutation of osnas1-zh2 was identified as causing disordered amino acid sequences. The mutation results are as follows:

[0030] The original sequence is: ACGTCAGG

[0031] Post-mutation sequence: CGCT

[0032] Example 3. Effects of OsNAS1 mutation on rice growth

[0033] Seeds of mutants and wild-type materials were germinated in water. After transplanting, seedlings were cultured in 1 / 8, 1 / 4, 1 / 2, and full IRRI nutrient solutions for 3 days each, followed by low K treatment. + (0.1mM K + ) Processing, normal K + (1mM K +The treated materials were cultured in normal IRRI nutrient solution for another 4 weeks before samples were collected. Five replicates were performed for each line. Rice roots were first rinsed twice with deionized water, then soaked in 0.1 mM CaSO4 solution for 2 min, and finally rinsed twice with deionized water. The roots were dried, and samples were collected from different parts as needed. The collected samples were blanched at 115℃ for 30 min, and then dried at 60℃ to constant weight. The dry biomass was obtained by weighing using a microbalance.

[0034] like Figure 2 As shown, low K + It significantly reduced the root-shoot ratio (root dry weight / aerial dry weight) of both wild-type and osnas1 mutants, and under normal K supply conditions + Under treatment, the root-to-shoot ratio of the osnas1 mutant was approximately 88% of that of the wild type; however, under low K... + Under these conditions, this value increased to 110%. This indicates that under normal K supply... + At low K levels, the OsNAS1 mutation reduces the transport of photosynthetic products to the roots; while at low K levels... + Under certain conditions, the OsNAS1 mutation significantly enhances the transport of photosynthetic products to the roots, which is beneficial for strengthening rice growth under low K conditions. + Absorption K under the conditions + ability.

[0035] Example 4. Effect of OsNAS1 mutation on potassium content in rice.

[0036] The rice seedling cultivation and sampling methods are as described in Example 3. The sample was then pulverized into powder, and 0.05 g was weighed into a 10 mL centrifuge tube. 2 mL of 1M HCl was added for extraction for three days. The solution was then diluted with 5 mL of deionized water, filtered through qualitative filter paper, and the resulting filtrate was diluted 6 times with deionized water. The K+ concentration in the solution was determined using a flame photometer (AP1200). + Concentration and statistical calculations were performed.

[0037] like Figure 3 As shown, the OsNAS1 mutation significantly reduces the normal supply of K+. + K in the roots of lower plants + Concentration, while significantly increasing K in leaves + Concentration; while at low K + Under treatment, the OsNAS1 mutation increased the K content in the root to some extent. + Concentration. This indicates that under normal K supply conditions... + Under these conditions, OsNAS1 mutations lead to K + More accumulates in the upper part of the body, while in the lower K + Under treatment, the OsNAS1 mutation affects K + It had no significant effect on the distribution in roots and aboveground parts. Therefore, OsNAS1 may affect K.+ Transport within rice plants.

[0038] Example 5. Effects of OsNAS1 mutation on potassium transport in rice

[0039] Wild-type and osnas1 mutant seeds were transplanted 10 days after germination in water. After transplanting, the seedlings were cultured in 1 / 8, 1 / 4, 1 / 2 and full IRRI nutrient solutions for 3 days each, followed by low K treatment. + (0.1mM K + ) Processing, normal K + (1mM K + The treated materials were cultured in normal IRRI nutrient solution for 8 weeks.

[0040] Collection of xylem sap: The aboveground part was quickly cut off 2-3 cm above the rootstock junction with a sharp blade. The sap flowing from the wound was absorbed with absorbent cotton. Then, the wound surface was wrapped with about 0.3 g of absorbent cotton and collected for 5 hours (newly grown tissue was removed periodically to prevent the absorbent cotton from separating from the tissue). The sap was then collected by centrifugation, diluted by the same factor, and the potassium (K) in the sap was determined by ICP. + Content. Collection of phloem sap: Following the method described earlier (King and Zeevaart, 1974), the cut aerial parts were quickly placed into a pre-prepared 20 mM EDTA solution. Approximately 2 cm of stem was then cut off in the solution to prevent tissue blockage due to air exposure. After 2 minutes in the EDTA solution, the solution on the stem surface was wiped off with a paper towel, and the solution was placed in a 50 mL centrifuge tube containing 20 mL of 20 mM EDTA solution. The solution was collected for 5 hours in darkness and high humidity. The aerial part samples were dried and weighed. The collected solution was analyzed using ICP-OES (Perkin Elmer Optima 2000DV) to determine the potassium content. + Content. Phloem K + Content = K in solution + Concentration * Collection liquid volume / Dry weight of aerial parts.

[0041] like Figure 4 As shown, under normal K supply + Below, compared with the wild type, the K content in the xylem sap of the osnas1 mutant material is higher. + Concentration and K + The overflow rates both increased significantly, rising by 40-50% and 45-70%, respectively; at low K... + Under treatment, K in the xylem sap of mutant materials + Although the concentration was not significantly different from the wild type, it was approximately 85-94% of that of the wild type. K in phloem wound fluid +There were no significant differences in concentration. This suggests that OsNAS1 may affect the potassium content in rice. + The transport from the root to the above-ground parts, that is, in normal K + Treatment of K-inhibition + Transport from the roots to the above-ground parts, but at low K + With treatment, this inhibitory effect may be weakened.

[0042] References

[0043] C,Senbayram M,andPeiter E(2014).Potassium agriculture-Statusand perspectives.Journal ofPlant Physiology 171,656-669.

[0044] Adams E,and Shin R(2014).Transport,signaling,and homeostasisofpotassium and sodiumin plants.Journal ofIntegrative Plant Biology 56,231-249.

[0045] Leigh RA,andWyn Jones RG(1984).Ahypoysis relating criticalpotassium concentrations for growth to the distribution and functions ofthision in the plant cell.New Phytologist 97,1-13.

[0046] Rengel Z,and Damon PM(2008).Crops and genotypes differ in efficiency of potassium uptake and use.Physiologia Plantarum 133,624-636.

[0047] Yang X E,Liu JX,Wang W M,et al.(2003).Genotypic differences and someassociatedplant traits inpotassiuminternal use efficiency oflowland rice(Oryza sativa L.).Nutrient Cycling inAgroecosystems 67,273-282.

Claims

1. Application of rice nicotinamide synthase encoding gene OsNAS1 in influencing rice's ability to tolerate low potassium environment and potassium transport, wherein the genomic nucleotide sequence of the nicotinamide synthase encoding gene OsNAS1 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The CDS sequence of the rice nicotinamide synthase encoding gene OsNAS1 is as SEQ ID NO.

2.

3. The use according to claim 1, characterized in that Knockout of OsNAS1 reduces the sensitivity of rice seedlings to low potassium treatment.

4. The use according to claim 1, characterized in that Knocking out OsNAS1 significantly increased the root-to-shoot ratio of rice under low potassium conditions, where the root-to-shoot ratio = root dry weight / aerial dry weight.

5. The use according to claim 1, characterized in that Knockout of OsNAS1 increases root K in rice under low potassium treatment + Total amount, reducing K in leaf sheath + Total amount.

6. The use according to claim 1, characterized in that Knockout of OsNAS1 can reduce K in xylem bleeding sap of rice under low potassium treatment. + concentration.

Images