Application of circPDE5A inhibitor in preparation of medicine for treating sterile looseness of artificial joint

By developing specific inhibitors against circPDE5A, regulating arginine-polyamine metabolism and proinflammatory response in macrophages, the treatment problem of aseptic loosening of artificial joints was solved, and effective intervention and improvement of this pathological process was achieved.

CN120204252AActive Publication Date: 2025-06-27SHENSHAN MEDICAL CENT MEMORIAL HOSPITAL OF SUN YAT-SEN UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510313292.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-17
Publication Date
2025-06-27
Estimated Expiration
2045-03-17

AI Technical Summary

Technical Problem

Prosthesis failure caused by aseptic loosening of artificial joints is a common problem after artificial joint replacement, and it is difficult for the prior art to effectively prevent and treat this problem.

Method used

Develop a specific inhibitor against circular RNA circPDE5A to intervene with the pathological process of sterile loosening induced by titanium particles by regulating LACC1-mediated arginine-polyamine metabolism and proinflammatory responses in macrophages.

Benefits of technology

By targeting inhibition of circPDE5A, it can effectively alleviate the over-activation of macrophage inflammatory signaling pathways and improve the osteolysis microenvironment, thereby providing a safe and effective novel drug for the treatment of sterile loosening of artificial joints.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120204252A_ABST
    Figure CN120204252A_ABST
Patent Text Reader

Abstract

The invention relates to an application of a circPDE5A inhibitor in preparation of a medicine for treating sterile looseness of an artificial joint. According to the present invention, the positive correlation between the circPDE5A and the sterile loosening is determined; through RNA Pull-Down experiments and protein mass spectrometry (MS) analysis, it is clear that circPDE5A can affect regulation and control of an LACC1 signal channel through interaction with LACC1, and then the inflammatory response of macrophages is affected. In addition, through in-vivo animal experiments, the result of a mouse skull osteolysis model shows that the injection of lentivirus for knocking down circPDE5A can relieve osteolysis induced by Ti particles. In general, the invention provides a new thought and theoretical basis for research and development of medicines for treating sterile looseness of artificial joints, and has important clinical value and social significance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to the application of circPDE5A inhibitors in the preparation of drugs for treating aseptic loosening of artificial joints. Background Art

[0002] Arthroplasty is the main surgical method for treating advanced osteoarticular diseases, especially applicable to diseases such as osteoarthritis, rheumatoid arthritis, and osteonecrosis of the femoral head. This technology can significantly relieve joint pain, improve function, and enhance the quality of life of patients. With the development of technology and the improvement of surgical materials, the success rate and long-term efficacy of arthroplasty have been continuously improved. However, due to complications such as prosthesis wear, loosening, and osteolysis, prosthesis failure may still occur after joint replacement, especially aseptic loosening, which is one of the most common causes leading to revision surgery for joint replacement. According to statistics, the proportion of revision surgeries caused by aseptic loosening has been increasing year by year, and the complexity and cost of revision surgeries are much higher than those of primary replacement surgeries. Therefore, how to effectively prevent and treat aseptic loosening has become an important topic in the field of artificial joint research.

[0003] Aseptic loosening is a pathological osteolysis process caused by chronic inflammation around the prosthesis. Particles generated by prosthesis wear (such as titanium particles) are the main pathogenic factors. After being phagocytosed by macrophages, these particles can induce the activation of macrophages and release a large number of pro-inflammatory factors, such as tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and RANKL (receptor activator of nuclear factor-κB ligand), etc. These factors accelerate the absorption and dissolution of bone tissue by promoting the differentiation and activity of osteoclasts. Research shows that the inflammatory response of macrophages is a key regulatory node in aseptic loosening. For example, by regulating the activation of NLRP3 inflammasome, the inflammatory response mediated by macrophages can be significantly reduced, thereby improving bone loss. Therefore, inhibiting the release of pro-inflammatory factors by macrophages or regulating their functional state may significantly improve the pathological process of aseptic loosening.

[0004] Circular RNA (circRNA) is a class of non-coding RNAs with a closed circular structure formed by RNA back-splicing, possessing high stability and specific regulatory functions. In recent years, the research on circular RNA in inflammation, tumors, and metabolic diseases has received extensive attention. Circular RNA can indirectly regulate the expression of target genes by binding to microRNA (miRNA) as a "sponge", and can also directly interact with proteins to participate in the regulation of signaling pathways. For example, it has been found that circular RNA circHIPK3 can promote the excessive secretion of inflammatory factors in macrophages by adsorbing miR-561 and miR-192, thereby exacerbating the inflammatory response. In addition, circZNF609 regulates the production of reactive oxygen species (ROS) and the secretion of inflammatory factors in macrophages by binding to mitochondrial-related proteins, playing an important role in various inflammatory diseases. These studies suggest that circular RNA may play a key role in macrophage inflammatory response and its downstream bone loss.

[0005] LACC1 (Laccase Domain Containing 1) is a key regulatory molecule discovered in inflammatory diseases in recent years. It affects inflammation and immune responses by regulating the arginine-polyamine metabolic pathway in macrophages. Arginine metabolism is an important biochemical pathway in macrophages, and its metabolites nitric oxide (NO) and polyamines have a two-way regulatory effect on the inflammatory response. Studies have shown that LACC1 inhibits the inflammatory response by enhancing the activity of arginase 1 and promoting the production of anti-inflammatory polyamine products. In addition, the deletion of LACC1 is closely related to the dysfunction of macrophages in diseases such as inflammatory bowel disease (IBD). Although the specific role of LACC1 in aseptic loosening has not been deeply explored at present, its potential value in macrophage metabolic regulation provides a direction for future research. Summary of the Invention

[0006] The purpose of the present invention is to solve the problems existing in the treatment of aseptic loosening of artificial joints in the prior art, thereby identifying a circular RNA, namely circPDE5A, that is closely related to aseptic loosening of artificial joints. The specific inhibitor provided by the present invention for circular RNA circPDE5A can be used to regulate LACC1-mediated macrophage arginine-polyamine metabolism and pro-inflammatory response, thereby intervening in the pathological process of titanium particle-induced aseptic loosening. By targeting and inhibiting circPDE5A, the over-activation of the macrophage inflammatory signaling pathway can be effectively alleviated, the osteolytic microenvironment can be improved, and ultimately a safe and effective new drug for the treatment of aseptic loosening can be provided.

[0007] To achieve the above object, the present invention is realized by the following means:

[0008] The first aspect of the present invention provides the use of a circPDE5A inhibitor in the preparation of a drug for treating aseptic loosening of artificial joints and / or improving physiological indices related to aseptic loosening of artificial joints.

[0009] Preferably, the physiological indices related to aseptic loosening of artificial joints are selected from one or more of the levels of inflammatory factors, the levels of core regulatory factors of macrophage inflammatory response, the level of spermidine, the level of spermine, the level of ornithine decarboxylase 1, and the effect of cranial bone lysis.

[0010] Preferably, the inflammatory factors are selected from one or more of TNF-α and IL-1β.

[0011] Preferably, the core regulatory factor of macrophage inflammatory response is selected from LACC1.

[0012] Preferably, the circPDE5A inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the circPDE5A gene.

[0013] Preferably, the circPDE5A inhibitor is selected from siRNA designed based on the circPDE5A gene.

[0014] Preferably, the sequence of the siRNA is selected from one or more of SEQ ID NO: 1 (5'-GGAAGAGAGAAATGGTCAA-3') and SEQ ID NO: 2 (5'-AATCATAGGGAAGAGAGAA-3').

[0015] The second aspect of the present invention provides the use of a reagent for detecting the expression level of circPDE5A in the preparation of a product for prognostic evaluation of aseptic loosening of artificial joints.

[0016] Preferably, the reagent for detecting the expression level of circPDE5A includes a primer pair for specifically detecting the level of circPDEA5.

[0017] Preferably, the upstream sequence of the primer pair is as shown in SEQ ID NO: 3 (5'-AGAAGTTGACCAAATTACAGGCT-3'), and the downstream sequence is as shown in SEQ ID NO: 4 (5'-CCATGCATTGACCATTTCTCTCT-3').

[0018] The third aspect of the present invention provides a pharmaceutical composition for treating aseptic loosening of artificial joints and / or improving physiological indices related to aseptic loosening of artificial joints, comprising a circPDE5A inhibitor and a pharmaceutically acceptable carrier.

[0019] Preferably, the physiological indexes related to aseptic loosening of artificial joints are selected from one or more of the levels of inflammatory factors, the levels of core regulatory factors of macrophage inflammatory response, the level of spermidine, the level of spermine, the level of ornithine decarboxylase 1, and the skull dissolution effect.

[0020] Preferably, the inflammatory factors are selected from one or more of TNF-α and IL-1β.

[0021] Preferably, the core regulatory factor of macrophage inflammatory response is selected from LACC1.

[0022] Preferably, the circPDE5A inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the circPDE5A gene.

[0023] Preferably, the circPDE5A inhibitor is selected from siRNA designed based on the circPDE5A gene.

[0024] Preferably, the sequences of the siRNA are selected from one or more of SEQ ID NO: 1 and SEQ ID NO: 2.

[0025] Preferably, the pharmaceutically acceptable carrier includes one or more of fillers, binders, disintegrants, solvents, preservatives, lubricants, and flavoring agents.

[0026] Unless otherwise specified, in the context of the present invention, the circPDE5A inhibitor refers to a substance that can specifically down-regulate the level or activity of circPDE5A. For example, methods such as antisense oligonucleotides, siRNA, shRNA, sgRNA, antagomiRs, miRNA sponges, miRNA Erasers, Target Masking, and / or multi-targets are used to down-regulate the expression level and / or activity of circPDE5A, as long as the level and / or activity of circPDE5A can be reduced. The primer and / or primer pair refers to a PCR primer used to synthesize the cDNA strand of the circPDE5A gene in PCR, so as to detect the expression level of the circPDE5A gene mRNA. In addition to the primers and / or primer pairs listed in the present invention, those skilled in the art are fully capable of designing corresponding primers and / or primer pairs according to the gene sequence of circPDE5A by using conventional methods and means in the art, including but not limited to molecular biology, and screening the designed primers and / or primer pairs by conventional experimental means, as long as the specific detection of the circPDE5A expression level can be achieved.

[0027] Through a large number of studies, the present invention performed high-throughput sequencing of circRNAs on mouse bone marrow-derived macrophages stimulated by Ti particles, and found and identified that circPDE5A was significantly highly expressed therein. It was verified that it was highly expressed around the prosthesis in patients with aseptic loosening, and at the same time its circularization effect was verified. By detecting its expression in Ti particle-induced macrophages and around the prosthesis in patients with aseptic loosening, it was proved that it had a positive correlation with the occurrence of aseptic loosening. Through RNA Pull-Down experiments and protein mass spectrometry (MS) analysis, differential proteins binding to circPDE5A were screened, and it was predicted that LACC1 was a potential core regulatory gene in the inflammatory response of macrophages activated by wear particles. circPDE5A could affect the regulation of the LACC1 signaling pathway by interacting with LACC1, and further affect the inflammatory response of macrophages. Detecting its expression in Ti particle-induced macrophages and around the prosthesis in patients with aseptic loosening proved that it had a positive correlation with the occurrence of aseptic loosening. In addition, through in vivo animal experiments, the results of a mouse cranial osteolysis model showed that the injection of a lentivirus knocking down circPDE5A could reduce Ti particle-induced osteolysis. Generally speaking, the present invention provides new ideas and a theoretical basis for the drug research and development for the treatment of aseptic loosening of artificial joints, and has important clinical value and social significance. Brief Description of the Drawings

[0028] Figure 1 It is a volcano plot of the results of detecting gene expression in mouse bone marrow-derived macrophages induced by wear particles using RNA high-throughput sequencing.

[0029] Figure 2 It is a schematic diagram of the results of detecting the expression of circPDE5A in Ti particle-induced macrophages using PCR technology.

[0030] Figure 3 It is a schematic diagram of the results of detecting the circularization of circPDE5A using ribonuclease R (RNase R) that removes linear RNA.

[0031] Figure 4 It is a schematic diagram of the results of detecting the expression of circPDE5A in the synovium around the prosthesis in patients with aseptic loosening using FISH technology.

[0032] Figure 5 It is a schematic diagram of the results of detecting the distribution of circPDE5A in the nucleus and cytoplasm using immunofluorescence assay (IF).

[0033] Figure 6 It is for detecting the expression of inflammatory factors produced by Ti particle-induced macrophages after targeting overexpression / knockdown of circPDE5A using ELISA technology.

[0034] Figure 7 To screen for differential proteins that bind to circPDE5A using RNA Pull-Down assays and protein mass spectrometry (MS) analysis, and to predict through bioinformatics analysis that LACC1 is a potential core regulatory gene in the activation of macrophage inflammatory responses by wear particles.

[0035] Figure 8 Schematic diagram of the results of detecting the mRNA level expression of LACC1 in macrophages after targeted overexpression / knockdown of circPDE5A using PCR technology and detecting the protein level expression of LACC1 in macrophages after targeted overexpression / knockdown of circPDE5A using WB technology.

[0036] Figure 9 To detect the secretion levels of downstream spermidine (Spd) and spermine (Spm) induced by Ti particles in macrophages after targeted overexpression / knockdown of LACC1 using ELISA technology, and the schematic diagram of the results that targeted knockdown of LACC1 can reverse the inhibitory effect of overexpression of ornithine decarboxylase 1 (ODC1) on the secretion levels of pro-inflammatory factors TNF-α and IL-1β.

[0037] Figure 10 Schematic diagram of the results of micro-CT detection of mouse skulls. Detailed implementation methods

[0038] To make the objectives, technical solutions, and effects of the present invention clearer and more definite, the following further elaborates on the present invention with reference to the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0039] Unless otherwise specified, the cells used in the context of the present invention are cultured according to the ATCC guidelines. All cell lines are identified by short tandem repeat analysis at the China Center for Type Culture Collection (Wuhan) and verified for mycoplasma contamination using a PCR detection kit (Shanghai Biothrive Sci). They are also cryopreserved in liquid nitrogen and used for subsequent experiments. The reagents, consumables, etc. used in the present invention are all obtained commercially or prepared by conventional methods. The experimental methods used in the present invention, such as molecular biology experiments and cell biology experiments, are all conventional methods and techniques in the art.

[0040] Representative results from biological experiment replicates are presented in the context figures, and the data are shown as mean ± SD as specified in the figures. All experiments are repeated at least three times. The data are analyzed using GraphPad Prism 8.0. The t-test or analysis of variance is used to compare the mean differences between two or more groups. A p < 0.05 is considered a significant difference.

[0041] Example 1

[0042] First, an in vitro model of stimulating macrophages with wear particles was established, and the specific steps are as follows:

[0043] (1) Under sterile conditions, the femurs and tibias of 8-week-old C57BL / 6J male mice were isolated, and bone marrow cells were extracted. In DMEM high-glucose medium containing 1% double antibiotics and 10% FBS, 10 ng / mL macrophage colony-stimulating factor was added, and the cells were cultured at a constant temperature of 5% CO2 and 37 °C for 5 - 7 days to obtain mature mouse bone marrow-derived macrophages.

[0044] (2) The titanium particle solution (Alfa Aesar) was diluted with sterile water and filtered through Isopore membranes with pore sizes of 10 μm, 1.2 μm, and 0.2 μm to obtain titanium particles in the range of 0.82 ± 0.12 μm, and then washed with 75% ethanol for 48 hours.

[0045] (3) After the ethanol had completely evaporated, the titanium particles were weighed and sterilized with ethylene oxide. The sterilization of the titanium particles was confirmed by the limulus amebocyte lysate assay, and then diluted with PBS to a titanium particle solution of 9×10 -3 g / mL.

[0046] (4) At different time points, the mouse bone marrow-derived macrophages were stimulated with the titanium particles prepared in step (3) to establish an in vitro model of stimulating macrophages with wear particles.

[0047] The macrophages derived from the in vitro model of stimulating macrophages with wear particles were analyzed using circRNA high-throughput sequencing technology, and the specific steps are as follows:

[0048] (1) Mouse bone marrow-derived macrophages stimulated with titanium particles for 4 hours were lysed using a Trizol kit to extract total RNA, and the quality and integrity of the RNA samples were evaluated using an Agilent 2100 bioanalyzer.

[0049] (2) The samples were treated with RNase R to selectively degrade linear RNA while retaining circular closed RNA that is resistant to RNase R.

[0050] (3) After enzymatic digestion, the RNA was purified by methods such as column purification or magnetic bead purification to ensure the obtained purified circular RNA. Next, specific primers were added to the RNA fragments and reverse-transcribed into cDNA, and the cDNA was subjected to end repair, addition of a poly(A) tail, and ligation of Illumina sequencing adapters.

[0051] (4) Digest the cDNA with uracil-N-glycosylase (UNG), perform size selection by agarose gel electrophoresis, and perform PCR amplification to enrich the target fragments. Then, perform high-throughput sequencing using the Illumina HiSeq 4000. The sequencing data is strictly filtered to remove reads containing adapter sequences or with a quality value lower than 20 (Q value ≤ 20).

[0052] (4) Perform gene-level read counting on the mouse reference genome (GRCm38) using MapSplice and HTSeq, and use the R package to screen out significantly differentially expressed genes (DEGs) with FDR < 0.05 and log2(fold change) > 1. Determine the circRNAs with significant expression differences through volcano plot and heatmap analysis.

[0053] Subsequently, use qPCR technology to detect the expression of circPDE5A in Ti particle-induced macrophages, and the specific steps are as follows:

[0054] (1) Extract total RNA from Ti particle-stimulated macrophages using the RNAiso Plus kit (9109, TaKaRa Biotechnology), and measure the RNA concentration.

[0055] (2) Reverse transcribe the RNA into cDNA using the TaKaRa reverse transcription kit, and use GAPDH as an internal reference to detect the expression of circPDE5A in mouse bone marrow-derived macrophages stimulated with Ti particles at each time point by qPCR.

[0056] The primers for circPDE5A and GAPDH used are as follows:

[0057] circPDE5A-Forword: AGAAGTTGACCAAATTACAGGCT (SEQ ID NO: 3);

[0058] circPDE5A-Reverse: CCATGCATTGACCATTTCTCTCT (SEQ ID NO: 4);

[0059] GAPDH-Forword: TGTGTCCGTCGTGGATCTGA (SEQ ID NO: 5);

[0060] GAPDH-Reverse: TTGCTGTTGAAGTCGCAGGAG (SEQ ID NO: 6).

[0061] Among them, the volcano plot of the gene expression results is as Figure 1As shown. It was found that circPDE5A was highly expressed in mouse bone marrow-derived macrophages induced by wear particles; and in mouse bone marrow-derived macrophages induced by titanium particles at different time points, circPDE5A was highly expressed (see Figure 2 ). The above results suggest that circPDE5A is highly expressed in an in vitro model of macrophages stimulated by wear particles, indicating that circPDE5A is associated with the occurrence of macrophage inflammatory responses induced by wear particles.

[0062] Example 2

[0063] First, the circularization of circPDE5A was detected, and the specific steps were as follows:

[0064] (1) After extracting the total RNA of BMDM macrophages, genomic DNA contamination was first removed using DNase I. The RNA samples were divided into two groups, one group was treated with RNase R to selectively degrade linear RNA, and the other group was untreated as a control.

[0065] (2) After RNase R digestion, purification was performed to remove enzymes and other small molecule interferents. Subsequently, the two groups of RNA were respectively reverse transcribed into cDNA, and PCR amplification was performed using primers designed to detect the specific circular region of circPDE5A.

[0066] (3) After amplification, the PCR products were separated by 2% agarose gel electrophoresis, and nucleic acid bands were stained with ethidium bromide (EB) or other fluorescent dyes. The bands were observed under ultraviolet light. Circular RNA (circPDE5A) could still show obvious amplification bands after RNase R treatment due to its specific circular structure, while the signal of linear RNA was significantly weakened or disappeared. By comparing the band intensities and positions of the treated group and the untreated group, the circularization of circPDE5A and the stability of its circular structure could be confirmed.

[0067] Subsequently, the expression of circPDE5A in the synovium around the prosthesis of aseptic loosening patients was detected using FISH technology, and the specific steps were as follows:

[0068] (1) The synovial tissue around the prosthesis from aseptic loosening patients and control group tissues were fixed with 4% paraformaldehyde for 12 hours, then dehydrated using xylene, and paraffin-embedded blocks were prepared and sectioned.

[0069] (2) The synovial tissue sections were sequentially subjected to heating, dewaxing, and rehydration steps to restore their hydrated state. Then, the sections were treated with proteinase K at room temperature for 15 minutes to enhance the permeabilization effect of the tissue.

[0070] (3) At 37 °C, the sections were hybridized with a 5'-DIG-labeled Neat1 specific probe for 18 hours. After hybridization, the DIG-labeled probe was detected by immunostaining, using anti-DIG-POD antibody and streptavidin-HRP successively. The signal amplification step was carried out using a tyramide signal amplification kit (TSA, Perkin Elmer, Waltham, PA), and the reaction was carried out for 15 minutes in the dark to enhance the fluorescence signal.

[0071] (4) The sections were counterstained with DAPI to label the cell nuclei, and the images were observed and collected using a confocal microscope.

[0072] Furthermore, immunofluorescence technology was used to detect the distribution of circPDE5A in Ti particle-induced macrophages, and the specific steps were as follows:

[0073] (1) Take 1×10 5 BMDM macrophages and seed them into a confocal dish. Culture them in a constant temperature incubator for 24 h, and then add the corresponding stimulants according to different groups.

[0074] (2) After stimulation, discard the supernatant at the corresponding time points, and add paraformaldehyde for fixation. After washing, add 0.1% Triton X-100 to permeabilize the membrane and gently shake for 15 min.

[0075] (3) After washing three times with PBS again, add blocking goat serum in the dish to block for 30 min. Add the primary antibody to the confocal dish and incubate overnight at 4 °C. The next day, discard the primary antibody, wash with PBS, add 100 μl of the corresponding fluorescent secondary antibody and incubate in the dark at room temperature for 1 h, and then discard the secondary antibody and wash three times with PBS.

[0076] (4) Dropwise add an anti-fluorescence quenching mounting medium containing DAPI, and observe it under a confocal microscope.

[0077] The detection results are as Figures 3 - 5 shown. The results showed that compared with the linear RNA control group, circPDE5A had higher resistance to RNase R digestion, with a total length of 679 nt, and was located on exons 2 to 3 of the PDE5A gene (see Figure 3 ). The results of the FISH experiment showed that the expression of circPDE5A was increased in the synovium around the prosthesis in patients with aseptic loosening (see Figure 4 ). The results of the cellular immunofluorescence experiment (IF) showed that circPDE5A was distributed in both the cell nucleus and cytoplasm (see Figure 5) The above results indicate that circPDE5A has good circular stability and is highly expressed in the synovium around the prosthesis in patients with aseptic loosening, suggesting that circPDE5A is correlated with the occurrence of aseptic loosening.

[0078] Example 3

[0079] First, the ELISA technique was used to detect the expression of inflammatory factors induced by Ti particles in macrophages after targeted overexpression / knockdown of circPDE5A. Among them, the plasmid for targeted overexpression of circPDE5A in mice and the siRNA (si-circPDE5A#1, sequence as shown in SEQ ID NO: 1, GGAAGAGAGAAATGGTCAA; si-circPDE5A#2, sequence as shown in SEQ ID NO: 2, AATCATAGGGAAGAGAGAA) for targeted knockdown of circPDE5A in mice were used. The plasmids were designed and constructed by GenePharma, and the mock vector (Mock) and negative control siRNA (NC) were used as their respective controls. In the verification of the siRNA knockdown effect, the inhibitory effect of si-circPDE5A#1 was relatively more excellent, so si-circPDE5A#1 was used for subsequent experiments for verification.

[0080] The specific steps of ELISA detection are as follows:

[0081] (1) Seed 5×10 5 mouse bone marrow-derived macrophages into a six-well plate and culture for 24 hours, and then culture in Opti-MEM I reduced serum medium for 12 hours successively.

[0082] (2) Add 7.5 μL of Lipofectamine RNAiMAX transfection reagent to each well and transfect 200 pmol siRNA. Collect the culture medium supernatant of mouse bone marrow-derived macrophages transfected with each plasmid after Ti particle stimulation, and discard the debris after centrifugation.

[0083] (3) Use an instant enzyme-linked immunosorbent assay (ELISA) kit to measure the expression of inflammatory factors TNF-α and IL-1β.

[0084] The detection results are as Figure 6 shown. The results show that compared with the control group, targeted overexpression of circPDE5A can promote the production of inflammatory factors by Ti particle-induced macrophages, while targeted knockdown of circPDE5A with si-circPDE5A can inhibit the production of inflammatory factors by Ti particle-induced macrophages.

[0085] Subsequently, RNA Pull-Down and protein mass spectrometry (MS) analysis were used to screen for differential proteins that bind to circPDE5A, and bioinformatics analysis was performed to predict core regulatory genes. The specific steps are as follows:

[0086] (1) After extracting and purifying total RNA from cells, biotin-labeled circPDE5A probes were generated by in vitro transcription. The cell lysate was incubated with the labeled probes to capture the protein complexes that bind to circPDE5A.

[0087] (2) Pretreated streptavidin magnetic beads were used to bind the biotin-labeled probes, and non-specifically bound components were removed by multiple washes to finally obtain highly pure protein complexes.

[0088] (3) After extracting the proteins from the complexes, protein mass spectrometry (MS) technology was used to identify and quantitatively analyze the proteins, and differential proteins that bind to circPDE5A were screened. By integrating the functional information and molecular pathways of the differential proteins, combined with Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis, potential core regulatory genes and related signaling pathways were further predicted.

[0089] The detection results are as Figure 7 shown. The results showed that the biological processes most closely related to these differential proteins were: immune response involving macrophage activation, cytokine response, and metabolic process. Among the differential proteins that bind to circPDE5A, LACC1 is a potential core regulatory gene in the inflammatory response of macrophages activated by wear particles and is closely related to immune response, inflammation, and cytokine expression.

[0090] Furthermore, qPCR technology and WB technology were used to detect the expression of LACC1 after targeting overexpression / knockdown of circPDE5A. The specific steps for qPCR detection are as follows:

[0091] (1) Plasmids for targeting overexpression of mouse circPDE5A and siRNA plasmids for targeting knockdown of mouse circPDE5A (si-circPDE5A#1) were constructed respectively, and a mock vector and negative control siRNA (NC) were used as their controls respectively.

[0092] (2) Total RNA was extracted from macrophages stimulated with Ti particles using the RNAiso Plus kit, and RNA concentration was measured.

[0093] (3) RNA was reverse transcribed into cDNA using the TaKaRa reverse transcription kit. Using GAPDH as an internal reference, qPCR was employed to detect the expression of LACC1 in mouse bone marrow-derived macrophages stimulated with Ti particles at each time point.

[0094] The WB detection steps are as follows:

[0095] (1) 5×10 5 BMDM cells were added to a 6-well plate. After culturing for 24 hours, RIPA buffer lysate (containing 1% PMSF protease inhibitor and 1% phosphatase inhibitor) was added.

[0096] (2) The cells were scraped off with a cell scraper and transferred to a 1.5 mL EP tube. The protein concentration was detected using a BCA protein quantification kit, and 75 μL of protein supernatant was taken for Western blot analysis.

[0097] (3) The stacking gel and separating gel were prepared. The samples to be tested were added to a 12-well polyacrylamide gel, with 30 μg of sample added to each well. After electrophoresis and transfer, the PVDF membrane was blocked with a 5% BSA solution and incubated with the primary antibody overnight on a slow shaker at 4°C. After washing, it was incubated with the secondary antibody solution for 1 hour on a slow shaker at room temperature. Finally, the ECL chemiluminescent chromogenic reagent was added, and appropriate exposure conditions were set to detect protein expression.

[0098] The detection results are as Figure 8 shown. The results showed that after targeted overexpression / knockdown of circPDE5A, there was no significant change in the mRNA level expression of LACC1 in macrophages. However, compared with the control group, targeted overexpression / knockdown of circPDE5A could negatively regulate the protein level of LACC1, indicating that it can directly act on the LACC1 protein.

[0099] Finally, the ELISA technique was used to detect the secretion levels of inflammatory factors in the downstream polyamine metabolism after targeted overexpression / knockdown of LACC1. The specific steps are as follows:

[0100] (1) Plasmids for targeted overexpression of mouse circPDE5A and siRNA plasmids for targeted knockdown of mouse circPDE5A (si-circPDE5A#1) were constructed respectively, and the mock vector (Mock) and negative control siRNA (NC) were used as their respective controls.

[0101] (2) 5×10 5Mouse bone marrow-derived macrophages were seeded into six-well plates and cultured for 24 hours, and then cultured in Opti-MEM I reduced serum medium for 12 hours successively.

[0102] (3) Add 7.5 μl of Lipofectamine RNAiMAX transfection reagent to each well and transfect 200 pmol siRNA. Collect the culture medium supernatant of mouse bone marrow-derived macrophages transfected with the plasmid in each group after Ti particle stimulation, and discard the debris after centrifugation.

[0103] (4) Use an instant enzyme-linked immunosorbent assay (ELISA) kit to measure the expression levels of polyamine metabolites spermidine (Spd), spermine (Spm), and inflammatory factors TNF-α and IL-1β.

[0104] The detection results are as Figure 9 shown. The results show that overexpression / knockdown of LACC1 can positively regulate the secretion levels of downstream spermidine (Spd) and spermine (Spm) induced by Ti particles in macrophages. And targeted knockdown of LACC1 can reverse the inhibitory effect of overexpression of ornithine decarboxylase 1 (ODC1) on the secretion levels of pro-inflammatory factors TNF-α and IL-1β.

[0105] The above results together indicate that targeted knockdown of circPDE5A can increase the expression of LACC1 protein, thereby increasing the polyamine metabolism level mediated by ODC1, further promoting the production of polyamine products, and thus reducing the macrophage inflammatory response.

[0106] Example 4

[0107] By constructing an in vivo model of mouse skull osteolysis and analyzing the alleviating effect of inhibiting circPDE5A on Ti particle-induced osteolysis in vivo through Micro-CT scanning and three-dimensional reconstruction. The method for constructing the in vivo model of mouse skull osteolysis is as follows:

[0108] (1) Anesthetize 8-week-old male mice with 10% chloral hydrate by intraperitoneal injection. After successful anesthesia, make a 15-mm sagittal incision in the midline of the top of the mouse skull to expose the skull, and then use a nerve dissector to scrape the periosteum in the top area of the skull, and place a 0.5×0.5×0.3 cm 3Gelatin sponges of the appropriate size were placed on the skulls for the next specific injection. In the Control group, 100 μL of PBS was injected alone; in the Ti group, 3 mg of titanium particles suspended in 100 μL of PBS was injected locally; in the NC group, 30 μL of PBS, 3 mg of titanium particles, and 70 μL of lentivirus as a negative control were injected locally; in the si-circPDE5A group, 30 μL of PBS, 3 mg of titanium particles, and 70 μL of si-circPDE5A (si-circPDE5A#1) lentivirus were injected locally.

[0109] (2) All mice were observed without death or complications within 7 days after surgery. After 7 days, the mice were euthanized, and the skulls of the mice were removed to clear all soft tissues for further analysis.

[0110] The skulls of the mice were collected and fixed thoroughly with 4% paraformaldehyde for 48 h, and then scanned and analyzed using a high-resolution small animal micro-CT and related software (ZZKS-MicroCT4.1). The relevant micro-CT instrument settings were 60 kV and 667 μA, and 3D image reconstruction was completed using the reconstruction software.

[0111] The analysis results are as Figure 10 shown. The results showed that after micro-CT scanning and 3D reconstruction, the titanium particles induced obvious skull dissolution in mice, and compared with the control group, the injection of lentivirus targeting the inhibition of circPDE5A could significantly inhibit the skull dissolution effect induced by titanium particles.

[0112] As can be clearly seen from the above, the present invention performs high-throughput sequencing of circRNAs on mouse bone marrow-derived macrophages stimulated by Ti particles, discovers and identifies that circPDE5A is significantly highly expressed therein, verifies its high expression around the prosthesis in patients with aseptic loosening, and simultaneously verifies its circularization effect. By detecting its expression in Ti particle-induced macrophages and around the prosthesis in patients with aseptic loosening, it is demonstrated that it has a positive correlation with the occurrence of aseptic loosening. And through RNA Pull-Down experiments and protein mass spectrometry (MS) analysis, differential proteins binding to circPDE5A are screened, and it is predicted that LACC1 is a potential core regulatory gene in the inflammatory response of macrophages activated by wear particles. circPDE5A can affect the regulation of the LACC1 signaling pathway by interacting with LACC1, thereby affecting the inflammatory response of macrophages. Detecting its expression in Ti particle-induced macrophages and around the prosthesis in patients with aseptic loosening demonstrates that it has a positive correlation with the occurrence of aseptic loosening. In addition, through in vivo animal experiments, the results of a mouse calvarial osteolysis model show that injection of lentivirus knocking down circPDE5A can reduce Ti particle-induced osteolysis. Generally speaking, the present invention provides new ideas and a theoretical basis for the research and development of drugs for the treatment of aseptic loosening of artificial joints, and has important clinical value and social significance. Generally speaking, the present invention provides new ideas and a theoretical basis for the research and development of drugs for the treatment of aseptic loosening of artificial joints, and has important clinical value and social significance.

[0113] The above specific implementation part specifically introduces the analysis methods involved in the present invention. It should be noted that the above introduction is only to help those skilled in the art better understand the methods and ideas of the present invention, rather than a limitation on the relevant content. Without departing from the principle of the present invention, those skilled in the art can also make appropriate adjustments or modifications to the present invention, and the above adjustments and modifications should also fall within the protection scope of the present invention.

Claims

1. Use of circPDE5A inhibitors in the preparation of drugs for treating aseptic loosening of artificial joints and / or improving physiological indicators related to aseptic loosening of artificial joints.

2. The use according to claim 1, characterized in that: The physiological indicators related to aseptic loosening of artificial joints are selected from one or more of the following: inflammatory factor levels, macrophage inflammatory response core regulatory factor levels, spermidine levels, spermine levels, ornithine decarboxylase 1 levels, and skull bone dissolution effects.

3. The use according to claim 1, characterized in that: The circPDE5A inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the circPDE5A gene.

4. The use according to claim 3, characterized in that: The circPDE5A inhibitor is selected from siRNA designed based on the circPDE5A gene.

5. The use according to claim 4, characterized in that: The sequence of the siRNA is selected from one or more of SEQ ID NO: 1 and SEQ ID NO:

2.

6. Application of reagents for detecting circPDE5A expression levels in the preparation of products for prognosis assessment of aseptic loosening of artificial joints.

7. The use according to claim 6, characterized in that: The reagent for detecting the expression level of circPDE5A includes a primer pair for specifically detecting the level of circPDEA5.

8. The use according to claim 7, characterized in that: The upstream sequence of the primer pair is shown in SEQ ID NO:3, and the downstream sequence is shown in SEQ ID NO:

4.

9. A pharmaceutical composition for treating aseptic loosening of artificial joints and / or improving physiological indicators related to aseptic loosening of artificial joints, characterized in that: It includes a circPDE5A inhibitor and a pharmaceutically acceptable carrier.

10. The pharmaceutical composition according to claim 9, characterized in that The physiological indicators related to aseptic loosening of artificial joints are selected from one or more of the following: inflammatory factor levels, macrophage inflammatory response core regulatory factor levels, spermidine levels, spermine levels, ornithine decarboxylase 1 levels, and skull bone dissolution effects.

Citation Information

Patent Citations

  • Kit for diagnosing artificial hip joint aseptic loosening

    CN103575877A

  • Application of CY-09 in preparation of medicine for resisting joint prosthesis wear particle induced osteolysis

    CN112245427A

  • Application of DDX3X inhibitor in preparation of medicine for treating sterile looseness of artificial joint

    CN118649238A

  • Therapeutic compositions for repairing chondropathy

    CN1537018A

  • Methods of use of inhibitors of phosphodiesterases and modulators of nitric oxide, reactive oxygen species, and metalloproteinases in the treatment of peyronie's disease, arteriosclerosis and other fibrotic diseases

    US20050085486A1