Screening and application of m6A-dependent proliferation promoting gene

By constructing m6A methylated deletion cell lines and knocking out or overexpressing JTB or ZC3H13 genes, the problem of unclear regulatory mechanisms of m6A deficiency in tumor cell proliferation is solved, and new targets and strategies in regenerative medicine and cancer treatment are achieved, promoting cell proliferation and inhibiting cancer cell growth.

CN120204403APending Publication Date: 2025-06-27SUN YAT SEN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510357653.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-25
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

The regulatory mechanism of the lack of m6A in tumor cell proliferation is unclear in the prior art, and there is a lack of effective targeted therapeutic means to inhibit METTL3-mediated cancer cell proliferation.

Method used

By constructing m6A methylated deletion cell lines and knocking out or overexpressing the JTB or ZC3H13 gene, it was found that its overexpression can promote cell proliferation, and knocking out inhibits cell proliferation, providing new targets and strategies for regenerative medicine and cancer treatment.

Benefits of technology

In regenerative medicine, overexpressing JTB or ZC3H13 genes can accelerate tissue repair and optimize stem cell culture and differentiation; in cancer treatment, knocking out these genes can inhibit cancer cell proliferation and provide new targeted therapeutic options.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120204403A_ABST
    Figure CN120204403A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to screening and application of an m6A-dependent proliferation promoting gene. According to the invention, after STM2457 is utilized to construct an m6A methylation deletion cell line and JTB (NC000001.11) or ZC3H13 (NC000013.11) genes are knocked out or overexpressed, cell proliferation can be obviously promoted by overexpression of the m6A methylation deletion cell line, and cell proliferation can be inhibited after the m6A methylation deletion cell line is knocked out of the JTB (NC000001.11) or ZC3H13 (NC000013.11) genes, so that the two genes are of great significance in the fields of regenerative medicine and cancer treatment. The METTL3 gene can be applied to the regenerative medicine fields of accelerating tissue repair, optimizing stem cell culture and differentiation, assisting nerve and blood vessel regeneration and the like, provides a new gene target for treatment means of organ repair, wound healing and the like, and can also be developed to enhance the inhibition effect on METTL3-mediated tumor cell proliferation by drugs aiming at the genes. And new strategies and drug choices are provided for cancer treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to the screening and application of m6A-dependent proliferation-promoting genes. Background Art

[0002] N6-methyladenosine (m6A), as a highly conserved chemical modification during evolution, is extremely common within the mRNA molecules of eukaryotes and is the most prevalent internal modification form. This modification extensively participates in all stages of the eukaryotic RNA life cycle, playing a crucial role from RNA splicing, nuclear export, to decay, folding, and translation. Recent research has shown that m6A plays important roles in a variety of physiological and pathological scenarios, ranging from embryonic development to human diseases such as cancer. m6A modification is crucial for cell proliferation, and abnormal expression of the key gene METTL3 has been reported in multiple cancer types. As an oncogene, the expression of METTL3 is significantly elevated in lung adenocarcinoma and colorectal adenocarcinoma, and this trend has been repeatedly observed in the Cancer Genome Atlas (TCGA) dataset. Given the important association between m6A modification and METTL3, researchers have focused on developing relevant intervention measures. Currently, a highly efficient and selective METTL3 methyltransferase activity inhibitor, STM2457, has been reported, which can inhibit AML growth in vivo while promoting cell differentiation and apoptosis. These findings fully highlight the great potential of METTL3 as a novel anti-cancer target. However, the current regulatory mechanism of tumor proliferation after m6A deficiency remains unclear. Understanding the impact of m6A deficiency on tumor cell proliferation and identifying the regulatory genes related to m6A-dependent tumor proliferation are of great significance for applying METTL3 to tumor treatment. Summary of the Invention

[0003] To overcome the deficiencies of the above-mentioned prior art, the present invention constructs an m6A methylation-deficient cell line using STM2457 and knocks out or overexpresses the JTB (NC_000001.11) or ZC3H13 (NC_000013.11) gene. It is found that overexpression of these two genes can significantly promote cell proliferation, while knockout of them can inhibit cell proliferation, indicating that these two genes are of great significance in the fields of regenerative medicine and cancer treatment. They can not only provide new gene targets for treatment methods such as organ repair and wound healing in regenerative medicine, but also develop drugs targeting these genes to enhance the inhibition of METTL3-mediated tumor cell proliferation, providing new strategies and drug options for cancer treatment.

[0004] To achieve the above object, the technical solution adopted by the present invention is:

[0005] The first aspect of the present invention provides the use of a reagent for overexpressing gene JTB or ZC3H13 in the preparation of a drug for promoting the proliferation of m6A methylation-deficient cell lines.

[0006] Preferably, the m6A methylation-deficient cell line is an m6A methylation-deficient cell line constructed by inhibiting the activity of METTL3 using STM2457.

[0007] The present invention has found through research that overexpressing gene JTB or ZC3H13 can promote cell proliferation in the m6A methylation-deficient cell line constructed by STM2457, and this discovery is of great significance in the field of regenerative medicine. In tissue repair, when there is skin trauma, it can accelerate the proliferation of skin stem cells and fibroblasts, quickly heal the wound and reduce scars; after bone injury, it can accelerate the proliferation of bone marrow mesenchymal stem cells and their differentiation into osteoblasts, improving the quality of fracture healing. In stem cell therapy, it can optimize stem cell culture and differentiation, increase the number of stem cells and the efficiency of directed differentiation. It can also assist in nerve regeneration, enhance the proliferation and differentiation ability of neural stem cells, and improve the symptoms of nervous system diseases; promote angiogenesis, construct a blood vessel network, and increase the success rate of tissue engineering products.

[0008] The second aspect of the present invention also provides the use of a reagent for knocking out gene JTB or ZC3H13 in the preparation of a drug for inhibiting the proliferation of m6A methylation-deficient cell lines.

[0009] Preferably, the m6A methylation-deficient cell line is an m6A methylation-deficient cell line constructed by inhibiting the activity of METTL3 using STM2457.

[0010] The present invention has found through research that knocking out gene JTB or ZC3H13 can inhibit cell proliferation in the m6A methylation-deficient cell line constructed by STM2457, suggesting that it may antagonize the m6A modification pathway mediated by METTL3 and block the abnormal proliferation signal transduction of cancer cells. Based on this, it is expected to develop new targeted therapeutic drugs or therapies for cancer, precisely act on cancer cells, inhibit their growth, while reducing damage to normal cells, improving the effectiveness and safety of cancer treatment, and bringing new hope to the majority of cancer patients.

[0011] Preferably, the promoter used for overexpression is the CMV promoter.

[0012] Preferably, the reagent for knocking out gene JTB or ZC3H13 is a complex composed of sgRNA and Cas9 protein, wherein sgRNA can specifically recognize and bind to gene JTB or ZC3H13.

[0013] More preferably, the sgRNA for knocking out the JTB gene is as shown in SEQ ID NO:3 or SEQ ID NO:4; the sgRNA for knocking out the ZC3H13 gene is as shown in SEQ ID NO:5 or SEQ ID NO:6.

[0014] The third aspect of the present invention also provides a pharmaceutical composition, which includes a reagent for knocking out the gene JTB or ZC3H13 and STM2457 for inhibiting the activity of METTL3 so as to create an m6A methylation-deficient environment; the pharmaceutical composition is used for inhibiting the proliferation of m6A methylation-deficient cell lines.

[0015] Preferably, the pharmaceutical composition further includes a pharmaceutically acceptable carrier.

[0016] Preferably, the dosage form of the pharmaceutical composition is an injection, tablet, capsule, oral liquid preparation or sustained-release preparation.

[0017] More preferably, the pharmaceutically acceptable carrier includes but is not limited to water, normal saline, phosphate buffer solution, glucose solution, ethanol, polyethylene glycol, gelatin, starch, cellulose and its derivatives, cyclodextrin, liposome, albumin, etc.

[0018] Compared with the prior art, the beneficial effects of the present invention are:

[0019] It has been found through research in the present invention that overexpression of gene JTB or ZC3H13 can promote cell proliferation in the m6A methylation-deficient cell line constructed by STM2457, suggesting that these two genes have important application prospects in the field of regenerative medicine such as accelerating tissue repair, optimizing stem cell culture and differentiation, and facilitating nerve and blood vessel regeneration. The specific application values are as follows: (1) Accelerating tissue repair: Constructing an m6A methylation-deficient cell line using STM2457 and knocking out the JTB or ZC3H13 gene can significantly promote cell proliferation. When the skin is traumatized, the proliferation of skin stem cells and fibroblasts is accelerated, enabling rapid reconstruction of the epidermis and dermis tissues, shortening the wound healing time, and reducing scarring. After bone injury, the proliferation of bone marrow mesenchymal stem cells is enhanced, and the differentiation into osteoblasts is accelerated, promoting the rapid formation of callus and improving the quality of fracture healing. (2) Optimizing stem cell therapy: m6A methylation affects the function of stem cells. Under the condition of m6A methylation deficiency and knockout of the JTB or ZC3H13 gene, the culture and differentiation of stem cells are optimized, and a large number of high-quality stem cells can be obtained quickly. During directed differentiation, it can precisely guide stem cells to differentiate into specific cells, such as efficiently inducing pluripotent stem cells to differentiate into cardiomyocytes, improving the effect of stem cell therapy. (3) Facilitating nerve regeneration: Treating neural stem cells with m6A methylation deficiency and knockout of the JTB or ZC3H13 gene can enhance their proliferation ability and improve the efficiency of differentiation into neurons and glial cells. This is of great significance for nervous system diseases such as spinal cord injury and stroke. Transplanting the treated neural stem cells helps nerve cell regeneration and the reconstruction of conduction pathways, improving the limb motor and sensory functions of patients. (4) Promoting blood vessel regeneration: In the treatment of ischemic diseases such as peripheral artery disease, subjecting vascular endothelial progenitor cells to m6A methylation deficiency and knockout of the JTB or ZC3H13 gene can promote their massive proliferation and accelerate differentiation into mature vascular endothelial cells, constructing a new blood vessel network and improving the blood supply to ischemic tissues. In tissue engineering, using this technology to promote the proliferation of vascular endothelial cells and angiogenesis provides nutrition and oxygen for artificial tissues or organs, improving the success rate of products.

[0020] In addition, it was also found that knocking out gene JTB or ZC3H13 could inhibit cell proliferation in the m6A methylation-deficient cell line constructed by STM2457. Given that the abnormal proliferation of cancer cells is closely related to m6A modification and METTL3, the genes (JTB or ZC3H13) screened in the present invention exhibit great potential for cancer treatment. Many studies have shown that METTL3 is highly expressed in various cancers, promoting the proliferation, invasion and metastasis of cancer cells. However, the genes in the present invention can effectively inhibit cell proliferation in the absence of m6A, suggesting that they may antagonize the m6A modification pathway mediated by METTL3 and block the abnormal proliferation signal transduction of cancer cells. Based on this, it is expected to develop new targeted therapeutic drugs or therapies for cancer, precisely acting on cancer cells, inhibiting their growth, while reducing damage to normal cells, improving the effectiveness and safety of cancer treatment, and bringing new hope to the majority of cancer patients. Brief Description of the Drawings

[0021] Figure 1 It is the detection result of sgRNA for the genome-wide knockout cell line; A is the uniformity of sgRNA reads in different samples (S0d, SC14d, ST14d) (measured by the Gini index); Figure B is the number of missed sgRNAs in these samples (presented as the value after Log10 transformation);

[0022] Figure 2 It is the candidate genes significantly enriched obtained by using MAGECK analysis;

[0023] Figure 3 It is the editing efficiency of genes JTB and ZC3H13;

[0024] Figure 4 It is the proliferation of cells after knocking out genes JTB and ZC3H13;

[0025] Figure 5 It is the proliferation of cells after overexpressing genes JTB and ZC3H13. Detailed Embodiments

[0026] The following further describes the detailed embodiments of the present invention. It should be noted here that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation on the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0027] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and the test materials used in the following embodiments are all commercially available through conventional channels unless otherwise specified.

[0028] Example: Genome-wide screening to identify genes involved in m6A-dependent regulation of cell proliferation

[0029] (1) Lentivirus packaging

[0030] The lentivirus packaging system is a three-plasmid system, consisting of pspax2, pMD2.G and PLentiCRISPRV2 vector plasmids. Lentivirus packaging is completed in HEK293T cells. HEK293T cells are cultured in DMEM medium containing 10% FBS at 37 °C and 5% CO2 concentration.

[0031] The lentivirus packaging process begins with resuscitating HEK 293T cells and culturing them to the third generation. First, 1.6×10 6 cells are seeded in a 6-cm culture dish. Within the next day, the three plasmids are mixed at a mass ratio of pspax2:pMD2.G:PLentiCRISPRV2 = 3:1:4, and the plasmids are transfected into the cells according to the standard transfection procedure (specifically, refer to "Molecular Cloning: A Laboratory Manual"). After 18 hours, the medium is replaced with fresh D10 cell medium. After 48 hours, the culture supernatant is collected. After centrifugation at 4 °C and 500 g for 10 minutes, the supernatant is filtered through a 0.45-μm filter. 1 mL of the supernatant is taken for virus titer determination, and the rest is aliquoted and stored at -80 °C.

[0032] (2) Lentivirus titer determination

[0033] For the determination of lentivirus titer, the antibiotic screening method is used. First, 1×10 5 cells are seeded in a 6-well plate to a density of 50%-60%. The next day, different volumes of virus solution (0 μL to 30 μL) are added to the wells, and D10 cell medium containing 8 μg / mL Ploybrene is added to adjust the total volume of each well to 1.5 mL. After 24 hours, the medium is replaced. After 48 hours, the cells are digested with trypsin, divided into two equal parts, and then seeded into two new 6-well plates, labeled as the control group and the antibiotic treatment group. After 72 hours, Puromycin antibiotic (final concentration of 1 μg / μL) is added to the antibiotic treatment group. When all the cells in the antibiotic treatment group die, the cells in the control group and the antibiotic treatment group are counted. Finally, the virus titer is calculated according to the formula: Virus titer (IFU / mL) = (number of cells in the antibiotic treatment group × initial number of cells) ÷ (number of cells in the control group × volume of virus (in milliliters)).

[0034] (3) Obtaining a genome-wide knockout cell line

[0035] To obtain genome-wide knockout cell lines, follow the detailed lentiviral infection procedure below. First, resuscitate the cryopreserved cells and culture them to the third passage to ensure cell health and stability. Perform the infection in a 10-cm cell culture dish using cells that are no more than six passages old.

[0036] The infection steps are as follows: On the first day, seed 3.5×10 6 cells into each of 22 10-cm culture dishes, for a total of 7.7×10 7 cells. On the second day, calculate the required volume of virus solution based on an MOI (multiplicity of infection) of 0.3 and add Polybrene at a final concentration of 8 μg / mL to 5 mL of D10 cell culture medium to enhance virus infection efficiency. Replace the medium 24 hours later, and after 48 hours, digest the cells with trypsin and passage the cells at a density of 30%. Subsequently, screen the cells with puromycin for 3 to 7 days until all the negative control cells are dead.

[0037] (4) Construct an m6A-deficient cell environment and conduct experimental screening

[0038] To obtain the cell lines for the Treat group and the Control group, divide the cells screened above into two equal parts. Add 7 μM of STM2457 to one part of the cells to create an environment lacking m6A methylation, while add an equal volume of DMSO to the other part as the control group. Continue culturing at a cell density of no more than 80% for 14 days (the Control group is denoted as SC14d, and the Treat group is denoted as ST14d), and collect these two groups of cells separately as the Treat group and the Control group for subsequent comparative analysis of experiments.

[0039] (5) Quality control of genome-wide knockout cell lines

[0040] Extract the genomic DNA of the genome-wide knockout cell line using the Vazyme Genomic DNA Extraction Kit (DC112). Subsequently, perform PCR amplification and purification. During the process of PCR amplification and purification, first prepare the following amplification system: use 5 μg of template DNA, 1 μL of Common primers, 1 μL of Universal Primers, and 25 μL of 2×KAPA HiFi Hot Start Ready Mix (KAPA Biosystems), and finally make up to a total volume of 50 μL with ddH2O. The sequence of Common primers is: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG (SEQ ID NO:1). The specific sequence of Universal Primers is CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCAATTCCCACTCCTTTCAAGACCT (SEQ ID NO:2), where NNNNNNNN in Universal Primers represents the index sequence, which can be replaced with any index sequence suitable for Illumina next-generation sequencing as needed, such as CGGTTCAA.

[0041] Set the conditions for the amplification reaction as follows: pre-denature at 95°C for 3 minutes, then perform 12 to 15 cycles, each cycle including denaturation at 98°C for 20 seconds, annealing at 65°C for 20 seconds, and extension at 72°C for 30 seconds. Finally, extend at 72°C for 2 minutes, and then hold at 4°C waiting for subsequent operations.

[0042] After the amplification is completed, use 1×VAHTS DNA clean beads for purification to obtain a 30 μL purified library. After ensuring that the library concentration is greater than 4 ng / μL and the fragment size is within the range of 200 - 500 bp, send the purified library to a sequencing company and perform high-throughput sequencing on the HiSeqX sequencing platform to obtain the required sequencing data.

[0043] The results of the sequencing data analysis are as Figure 1 A, Figure 1 shown in B, where S0d represents the detection result after knocking out the genome-wide knockout cell line, SC14d represents the detection result of the genome-wide knockout cell line after culturing for 14 days, and ST14d represents the detection result of the genome-wide knockout cell line after culturing for 14 days with STNM2457 treatment. Figure 1A indicates that the sgRNAs in the library are evenly distributed. Figure 1 B indicates that the coverage of sgRNAs in the library is as high as 99%.

[0044] (6) Obtain the sequence information of sgRNAs within each group

[0045] Extract the genomic DNA of the genome-wide knockout cell line using the Vazyme Genomic DNA Extraction Kit (DC112). Subsequently, perform PCR amplification and purification. During the process of PCR amplification and purification, first prepare the following amplification system: use 5 μg of template DNA, 1 μL of Common primers (SEQ ID NO:1), 1 μL of Universal Primers (SEQ ID NO:2), and 25 μL of 2×KAPA HiFi Hot Start Ready Mix (KAPA Biosystems), and finally make up to a total volume of 50 μL with ddH2O.

[0046] The conditions for the amplification reaction are set as follows: pre-denaturation at 95°C for 3 minutes, followed by 12 to 15 cycles, each cycle including denaturation at 98°C for 20 seconds, annealing at 65°C for 20 seconds, and extension at 72°C for 30 seconds. Finally, extend at 72°C for 2 minutes, and then hold at 4°C waiting for subsequent operations.

[0047] After the amplification is completed, use 1×VAHTS DNA clean beads for purification to obtain a 30 μL purified library. After ensuring that the library concentration is greater than 4 ng / μL and the fragment size is in the range of 200 - 500 bp, send the purified library to a sequencing company and perform high-throughput sequencing on the HiSeqX sequencing platform to obtain the required sequencing data.

[0048] The analysis results of the sequencing data are as Figure 1 A, Figure 1 B shown, where SC14d represents the detection results of the control cell line, and ST14d represents the detection results of the treatment cell line. Figure 1 A indicates that the sgRNAs in the library are evenly distributed. Figure 1 B indicates that the coverage of sgRNAs in the library is as high as 99%. The results show that the coverage and uniformity of sgRNAs in each group meet the requirements of the CRISPR screening experiment.

[0049] (7) Use MAGECK to analyze and obtain candidate genes

[0050] For the sgRNA information obtained in the previous step, use the count module in the MAGECK software to perform sgRNA read counting and normalization on each sample in the Treat group and the Control group. The specific commands are as follows:

[0051] mageck count\

[0052] -l library.txt # Information table of all sgRNAs in the library

[0053] -n <output># Output file name

[0054] --sample-label name1,name2,… # Sample name

[0055] --fastq name1_trimmed.fastq.gz name2_trimmed.fastq.gz… # Sequencing data

[0056] After counting and normalizing the sgRNA reads, genes significantly enriched in the CRISPR screen were determined using FDR < 0.05 as the threshold. The results are as Figure 2 shown. Compared with the built-in control in the screening system, after treatment with STM2457, knockout of these genes inhibited cell proliferation in the absence of m6A, including JTB and ZC3H13.

[0057] (8) Construction of candidate gene KO cell lines:

[0058] Using the HuH7 cell line, a CRISPR-Cas9 editing system was used to construct stable cell lines with knockout of candidate genes. The sgRNAs were designed based on the CRISPOR online website. The specific targets and primers are as follows:

[0059]

[0060] The process of constructing stable cell lines was the same as the method described in steps (1) to (3). The specific process was as follows: First, the KO vectors corresponding to the target genes (JTB-1-KO, JTB-2-KO, ZC3H13-1-KO, ZC3H13-2-KO, Nontarget-Control vector) were constructed using the single-fragment one-step ligation cloning method. Then, a lentiviral packaging system was used for virus packaging. In this process, the PLentiCRISPRV2 plasmid used in conventional virus packaging was replaced with the newly constructed vector we developed. After packaging, the obtained virus was used to infect the cells. After the infection was completed, the corresponding stable cell lines were obtained through antibiotic screening.

[0061] To determine the gene editing efficiency, the corresponding PCR primers were used to amplify the targeted editing region, and then the amplified products were sequenced and analyzed by NGS sequencing technology to clarify the editing efficiency. The editing efficiencies of the JTB gene and the ZC3H13 gene are as Figure 3 shown, indicating that the editing efficiencies of both the JTB gene and the ZC3H13 gene are close to 100%, and most of them are edits with 1 bp insertion or 2 bp insertion. The PCR amplification primers are as follows:

[0062] JTB-1:

[0063] F: CTTTCCCTACACGACGCTCTTCCGATCTGAAAGGGGCACATTTTCAGGG (SEQ ID NO:8);

[0064] R: CTTTCCCTACACGACGCTCTTCCGATCTAGGGGAAAAGGTGGGACCAT (SEQ ID NO:9).

[0065] JTB-2:

[0066] F: CTTTCCCTACACGACGCTCTTCCGATCTGAGGCAGCAAAGCAAGACAAC (SEQ ID NO:10);

[0067] R: CTTTCCCTACACGACGCTCTTCCGATCTCTTTGTCGTTCAAAATCTCGTCC (SEQ ID NO:11).

[0068] ZC3H13-1:

[0069] F: CTTTCCCTACACGACGCTCTTCCGATCTGGACTCAGGTGTCCTTGCAC (SEQ ID NO:12);

[0070] R: CTTTCCCTACACGACGCTCTTCCGATCTTGCAGTGAACCACCTACACG (SEQ ID NO:13).

[0071] ZC3H13-2:

[0072] F: CTTTCCCTACACGACGCTCTTCCGATCTGGGGATCTGTTGATCCCTCA (SEQ ID NO:14);

[0073] R: CTTTCCCTACACGACGCTCTTCCGATCTGCCGCCCCGAGGAATAGC (SEQ ID NO:15).

[0074] (9) Experimental verification of the function of candidate genes:

[0075] Resuspend the obtained JTB KO cell line and Non-target control above with D10 complete medium respectively and count, then dilute to 10 5 The cell density of cells / mL, inoculate 100 μL of cells per well in a 96-well plate and simultaneously set up a cell-free blank control group, and inoculate 6 wells for each cell line. On the next day, after the cells are completely adherent, dilute the STM2457 drug to 7 μM with D10 complete medium, add the same volume of DMSO to the control group medium, and replace the original medium with freshly prepared drug-containing D10 medium. 72 h after adding the drug, add 10 μL of CCK8 reagent to each well, incubate at 37 °C for 3 h, and then use a microplate reader to measure the absorbance at 450 nm. Calculate the relative cell density of JTB KO before and after adding the drug and that of the control group before and after adding the drug, and draw a proliferation curve. The relative cell proliferation is as Figure 4 shown, indicating that knocking out the gene JTB can inhibit cell proliferation in the absence of m6A.

[0076] Resuspend and count the above-obtained ZC3H13 KO cell line and Non-target control with D10 complete medium respectively, and dilute to 10 5 cells / mL of cell density, inoculate 100 μL of cells per well in a 96-well plate and simultaneously set up a cell-free blank control group, and inoculate 6 wells for each cell line. On the next day, after the cells are completely adherent, dilute the STM2457 drug to 7 μM with D10 complete medium, add the same volume of DMSO to the control group medium, and replace the original medium with freshly prepared drug-containing D10 medium. 72 h after adding the drug, add 10 μL of CCK8 reagent to each well, incubate at 37 °C for 3 h, and then use a microplate reader to measure the absorbance at 450 nm. Calculate the relative cell density of ZC3H13 KO before and after adding the drug and that of the control group before and after adding the drug, and draw a proliferation curve. The relative cell proliferation is as Figure 4 shown, indicating that knocking out the gene ZC3H13 can inhibit cell proliferation in the absence of m6A.

[0077] (10) Construct overexpressing cell lines of candidate genes:

[0078] Use the lentiviral plasmid to construct a stable overexpressing cell line of the candidate gene in the HuH7 cell line. The promoter sequence of the overexpressing cell line is the CMV promoter (SEQ ID NO:16), and the overexpressed genes are JTB (NC_000001.11) or ZC3H13 (NC_000013.11) respectively.

[0079] SEQ ID NO:16:

[0080] Cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct。

[0081] The process of constructing stable cell lines is the same as the method described in steps (1) to (3). The specific process is as follows: First, use the single-fragment one-step ligation cloning method to construct overexpression vectors (JTB-OE, ZC3H13-OE and Control vectors). Then, use the lentiviral packaging system for virus packaging. In this process, replace the PLentiCRISPR V2 plasmid used in conventional virus packaging with the newly constructed vector we developed. After packaging is completed, use the obtained virus to infect cells. After the infection is completed, through antibiotic screening, the corresponding stable cell lines can be obtained.

[0082] (11) Experimental verification of the function of candidate genes:

[0083] Resuspend the above-obtained JTB OE cell line and Non-target control with D10 complete medium respectively and count, then dilute to 10 5 For a cell density of cells / mL, 100 μL of cells were seeded into each well of a 96-well plate, and a cell-free blank control group was set up simultaneously. Six wells were seeded for each cell line. On the next day, after the cells were completely adherent, the STM2457 drug was diluted to 7 μM with D10 complete medium. The same volume of DMSO was added to the control group medium, and the original medium was replaced with freshly prepared drug-containing D10 medium. At 72 h after adding the drug, 10 μL of CCK8 reagent was added to each well. After incubation at 37 °C for 3 h, the absorbance at 450 nm was measured using a microplate reader. The relative cell density of JTB OE before and after adding the drug and that of the control group before and after adding the drug were calculated, and a proliferation curve was plotted. The relative cell proliferation is as shown in Figure 5 shown, indicating that overexpression of the gene JTB can promote cell proliferation in the absence of m6A.

[0084] The ZC3H13 OE cell line and the Non-target control obtained above were resuspended and counted with D10 complete medium, and diluted to 10 5 cells / mL of cell density. 100 μL of cells were seeded into each well of a 96-well plate, and a cell-free blank control group was set up simultaneously. Six wells were seeded for each cell line. On the next day, after the cells were completely adherent, the STM2457 drug was diluted to 7 μM with D10 complete medium. The same volume of DMSO was added to the control group medium, and the original medium was replaced with freshly prepared drug-containing D10 medium. At 72 h after adding the drug, 10 μL of CCK8 reagent was added to each well. After incubation at 37 °C for 3 h, the absorbance at 450 nm was measured using a microplate reader. The relative cell density of ZC3H13 OE before and after adding the drug and that of the control group before and after adding the drug were calculated, and a proliferation curve was plotted. The relative cell proliferation is as shown in Figure 5 shown, indicating that overexpression of the gene ZC3H13 can promote cell proliferation in the absence of m6A.

[0085] The above results show that overexpression of the gene JTB or ZC3H13 can promote cell proliferation in the m6A methylation-deficient cell line constructed by STM2457. This finding is expected to accelerate tissue repair, optimize stem cell culture and differentiation, facilitate nerve and blood vessel regeneration, and provide new research models and targets in regenerative medicine, bringing new breakthroughs to regenerative therapy. At the same time, knocking out the gene JTB or ZC3H13 can inhibit cell proliferation in the m6A methylation-deficient cell line constructed by STM2457, indicating that these two genes can also be used to develop drugs targeting these genes to enhance the inhibition of METTL3-mediated tumor cell proliferation, providing new strategies and drug options for cancer treatment.

[0086] The above has described the embodiments of the present invention in detail, but the present invention is not limited to the described embodiments. For those skilled in the art, without departing from the principle and spirit of the present invention, various changes, modifications, substitutions, and variations made to these embodiments still fall within the protection scope of the present invention.< / output>

Claims

1. Use of reagents that overexpress genes JTB or ZC3H13 in the preparation of drugs that promote the proliferation of m6A methylation-deficient cell lines.

2. Use of reagents for knocking out genes JTB or ZC3H13 in the preparation of drugs for inhibiting the proliferation of m6A methylation-deficient cell lines.

3. The use according to claim 1 or 2, characterized in that: The m6A methylation-deficient cell line is an m6A methylation-deficient cell line constructed by using STM2457 to inhibit METTL3 activity.

4. The use according to claim 1, characterized in that: The promoter used for overexpression was the CMV promoter.

5. The use according to claim 2, characterized in that: The reagent for knocking out the gene JTB or ZC3H13 is a complex composed of sgRNA and Cas9 protein, wherein the sgRNA can specifically recognize and bind to the gene JTB or ZC3H13.

6. The use according to claim 5, characterized in that: The sgRNA for knocking out the JTB gene is shown in SEQ ID NO: 3 or SEQ ID NO: 4; the sgRNA for knocking out the ZC3H13 gene is shown in SEQ ID NO: 5 or SEQ ID NO:

6.

7. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises an agent for knocking out the genes JTB or ZC3H13 and STM2457 for inhibiting the activity of METTL3 to create an m6A methylation-deficient environment; the pharmaceutical composition is used to inhibit the proliferation of m6A methylation-deficient cell lines.

8. A pharmaceutical composition according to claim 7, characterized in that: The pharmaceutical composition also includes a pharmaceutically acceptable carrier.

9. A pharmaceutical composition according to claim 8, characterized in that: The dosage form of the pharmaceutical composition is injection, tablet, capsule, oral liquid preparation or sustained-release preparation.