Molecular markers linked to yellow peel of bitter melon and their application
By developing a CAPS molecular marker that is closely linked to the yellow peel of bitter melon and using PCR amplification and enzyme cutting technology, the problem of low efficiency of peel color selection in traditional breeding was solved, and early accurate identification and efficient breeding were achieved.
Patent Information
- Application Number
- CN202510695149.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-28
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2045-05-28
AI Technical Summary
In traditional bitter melon breeding, peel color selection is inefficient and inaccurate, making it difficult to accurately identify the yellow peel trait in the early stages.
A CAPS molecular marker tightly linked to the yellow peel of bitter melon was developed. PCR amplification and restriction endonuclease XhoI digestion, combined with electrophoresis analysis, were used to achieve early identification of bitter melon seed or seedling DNA.
The breeding efficiency of bitter melon varieties with yellow peel was improved, the breeding cycle was shortened, the manpower and resource costs were reduced, and the results were intuitive and easy to analyze.
Smart Images

Figure CN120210424B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of molecular breeding, and in particular to a molecular marker linked to the yellow peel of bitter melon and application thereof. Background Art
[0002] Momordica charantia( Momordica charantia Bitter melon (Momordica charantia L.), also known as bitter melon or bitter melon, is an annual vine of the genus Momordica charantia in the Cucurbitaceae family, primarily cultivated in tropical and subtropical regions. Bitter melon is not only rich in vitamins and amino acids, but also contains numerous active chemical components with high medicinal value, earning it the reputation of a "medicinal vegetable." Bitter melon has numerous benefits, including antiviral, anti-tumor, and blood sugar-lowering properties. With increasing awareness of healthy eating, market demand for bitter melon and the area of its cultivation have increased significantly.
[0003] Peel color is a key quality trait in bitter melon, influencing consumer purchasing decisions and breeder decisions. Bitter melon peel colors primarily fall into white, light green, and green. Bitter melons grown in South Asia typically have green peels, while those grown in Southeast Asia tend to be white or light green. Different consumers have varying preferences for bitter melon peel color.
[0004] Traditional methods for identifying bitter melon fruit color rely primarily on phenotypic selection, requiring observation and screening during the fruiting or even ripening stages. This is not only time-consuming and labor-intensive, but also inefficient. In recent years, molecular marker technology has been widely used in crop genetics and breeding. CAPS (Cleaved Amplified Polymorphic Sequence) markers, or Cleaved Amplified Polymorphic Sequence markers, are a molecular marker method based on PCR and restriction endonuclease digestion. They offer advantages such as simplicity, stability, high reproducibility, and easy analysis of results, and have been applied in genetics and breeding of various crops. By identifying CAPS molecular markers that are closely linked to the yellow peel trait of bitter melon, breeders can accurately predict and screen for peel color traits in bitter melon plants during their early growth stages, even at the seed stage, significantly improving breeding efficiency and shortening the breeding cycle.
[0005] Currently, there are no reports of CAPS molecular markers that are tightly linked to the yellow peel trait in bitter melon. Therefore, developing a CAPS molecular marker that is tightly linked to the yellow peel trait in bitter melon and clarifying its application in bitter melon breeding is of great practical significance for the screening, improvement, and innovation of bitter melon varieties. Summary of the Invention
[0006] In view of the shortcomings of the existing technology, the present invention aims to provide a molecular marker linked to the yellow peel of bitter melon, as well as the application of the molecular marker in the early identification and assisted breeding of the yellow peel trait of bitter melon, so as to solve the problems of low efficiency and poor accuracy of peel color selection in traditional bitter melon breeding, and improve the breeding efficiency of bitter melon varieties with yellow peel.
[0007] The technical solutions of the present invention are as follows:
[0008] A molecular marker, a molecular marker detection reagent, or a molecular marker detection kit is used to identify yellow bitter melon peel. The molecular marker has a nucleotide sequence as shown in SEQ ID NO. 1. The 199th base of the sequence shown in SEQ ID NO. 1 is a single-nucleotide polymorphism (SNP) site with a G / A base mutation. In yellow bitter melon peel, the SNP site is A. The nucleotide sequence has a specific restriction endonuclease XhoI recognition site, CTCGAG.
[0009] Furthermore, the detection reagent includes primers for amplifying molecular markers and restriction endonuclease XhoI.
[0010] Furthermore, the detection reagent also includes 2×Hieff ® PCR Master Mix, ddH2O.
[0011] Furthermore, the nucleotide sequence of the upstream primer of the primer is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the primer is shown as SEQ ID NO.4.
[0012] Furthermore, the application is: using bitter melon genomic DNA as a template, using the primers to perform PCR amplification, using the restriction endonuclease XhoI to digest the PCR product, and performing electrophoresis. When a 460 bp band is generated, it is a bitter melon with non-yellow peel; when only 195 bp and 265 bp bands are generated simultaneously, it is a bitter melon with yellow peel.
[0013] On the other hand, the present invention also provides a method for identifying the yellow peel trait of bitter melon, the method comprising the following steps:
[0014] Using momordica charantia genomic DNA as a template, PCR amplification is performed using primers for amplifying the molecular marker, and the PCR amplification product is digested with restriction endonuclease XhoI and then subjected to electrophoresis;
[0015] When a 460 bp band is produced, it is a bitter melon with a non-yellow peel. When only 195 bp and 265 bp bands are produced simultaneously, it is a bitter melon with a yellow peel.
[0016] Furthermore, the bitter melon genomic DNA is derived from bitter melon seeds, bitter melon plants and / or bitter melon fruits.
[0017] Furthermore, each 20 μL PCR reaction system contains: 10 μL 2×Hieff ® PCR Master Mix: 0.5 μL of forward and reverse primers, 1 μL of DNA, and 8 μL of ddH2O.
[0018] Furthermore, the PCR amplification program was as follows: pre-denaturation at 95 °C for 5 min; 35 cycles of denaturation at 95 °C for 20 s, annealing at 55 °C for 40 s, and extension at 72 °C for 30 s; extension at 72 °C for 5 min, and holding at 12 °C for 5 min.
[0019] Furthermore, the enzyme digestion temperature was 37°C and the enzyme digestion was carried out overnight.
[0020] On the other hand, the present invention provides a molecular-assisted breeding method for bitter melon varieties with yellow peel, comprising screening bitter melon breeding materials using the aforementioned method for identifying the yellow peel trait of bitter melon, and selecting materials with yellow peel traits for subsequent breeding.
[0021] Compared with the prior art, the present invention has the following advantages:
[0022] Molecular markers are detected based on differences in DNA levels and are not affected by environmental factors. They can accurately identify the yellow peel trait of bitter melon, avoiding misjudgment caused by environmental influences in traditional phenotypic identification and improving the accuracy and reliability of selection.
[0023] Using this molecular marker, DNA can be extracted for testing at the seedling stage, or even the seed stage, after bitter melon seeds germinate, to determine the color characteristics of the bitter melon peel in advance without having to wait for the fruit to mature. This greatly shortens the breeding cycle, improves breeding efficiency, and saves land and resource costs.
[0024] The operational process of CAPS molecular markers is relatively simple. The required experimental equipment and reagents are easily obtained in general molecular biology laboratories. The results can be intuitively presented through conventional electrophoresis analysis, which is easy to promote and apply in breeding practice, and will help promote the selection and breeding of bitter melon varieties with yellow peel. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 : Y52 and M2750 fruit photos.
[0026] Figure 2Electrophoresis of the F2 generation of Y45 and Y45 / M2750 hybrids after PCR and enzyme digestion. 2kb DNA Marker is the "2kb DNA Standard Reference Material."
[0027] Figure 3 : Electrophoresis of Y52 and F2 generation of hybridization of Y52 and M2750 after PCR and enzyme digestion. DETAILED DESCRIPTION
[0028] In order to better understand the technical content of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.
[0029] Example 1
[0030] Y52 is a germplasm resource collected by the bitter melon research team of the Chinese Academy of Tropical Agricultural Sciences. It is a high-generation inbred line obtained through eight generations of single-seed propagation. Using ethyl methanesulfonate (EMS) as a mutagen (for specific methods, see "A Method for Mutagenizing Bitter Melon Mutants," Patent No. ZL 2022 1 0762651.9), bitter melon Y52 seeds were induced to screen out a bitter melon mutant M2750 with yellow peel ( Figure 1 MutMap analysis revealed that a G-to-A mutation at position 199 in SEQ ID NO. 2 is responsible for the yellow peel of bitter melon. Further analysis of the mutation revealed that mutant M2750 harbors an XhoI restriction site (CTCGAG, the sequence containing this site is shown in SEQ ID NO. 1), while Y52 harbors a CTCGGG site (the sequence containing this site is shown in SEQ ID NO. 2), lacking an XhoI restriction site. Primers McEGY1-371F (CGCCGAATTTGTCTCCAATTG) (SEQ ID NO. 3) and McEGY1-806R (GACGCAATTCCTAACTCCACAGAGG) (SEQ ID NO. 4) were designed upstream and downstream of this site, respectively. Using Y52 and M2750 as templates, a 460 bp PCR product was amplified. The amplified product was added with the endonuclease XhoI. The amplified product with Y52 as the template could not be cut by XhoI, while the amplified product with M2750 as the template was cut into two segments with sizes of 195 bp and 265 bp respectively. Therefore, the present invention developed a CAPS molecular marker based on the endonuclease XhoI. M2750 .
[0031] SEQ ID NO.1:
[0032] CGCCGAATTTGTCTCCAATTGGACCAGCTTACAATAACTTCCAAGTCGATTCTTTCAAACTGATGGAACTTCTTGGGCCCGAGAAGGTTGATCCTTCTGACGTCAAACTTATAAAGGACAAGCTTTTTGGCTATTCTACCTTCTGGGTAACCAAAGAAGAACCATTTGGAGATCTTGGGGAGGGCATTCTCTTCCTCG A GAATTTAAGAGGAAACAGAGAAGAGGTATTCTCCAAACTCCAAGGCCAGTTGGTTGAAGCCACAGGTGATAAATACAACCTTTTTATGGTGGAGGAACCAAATTCAGAAGGTCCAGATCCACGCGGTGGCCCACGTATCAGTTTTGGTCTGTTGCGAAAAGAGGTCTCAGAACCTGGTCCAACAACACTTTGGCAATATGTTATTGCTCTGTTGTTGTTCCTTTTAACAATTGGCTCCTCTGTGGAGTTAGGAATTGCGTC
[0033] SEQ ID NO.2:
[0034] CGCCGAATTTGTCTCCAATTGGACCAGCTTACAATAACTTCCAAGTCGATTCTTTCAAACTGATGGAACTTCTTGGGCCCGAGAAGGTTGATCCTTCTGACGTCAAACTTATAAAGGACAAGCTTTTTGGCTATTCTACCTTCTGGGTAACCAAAGAAGAACCATTTGGAGATCTTGGGGAGGGCATTCTCTTCCTCG GGAATTTAAGAGGAAACAGAGAAGAGGTATTCTCCAAACTCCAAGGCCAGTTGGTTGAAGCCACAGGTGATAAATACAACCTTTTTATGGTGGAGGAACCAAATTCAGAAGGTCCAGATCCACGCGGTGGC CCACGTATCAGTTTTGGTCTGTTGCGAAAAGAGGTCTCAGAACCTGGTCCAACAACACTTTGGCAATATGTTATTGCTCTGTTGTTGTTCCTTTTAACAATTGGCTCCTCTGTGGAGTTAGGAATTGCGTC
[0035] Example 2
[0036] Y52 and Y45 are germplasm resources collected by the bitter melon research group of the Chinese Academy of Tropical Agricultural Sciences. They are high-generation self-pollinated pure lines obtained through 8 generations of single-seed transmission and have green peels. The mutant M2750 was hybridized with Y52 and Y45. The peel color of the F1 generation was all green, and in the F2 generation, the individual plants with yellow peels accounted for 1 / 4 of the total number of plants. 23 individual plants with yellow peels were selected from the two F2 generation populations, and DNA was extracted from Y52, Y45 and F2 generation populations, and PCR amplification and enzyme digestion were performed (for specific methods, refer to Example 3). The results showed that, except for Y52 and Y45, the amplified products of the yellow individual plants in the F2 generation population could be digested by XhoI into fragments of 265bp and 195bp, and the consistency rate between genotype and phenotype was 100% ( Figure 2 and Figure 3 ), indicating that CAPS M2750 It is a molecular marker linked to the yellow peel of bitter melon, and this molecular marker can be used to identify bitter melon with yellow peel.
[0037] Example 3
[0038] Methods for identifying yellow-skinned bitter melon:
[0039] (1) Use the CTAB method to extract bitter melon DNA (DNA from bitter melon plants, seeds, or fruits) and adjust the DNA concentration to 50 ng / μL.
[0040] (2) Primers McEGY1-371F: CGCCGAATTTGTCTCCAATTG and McEGY1-806R: GACGCAATTCCTAACTCCACAGAGG were synthesized at Shanghai Sangon Biotechnology Co., Ltd. and diluted to 10 μM. PCR amplification was performed using genomic DNA as a template using the above primer pairs.
[0041] (3) PCR reaction system: 20 μL: 10 μL 2×Hieff ® PCR Master Mix (Shanghai Yisheng Biotechnology Co., Ltd.), forward and reverse primers 0.5 μL, DNA 1 μL, ddH2O 8 μL.
[0042] (4) PCR amplification program: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 20 s, annealing at 55 °C for 40 s, extension at 72 °C for 30 s, 35 cycles; extension at 72 °C for 5 min, and 12 °C for 5 min.
[0043] (5) Add 0.5 μL of endonuclease XhoI to the PCR product and digest at 37°C overnight.
[0044] (6) The enzyme digestion products were subjected to agarose gel electrophoresis analysis. The electrophoresis bands were used to distinguish whether the sample had yellow peel. If only the 265 bp and 195 bp bands appeared simultaneously, the bitter melon had yellow peel. If the 460 bp band appeared, the bitter melon did not have yellow peel.
[0045] The above descriptions are only some embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall fall within the scope of protection of the present invention.
Claims
1. The application of a molecular marker detection reagent in identifying yellow peel of bitter melon is characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.
1. The 199th base of the sequence shown in SEQ ID NO. 1 is a SNP site. The SNP site has a G / A base mutation, and the SNP site is A in the yellow peel. The bitter melon variety is bitter melon Y52, bitter melon mutant M2750, or the F2 generation of the hybrid of the two.
2. The use according to claim 1, characterized in that The detection reagent includes primers for amplifying molecular markers and restriction endonuclease XhoI; the nucleotide sequence of the upstream primer of the primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the primer is shown in SEQ ID NO.
4.
3. The use according to claim 2, characterized in that Using bitter melon genomic DNA as a template, PCR amplification is performed using the primers, and the PCR product is digested with the restriction endonuclease XhoI and subjected to electrophoresis. When a 460 bp band is generated, it is a bitter melon with a non-yellow peel; when only 195 bp and 265 bp bands are generated simultaneously, it is a bitter melon with a yellow peel.
4. A method for identifying the yellow peel trait of bitter melon, characterized in that: The following steps are involved: Using momordica charantia genomic DNA as a template, PCR amplification is performed using primers for amplifying the molecular marker according to claim 1, and the PCR amplification product is digested with restriction endonuclease XhoI and then subjected to electrophoresis; the nucleotide sequence of the upstream primer of the primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the primer is shown in SEQ ID NO.4; When a 460 bp band is produced, it is a bitter melon with a non-yellow peel; when only 195 bp and 265 bp bands are produced simultaneously, it is a bitter melon with a yellow peel; The nucleotide sequence of the molecular marker is shown in SEQ ID NO.
1. The 199th base of the sequence shown in SEQ ID NO. 1 is a SNP site. The SNP site has a G / A base mutation, and the SNP site is A in the yellow peel. The bitter melon variety is bitter melon Y52, bitter melon mutant M2750, or the F2 generation of the hybrid of the two.
5. The method according to claim 4, characterized in that The bitter melon genomic DNA is derived from bitter melon seeds, bitter melon plants and / or bitter melon fruits.
6. The method according to claim 4, characterized in that Each 20 μL PCR reaction system contains: 10 μL 2×Hieff PCR Master Mix, 0.5 μL forward and reverse primers, 1 μL DNA, and 8 μL ddH2O.
7. The method according to claim 4, characterized in that PCR amplification program: pre-denaturation at 95 °C for 5 min; 35 cycles of denaturation at 95 °C for 20 s, annealing at 55 °C for 40 s, and extension at 72 °C for 30 s; extension at 72 °C for 5 min, and hold at 12 °C for 5 min.
8. A molecular-assisted breeding method for bitter melon with yellow peel, characterized in that: The method comprises screening bitter melon breeding materials using the method for identifying the yellow peel trait of bitter melon according to any one of claims 4 to 7, selecting materials with the yellow peel trait for subsequent breeding, and the bitter melons to be screened are bitter melon Y52, bitter melon mutant M2750, or the F2 generation of a hybrid of the two.
Citation Information
Patent Citations
Mutagenesis method of bitter gourd mutant
CN115104401A
Molecular marker associated with bitter gourd peel color and application thereof
CN116497148A
SNP (Single Nucleotide Polymorphism) molecular marker linked with w gene and used for identifying color of cucumber peel and application of SNP molecular marker
CN117144039A