Reaction system for preparing DNA nanospheres and application thereof

CN120225670APending Publication Date: 2025-06-27MGI TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202280101711.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2022-11-07
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

In existing gene sequencing technology, the DNA nanosphere (DNB) library preparation process is cumbersome, requires multiple steps, and has low DNA utilization efficiency. Especially for trace amounts of DNA samples, PCR amplification is required, resulting in amplification errors and deviations.

Method used

A reaction system containing a special linker structure and temperature control is used to realize linker ligation, circularization and DNB preparation in a single system, reducing steps, improving DNA utilization efficiency, and avoiding PCR amplification steps to retain the original information of nucleic acids to the greatest extent.

Benefits of technology

It simplifies the library preparation steps, improves the utilization efficiency of DNA, meets the library construction requirements of trace amounts of nucleic acids, and reduces library bias and sequencing errors caused by PCR amplification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120225670A_ABST
    Figure CN120225670A_ABST
Patent Text Reader

Abstract

Provided is a reaction system for preparing DNA nanospheres (DNB), comprising: a linker; an enzyme, wherein the enzyme comprises a DNA ligase; the linkers comprise a linker A and a linker B, the linker A comprises a first chain and a second chain, the first chain comprises a sequence a, the second chain comprises a sequence a'and a sequence b, and the sequence a and the sequence a 'are complementarily paired; and the linker B comprises a third strand and a fourth strand, the third strand comprises a sequence c and a sequence e, the fourth strand comprises a sequence e ', a sequence f and a sequence b', the sequence b is complementarily paired with the sequence c, the sequence e is complementarily paired with the sequence e ', and the sequence b is complementarily paired with the sequence b'.
Need to check novelty before this filing date? Find Prior Art

Description

Reaction system for preparing DNA nanospheres and its application Technical Field

[0001] The present application relates to the field of gene sequencing technology, and in particular to a reaction system for preparing DNA nanoballs (DNBs) and applications thereof. Background Art

[0002] With the development of high-throughput sequencing technology, gene sequencing has become an important tool in life science research. Gene sequencing is generally based on preparing a library based on the nucleic acid to be tested, which is then sequenced. Library preparation requires multiple steps, including nucleic acid fragmentation, end-repair, end-addition of A fragments, adapter ligation, and PCR amplification. This complex, time-consuming, and labor-intensive process has, to a certain extent, restricted the large-scale application of gene sequencing technology.

[0003] The DNBSEQ sequencer launched by MGI uses DNA nanoballs (DNBs) generated by rolling circle linear amplification as sequencing units. It uses linear amplification to amplify the base signals of the target fragments. Unlike bridge PCR amplification, it does not cause the accumulation of amplification errors, so it has higher accuracy during sequencing. The current library preparation process of the DNBSEQ platform includes 6 independent steps, namely nucleic acid fragmentation, end repair and end A addition, adapter connection, PCR amplification, library circularization and DNB preparation. Compared with the conventional library preparation methods of other platforms, it has an additional circular library preparation process. Although the sequencing accuracy of DNBSEQ has been improved, its library preparation process is also more complicated, and the burden of sample pre-processing is heavier.

[0004] Furthermore, conventional library preparation involves many steps, and some later steps in DNB preparation, such as circularization, have low DNA utilization efficiency, requiring a large amount of DNA input to meet the final instrument requirements. Furthermore, even trace amounts of DNA require PCR to meet instrument requirements.

[0005] Therefore, there is an urgent need to provide a DNB library preparation method with fewer steps, simple operation and high DNA utilization efficiency.

[0006] Summary of the Invention

[0007] The embodiments of the present application provide a reaction system for preparing DNA nanoballs (DNBs) and its application in sequencing, a method for preparing DNBs in a single system, a kit, and a sequencing method.

[0008] In a first aspect, an embodiment of the present application proposes a reaction system for preparing DNA nanoballs (DNBs), comprising: a linker; an enzyme, wherein the enzyme comprises a DNA ligase; and a buffer, wherein the linker comprises a linker A and a linker B, the linker A comprises a first chain and a second chain, the first chain comprises a sequence a, the second chain comprises a sequence a' and a sequence b, wherein the sequence a and sequence a' are complementary pairs; and the linker B comprises a third chain and a fourth chain, the third chain comprises a sequence c and a sequence e, the fourth chain comprises a sequence e', a sequence f and a sequence b', wherein the sequence b' is complementary pairs with the sequence c, the sequence e is complementary pairs with the sequence e', and the sequence b is complementary pairs with the sequence b'.

[0009] In some embodiments, the 3' end of the first strand of the adapter A further comprises a base T, and the base T protrudes to form a sticky T end.

[0010] In some embodiments, the 3' end of the third strand of the adapter B further comprises a base T, and the base T protrudes to form a sticky T end.

[0011] In some embodiments, the 5' ends of the first chain of linker A, the second chain of linker A, and the fourth chain of linker B are phosphorylated.

[0012] In some embodiments, the first Tm value of sequence e and sequence e' proximal to the cohesive T-terminus of the third strand of linker B is higher than the second Tm value of sequence b' and sequence c distal to the cohesive T-terminus of the third strand of linker B. In some embodiments, the first Tm value of sequence e and sequence e' is 45 to 70°C; the second Tm value of sequence b' and sequence c is 30 to 40°C; and the third Tm value of sequence b' and sequence b is 45 to 70°C.

[0013] In some embodiments, the sequence b' is partially complementary to the sequence c, and the sequence b' is completely complementary to the sequence b.

[0014] In some embodiments, the sequence length of the sequence c is shorter than the sequence length of the sequence b'.

[0015] In some embodiments, the third strand further comprises a sequence d, wherein the sequence d is located between sequence c and sequence e. In some embodiments, the sequence f further comprises a sample tag sequence. In some embodiments, the sequence f does not match the sequence d.

[0016] In some embodiments, the length of sequence b and sequence b' is 8-20bp. In some embodiments, the length of sequence c is 3-15bp. In some embodiments, the length of sequence e is 10-25bp, and the length of sequence e' is 3-24bp. In some embodiments, the length of sequence e' is 9-24bp.

[0017] In some embodiments, the ligation temperature of the DNA ligase is 12 to 70° C. In some embodiments, the DNA ligase is T4 DNA ligase and / or Taq DNA ligase.

[0018] In some embodiments, the buffer comprises Tris-HCl, Mg 2+ , DTT and ATP. In some embodiments, the pH value of the buffer is between 4.0 and 9.0. In some embodiments, the buffer contains 5-500mM Tris-HCl, 1-500mM Mg 2+ , 1-50 mM DTT and 1-50 mM ATP. In some embodiments, wherein the Mg 2+ Derived from MgCl2.

[0019] In some embodiments, the enzyme further comprises a DNA polymerase. In some embodiments, the reaction temperature of the DNA polymerase is 30 to 70° C. In some embodiments, the DNA polymerase is selected from any one of the following or a combination thereof: Phi29 DNA polymerase, Bst DNA polymerase, and Bsm DNA polymerase.

[0020] In some embodiments, the buffer further comprises K + NH4 + , NAD and dNTP. In some embodiments, the buffer further comprises 1-500mM K + 1-500mM NH4 + , 1-50 mM NAD and 1-50 mM dNTP.

[0021] In some embodiments, the first chain sequence is shown as SEQ ID NO: 1; the second chain sequence is shown as SEQ ID NO: 2; the third chain sequence is shown as SEQ ID NO: 5; and the fourth chain sequence is shown as SEQ ID NO: 7.

[0022] The second embodiment of the present application proposes a method for preparing DNBs in a single system, comprising: contacting the reaction system for preparing DNBs described in any embodiment of the first aspect of the present application with a DNA to be tested; connecting the DNA to be tested to a linker at a first temperature to form a linker A-DNA-linker B product; cyclizing the linker A-DNA-linker B product at a second temperature to form a cyclized product; and performing rolling circle amplification on the cyclized product at a third temperature to obtain DNBs.

[0023] In some embodiments, the 3' end of the DNA to be tested has a sticky A terminus. In some embodiments, the DNA to be tested is DNA obtained by adding A to the 3' end and / or natural DNA having a sticky A terminus at the 3' end. In some embodiments, the 5' end of the DNA to be tested is phosphorylated.

[0024] In some embodiments, at a first temperature, the DNA to be tested is connected to a connector to form a connector A-DNA-connector B product, comprising: at the first temperature, under the action of DNA ligase, the sticky A end at the 3' end of the DNA to be tested is respectively connected to the sticky T end of the connector A and the sticky T end of the connector B to form a connector A-DNA-connector B product.

[0025] In some embodiments, the first temperature is 12 to 37° C. In some embodiments, the first temperature is 12 to 25° C.

[0026] In some embodiments, at the second temperature, the adapter A-DNA-adapter B product is cyclized to form a cyclized product, comprising: at the second temperature, the sequence b' of the fourth strand of the adapter B is melted to form a single strand, and then combined with the sequence b of the second strand of the adapter A to form a quasi-circular product. In some embodiments, further, under the action of the DNA ligase, the sequence b' of the fourth strand of the adapter B is connected to the sequence a of the second strand of the adapter A to form a cyclized product.

[0027] In some embodiments, the second temperature is 37 to 70°C. In some embodiments, the second temperature is 37 to 65°C.

[0028] In some embodiments, at the third temperature, under the action of DNA polymerase, the circularized product is subjected to rolling circle amplification to obtain DNB.

[0029] In some embodiments, the third temperature is 30 to 70°C.

[0030] In some embodiments, the second temperature is the same as the third temperature.

[0031] In some embodiments, the method for preparing DNBs in a single system further comprises: nucleic acid fragmentation and optionally end repair and end A addition to obtain the DNA to be tested.

[0032] The third aspect of the present application provides a kit comprising a reaction system for preparing DNBs as described in any embodiment of the first aspect of the present application. In some embodiments, the kit further comprises a sequencing primer. In some embodiments, the second strand of adapter A is bound to all or part of sequencing primer sequence 1 for sequencing. In some embodiments, sequence e' and a partial sequence f of the fourth strand of adapter B are bound to sequencing primer sequence 2 for sequencing. In some embodiments, sequence f further comprises a sample tag sequence.

[0033] The fourth embodiment of the present application proposes an application of a reaction system for preparing DNB as described in any embodiment of the first aspect of the present application in sequencing.

[0034] The fifth embodiment of the present application proposes a sequencing method, comprising: preparing DNBs according to the method for preparing DNBs in a single system as described in any embodiment of the second aspect of the present application; and performing DNB-SEQ sequencing on the DNBs.

[0035] This application achieves the following technical effects:

[0036] The DNB preparation reaction system and method in the embodiments of the present application, through a special linker structure and temperature setting, can perform linker ligation, circularization and DNB preparation in one reaction system, thereby greatly reducing the steps of library preparation, improving the utilization efficiency of DNA, and meeting the needs of library construction of trace nucleic acids; and this method does not involve a PCR amplification step after linker ligation and before library circularization, so the original information of the nucleic acid can be obtained to the greatest extent, eliminating the library bias caused by PCR amplification. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0038] FIG1 is a schematic diagram of the reaction principle for preparing DNB according to an embodiment of the present application;

[0039] FIG2 is a schematic diagram of the binding position of sequencing primers according to an embodiment of the present application. DETAILED DESCRIPTION

[0040] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0041] This application is made based on the following knowledge of the inventors:

[0042] In related technologies, DNBSEQ library preparation requires three separate steps: adapter ligation, circularization, and DNB preparation. This is cumbersome and time-consuming. Furthermore, after end-repair and end-addition, microsamples often require PCR amplification to meet the loading requirements for the instrument. This PCR step can introduce additional amplification bias and errors.

[0043] Based on this, the inventors have developed a system and method after multiple experiments and tests that can perform linker ligation, circularization and DNB preparation in one reaction system, thereby greatly reducing the steps of library preparation, simplifying experimental operations, and also improving the utilization efficiency of DNA, which can meet the needs of library construction of trace nucleic acids; and the invented method does not involve an amplification step before the circularization step, thereby ensuring the original information of the nucleic acid to the greatest extent, avoiding the library deviation caused by the PCR amplification process, and thus reducing the impact of library amplification errors or bias on sequencing.

[0044] The reaction system for preparing DNBs proposed in the examples of this application is compatible with room-temperature DNA ligases (such as T4 DNA ligase) and DNA polymerases with displacement activity (such as Phi29 / BST). At the same time, based on a special linker design, different reactions such as linker ligation, DNA circularization, and rolling circle amplification (DNB preparation) can be completed in the same reaction system through temperature control. This eliminates the need for experimental operation steps such as tube transfer, simplifies the experimental process, and effectively reduces labor and time costs.

[0045] In an embodiment of the present application, a reaction system for preparing DNA nanoballs (DNBs) may include: a linker, an enzyme, and a buffer. Figure 1 is a schematic diagram of the reaction principle for preparing DNBs according to an embodiment of the present application. As shown in Figure 1, in some embodiments, the enzyme in the reaction system may include DNA ligase; the linker includes a linker A and a linker B, wherein linker A includes a first chain A1 and a second chain A2, wherein the first chain A1 (hereinafter referred to as A1) specifically includes sequence a, and the second chain A2 (hereinafter referred to as A2) includes sequence a' and sequence b, wherein sequence a and sequence a' are complementary; linker B includes a third chain B1 and a fourth chain B2, wherein the third chain B1 (hereinafter referred to as B1) specifically includes sequence c and sequence e, and the fourth chain B2 (hereinafter referred to as B2) includes sequence e', sequence f, and sequence b', wherein sequence b' is complementary to sequence c, and sequence e is complementary to sequence e'. In some embodiments, linker B1 may further include sequence d, which is located between sequence c and sequence e. In some embodiments, sequence d does not match sequence f. In other words, linkers B1 and B2 can be bubble-shaped linkers in which the sequences at the two ends are complementary but the sequences in the middle are not complementary.

[0046] In some embodiments, the 3' end of adapter A1 may further include a T base, which protrudes to form a sticky T end; and the 3' end of adapter B1 may further include a T base, which protrudes to form a sticky T end. In some embodiments, the 5' ends of adapters A1, A2, and B2 may be phosphorylated. It is understood that adapter A may have a phosphorylated sticky end at one end and a phosphorylated sticky T end at the other end; adapter B may have a phosphorylated sticky T end at one end and a sticky end or a blunt end at the other end.

[0047] In the present application embodiment, DNA to be tested refers to a DNA sequence with a sticky A end at 3' end. In certain embodiments, the DNA to be tested is a double-stranded DNA sequence. It is understood that the DNA to be tested can be a DNA obtained by adding A to the 3' end and / or a natural DNA with a sticky A end at 3' end. Under the action of DNA ligase, its sticky A end can be connected to the sticky T end of joint A and joint B respectively, to form a joint A-DNA-joint B product. At the same time, it is understood that in the connection of the DNA to be tested and the joint based on the sticky end, the two sides of a small amount of DNA to be tested may also be connected to the same joint at the same time, that is, the situation of connecting joint A or joint B at the same time, but, based on such double-ended identical joints, subsequent cyclization and rolling circle amplification (RCA) cannot be carried out, so the appearance of a small amount of bilateral identical joints will not affect the system and method proposed in the present application embodiment, nor will it affect subsequent sequencing.

[0048] In the examples of the present application, unless otherwise specified, the Tm value (melting temperature) refers to the melting temperature of the oligonucleotide, that is, the temperature at which half of the double-stranded oligonucleotide chain is melted under the conditions of a Na+ concentration of 50mM and an oligonucleotide concentration of 0.5μM (if the oligonucleotide is a primer, the concentration is 0.25μM). The Tm value is determined by the length of the hybridized base pairs and the GC content in the oligonucleotide sequence and can be used to indicate the stability of the double-stranded oligonucleotide. In some embodiments, the Tm value of the complementary sequence close to the sticky T end of the adapter B1 is higher than the Tm value of the sticky T end away from the adapter B1. That is, in adapter B, the melting temperature (i.e., the first Tm value) of the complementary sequence close to the sticky T end (i.e., sequence e and e') is higher, which is used to stabilize the double-stranded structure of adapter B; the melting temperature (i.e., the second Tm value) of the complementary sequence away from the sticky T end is lower, and it will automatically melt in the subsequent circularization process to form a free end.

[0049] In an embodiment of the present application, when one end of the connector B away from the sticky T end is a sticky end, the sequence length of sequence c can be shorter than the sequence length of sequence b'. In some embodiments, sequence b' can be partially complementary to sequence c, while sequence b' is completely complementary to sequence b in connector A. Thus, at a higher cyclization temperature, sequence b' and sequence c are unzipped to form free ends, and since the potential energy of sequence b' to form a complementary sequence with sequence b in connector A is greater than the potential energy of forming a complementary sequence with sequence c, sequence b' is complementary to sequence b, thereby achieving the connection between connector A and connector B, thereby cyclizing the connector A-DNA-connector B product to form a double-stranded circular product with a local gap (as shown in Figure 1).

[0050] In the embodiment of the present application, the first Tm value of sequence e and sequence e' can be 45 to 70°C, for example, 45, 45.5, 46, 46.5, 47, 47.5, 48, 48.5, 49, 49.5, 50, 50.5, 51, 51.5, 52, 52.5, 53, 53.5, 54, 54.5, 55, 55.5, 56, 56.5, 57, 57.5, 58, 58.5, 59, , 59.5, 60, 60.5, 61, 61.5, 62, 62.5, 63, 63.5, 64, 64.5, 65, 65.5, 66, 66.5, 67, 67.5, 68, 68.5, 69, 69.5, 70°C, or any value therebetween; the second Tm value of sequence b' and sequence c is 30 to 40°C, for example, 30, 30.5, 31, 31.5, 32, 32.5, 33, 33 .5, 34, 34.5, 35, 35.5, 36, 36.5, 37, 37.5, 38, 38.5, 39, 39.5, 40°C, or any value therebetween; the third Tm value of sequence b' and sequence b is 45 to 70°C, for example, 45, 45.5, 46, 46.5, 47, 47.5, 48, 48.5, 49, 49.5, 50, 50.5, 51, 51.5, 52, 52. , 58, 58.5, 59, 59.5, 60, 60.5, 61, 61.5, 62, 62.5, 63, 63.5, 64, 64.5, 65, 65.5, 66, 66.5, 67, 67.5, 68, 68.5, 69, 69.5, 70°C, or any value therebetween. It can be understood that, since sequence b' and sequence b are fully complementary, while sequence b' may be partially complementary to sequence c, for example, the sequence length of sequence c is shorter than that of sequence b', and thus the number of hybridization base pairs between sequence b' and sequence b is less than the number of hybridization base pairs between sequence b' and sequence c, the third Tm value of sequence b' and sequence b is higher than the second Tm value of sequence b' and sequence c.

[0051] In an embodiment of the present application, the length of sequence b and sequence b 'can be 8-20bp, for example, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20bp. In an embodiment of the present application, the length of sequence c can be 3-15bp, for example, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15bp. In certain embodiments, the length of sequence e can be 10-25bp, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25bp. In certain embodiments, the length of sequence e 'can be 3-24bp, for example, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24bp. In some embodiments, the length of sequence e' can be 9-24 bp.

[0052] In the examples of the present application, the DNA ligase in the system can fill the gaps in the double-stranded circular product produced by the complementary pairing of linker A-DNA-linker B, incorporating the circular product into a ring, thereby forming a circular product. Based on this circularized product, DNBs can be prepared.

[0053] In the embodiments of the present application, the DNA ligase is T4 DNA ligase and / or Taq DNA ligase. It is understood that the DNA ligase in the system participates in the connection of the adapter to the DNA to be tested and the connection of the local gap in the circularization step, thereby playing a role in both the adapter connection and the circularization step. In the embodiments of the present application, the connection temperature of the DNA ligase is 12 to 70°C. It is understood that when using T4 DNA ligase with a lower optimal reaction temperature, the connection temperature can be 12-45°C, preferably 12-37°C, for example, it can be 25°C and 37°C. When using Taq DNA ligase with a slightly higher optimal reaction temperature, the connection temperature can be 37-70°C, preferably 37-65°C, more preferably 45-65°C, for example, the connection temperature can be 37°C, 45°C and 65°C. When using both at the same time, a relatively compromise temperature at which both can be active can be selected for the corresponding connection reaction, such as 37°C or 45°C.

[0054] Specifically, in the embodiments of the present application, the adapter and the test DNA can be ligated using T4 DNA ligase at a relatively low first temperature, i.e., the sticky A end at the 3' end of the test DNA is ligated to the sticky T ends of adapter A and adapter B, respectively, to form an adapter A-DNA-adapter B product. In some embodiments, the first temperature can be 12 to 37°C, preferably 12 to 25°C. It is understood that at this relatively low first temperature, since the Tm values ​​of sequence b' and sequence c in the adapter are 30 to 40°C, both the test DNA and the adapter maintain their double-stranded structures, thereby achieving efficient ligation of the test DNA and the adapter.

[0055] In some embodiments, at the second temperature, the adapter A-DNA-adapter B product is cyclized to form a cyclized product. Specifically, at the higher second temperature, due to the lower second Tm values ​​of sequence b' and sequence c in the adapter, sequence b' of adapter B2 is melted to form a single strand and binds to sequence b of adapter A2 to form a quasi-cyclic product. Further, in the present embodiment, at the second temperature, under the action of DNA ligase, sequence b' of adapter B2 is connected to sequence a of adapter A2 to form a cyclized product.

[0056] It is understandable that at the second temperature, since the Tm value of the complementary sequence (i.e., sequence c and b') away from the sticky T end in connector B is low, it will automatically melt to form a free end, and since the Tm value of the complementary sequence close to the sticky T end is high, the double-stranded structure can still be maintained. The sequence b' in the free end of connector B has a high complementary potential with the sequence b in connector A, and thus can be combined with it and form a quasi-annular double-stranded structure. And since connector A1 and connector B2 are not actually connected, there is a local gap in this type of ring structure. Further, at the second temperature, connector A1 and connector B2 (i.e., through sequence b' and sequence a) are connected using DNA ligase to achieve cyclization of the connection product.

[0057] In some embodiments, the cyclization of the ligation product can be achieved using a DNA ligase suitable for low-temperature ligation or a DNA ligase suitable for high-temperature ligation. In the present embodiment, the type of DNA ligase can be selected and the second temperature can be determined based on the different Tm values ​​of the different sequences of the linker. In some embodiments, Taq DNA ligase with a higher optimal reaction temperature can be used to cyclize the quasi-circular product. The second temperature can be 37 to 70°C, preferably 37 to 65°C, for example, 37°C or 45°C.

[0058] It is understood that, based on temperature control and the sequence structure of adapters A and B, the reaction system for preparing DNBs in the examples of the present application can achieve specific melting at the end of the adapter, and pair and connect with the adapter at the other end to complete the cyclization. This allows the cyclization to be completed in a single system during the adapter ligation process, thereby simplifying the experimental steps and saving operation time. At the same time, because the cyclization is completed during the adapter ligation process without the need for an additional separate cyclization step, the reaction system and method for preparing DNBs in the examples of the present application can eliminate the PCR amplification step before cyclization in traditional methods, thereby avoiding amplification errors and deviations introduced by PCR amplification.

[0059] In the embodiments of the present application, the enzyme in the reaction system for preparing DNB may further include DNA polymerase.

[0060] In this embodiment of the present application, the circularized product is subjected to rolling circle amplification under the action of a DNA polymerase with strand displacement activity to obtain DNBs. It is understood that this rolling circle amplification can be performed at a third temperature. In this embodiment of the present application, the third temperature can be between 30°C and 70°C, for example, 30°C, 45°C, or 70°C.

[0061] In some embodiments, the third temperature may be different from the second temperature. In other embodiments, the third temperature is the same as the second temperature. Specifically, when the second temperature is the same as the third temperature, the reaction system in the embodiments of the present application can achieve simultaneous circularization and rolling circle amplification, i.e., circularization and rolling circle amplification are synchronized. When the third temperature is different from the second temperature, different reaction temperatures can be set in steps within the same system to achieve circularization and rolling circle amplification, respectively.

[0062] Therefore, when the reaction system of the embodiment of the present application performs linker connection, the subsequent cyclization can be completed only by adjusting the temperature; and when the third temperature is the same as the second temperature, based on the DNA ligase and DNA polymerase in the system, rolling circle amplification of the cyclized product can be achieved based on the same temperature. Therefore, the DNB preparation in the embodiment of the present application reduces the three independent operation steps in the traditional method to a two-step reaction in a single system, that is, linker connection, cyclization and rolling circle amplification can be completed only by adjusting the temperature, thereby simplifying the experimental steps and saving time and labor operation costs.

[0063] In the embodiment of the present application, the DNA polymerase can be selected from any one of the following or a combination thereof: Phi29 DNA polymerase, Bst DNA polymerase and Bsm DNA polymerase.

[0064] In an embodiment of the present application, the adapter may also contain a sequencing primer sequence, a sample tag sequence, etc. for downstream sequencing. Figure 2 is a schematic diagram of the sequencing primer binding position according to an embodiment of the present application. As shown in Figure 2, in an embodiment of the present application, sequencing primer sequence 1 can be combined with all or part of adapter A2; sequence e' and partial sequence f of adapter B are combined with sequencing primer sequence 2 for sequencing. In some embodiments, sequence f also contains a sample tag sequence to distinguish different samples.

[0065] In some embodiments, the sequence of linker A1 can be 5'-Phos-CATGCCTCTCATACGATCCGACTTGT-3' (SEQ ID NO: 1); the sequence of linker A2 can be 5'-Phos-CAAGTCGGATCGTATGAGAGGCATGGCGACCTTATCAG-3' (SEQ ID NO: 2), wherein sequence a' is CAAGTCGGATCGTATGAGAGGCATG (SEQ ID NO: 3), and sequence b is GCGACCTTATCAG (SEQ ID NO: 4). In some embodiments, the sequence of linker B1 can be 5'-GACAGATGGCCTCCGACTTGT-3' (SEQ ID NO: 5), wherein sequence e is AGATGGCCTCCGACTTGT (SEQ ID NO: 6) and sequence c is GAC. The sequence of linker B2 can be 5'-Phos-CAAGTCGGAGGCCAAGCGGTCTTAGGAAGACAANNNNNNNNNNCAACTCTGATAAGGTCG-3' (SEQ ID NO: 7), wherein sequence e' is CAAGTCGGAGGCCA (SEQ ID NO: 8), sequence f is AGCGGTCTTAGGAAGACAANNNNNNNNNNCAACT (SEQ ID NO: 9), and sequence b' is CTGATAAGGTCGC (SEQ ID NO: 10), wherein Phos represents phosphorylation modification. N represents a sample tag sequence for labeling sample information. In some embodiments, N is any one of A, T, G, and C. In some embodiments, the sample tag sequence represented by "N" can be GGACGGAATC (SEQ ID NO: 11).

[0066] In some embodiments, the buffer in the reaction system may include Tris-HCl, Mg 2+ , DTT and ATP. In some embodiments, the pH value of the buffer is between 4.0 and 9.0. In some embodiments, the buffer may contain 5-500mM Tris-HCl, 1-500mM Mg 2+, 1-50 mM DTT and 1-50 mM ATP, of which Mg 2+ Can come from MgCl2.

[0067] In some embodiments, the buffer in the reaction system may further comprise K + NH4 + , NAD and dNTP. In some embodiments, the buffer further comprises 1-500 mM K + 1-500mM NH4 + , 1-50mM NAD and 1-50mM dNTP, where K + Can be derived from K2SO4 and / or KCl, NH4 + Can come from (NH4)2SO4 and / or NH4Cl.

[0068] It will be appreciated that the buffer in the reaction system of the present embodiment provides the raw material molecules required for the adaptor ligation, circularization, and rolling circle amplification reactions, and also provides environmental conditions suitable for the activity of DNA ligase and / or DNA polymerase, such as compatible pH values, ionic environments, etc. The buffer in the reaction system of the present embodiment has simple components, and no other reagents need to be added during the DNB preparation process. The buffer alone can provide the required conditions for the adaptor ligation, circularization, and rolling circle amplification reactions, thereby simplifying the experimental operation and improving experimental efficiency.

[0069] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0070] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.

[0071] Example 1

[0072] Experimental design: DNA fragmentation was performed using commercial standard DNA (NA12878, Coriell Institute). Then, a control group and an experimental group were set up, and libraries were prepared based on 10 ng of fragmented DNA. The control group used the conventional library construction method, that is, the library construction kit (Hieff Biotechnology Co., Ltd., Shanghai) was used. Libraries were prepared using the OnePot II DNA Library Prep Kit for MGI (Cat. No. 13321ES96) strictly according to the manufacturer's instructions. For the experimental group, libraries were prepared according to the following experimental steps. Libraries prepared for both the experimental and control groups were sequenced using a DNBSEQ-2000 sequencer using a PE150 sequencing type and a sequencing depth of 30×. Off-line data were analyzed, and performance metrics including data utilization, alignment rate, duplication rate, and GC bias were analyzed.

[0073] Experimental library building steps:

[0074] 1.1 DNA fragmentation, end repair, and end A addition

[0075] As above, the experimental group used commercial standard DNA (NA12878) and DNA fragmentation, end repair and A tailing were performed using the reagents in the kit of Shanghai Yisheng Biotechnology Co., Ltd. (the kit is Hieff Fast-Pace DNA Fragmentation Reagent, Catalog No. 12609ES24). The specific reaction system and procedures are shown in Tables 1 and 2 below.

[0076] Table 1

[0077]

[0078]

[0079] Table 2

[0080] 30℃8min72℃20min

[0081] The reaction product was purified using 60 μL XP beads (Agencourt AMPure XP magnetic beads, Beckman Co., Ltd., product number A63881) and dissolved in 22 μL TE buffer.

[0082] 1.2 Adapter ligation, circularization reaction and rolling circle amplification

[0083] 1.2.1 Linker ligation and cyclization reaction

[0084] The product DNA obtained in 1.1 was used for adapter ligation and cyclization reaction, wherein the adapter sequence is shown in Table 3, and the specific reaction system and procedure are shown in Table 4 and Table 5, respectively.

[0085] Table 3

[0086]

[0087] Note: "Phos-" refers to phosphorylation, that is, the 5' ends of the linker elements A1, A2, and B2 are all phosphorylated; the sample tag sequence indicated by "N" in the linker element B2 is "GGACGGAATC (SEQ ID NO: 11)", which is used to mark sample information.

[0088] Table 4

[0089] DNA 20 μL 5× Working Buffer 18 μL T4 DNA Ligase 2 μL Adapter A (2.5 μM) 1 μL Adapter B (2.5 μM) 1 μL NF water 8 μL Total 40 μL

[0090] The formula of 5× working buffer 1 is 350mM Tris-HCl, 50mM MgCl2, 25mM DTT, and 5mM ATP; T4 DNA ligase was purchased from BGI (catalog number: 1000004279); adapter element A is an equal mixture of adapter elements A1 and A2, and adapter element B is an equal mixture of adapter elements B1 and B2.

[0091] Table 5

[0092] Hot cover 45℃25℃10min37℃30min4℃Hold

[0093] 1.2.2 Rolling Circle Amplification

[0094] Use the DNBSEQ DNB preparation kit (BGI, catalog number: 1000016115) to add the following reagents shown in Table 6 of the kit to the reaction product of 1.2.1, and perform rolling circle amplification reaction according to the procedure shown in Table 7.

[0095] Table 6

[0096] Component volume: DNB polymerase mix I 40μL DNB polymerase mix II (LC) 4μL

[0097] Table 7

[0098] Heated lid 35℃30℃25min4℃Hold

[0099] After the reaction was completed, 20 μL of stop buffer was added to each reaction system.

[0100] 1.3 DNB quantification

[0101] The resulting rolling circle amplification products were quantified using the Qubit ssDNA kit for DNB quantification.

[0102] 1.4 Sequencing

[0103] The qualified DNBs prepared in 1.3 were sequenced on the sequencing platform DNBSEQ-2000 and the sequencing type PE150.

[0104] 1.5 Data Analysis

[0105] The analysis steps include basic steps such as filtering and alignment. FastQC (version v0.11.8) was used to perform quality statistics on the raw data, and PRINSEQ (version v0.20.4) was used to detect PCR duplications. The NGS QC Toolkit (version v2.3.3) was used to filter the raw data, including removing low-quality reads and connector data. The filtered data were aligned to the human genome (version GRCh38) using the mem module of BWA (version v0.7.12), and Picard (version v2.6.0) was used for duplication marking. The bam file was locally realigned and the base quality value was recalibrated using GATK (version v3.3). SNP and InDel variation detection was performed using GATK, and the resulting variation file was annotated and analyzed based on the dbSNP library. Coverage analysis was performed using SAMtools (version v1.9). The specific data statistics and analysis results are shown in Tables 8 and 9, respectively.

[0106] Table 8 Statistics of logoff data

[0107]

[0108] Table 9 Mutation analysis

[0109]

[0110] According to the statistics of the offline data shown in Table 8, the duplication rate (duplicates rate) of the offline data of the experimental group is much lower than that of the control group, and the data quality (Clean Q30), mapping rate (Mapping rate) and coverage of at least 10× are all better than those of the control group. At the same time, according to the data analysis results shown in Table 9, the number of mutations (total SNPs and total indels) detected by the data produced by the experimental group is also greater than that of the control group, and in other parameters, such as the number of heterozygotes (Heterozygous) and homozygotes (Homozygous), it is better than or equivalent to that of the control group, indicating that the library preparation method (experimental group) used in this embodiment can still achieve efficient and stable data output on the basis of simplifying the experimental steps, thereby effectively improving the sequencing performance and saving time and labor costs.

[0111] Compared to the traditional method (i.e., the control group), the library preparation method used in this example (experimental group) is based on a special connector structure and process design. The library circularization can be completed during the connector connection process, that is, the original two-step independent operation is simplified to a one-step operation under the same reaction system, thereby avoiding the liquid loss caused by the transfer tube, simplifying the experimental steps, and effectively reducing the reaction time. In addition, the data analysis results presented by the experimental group show that the library preparation method used in this example (experimental group) can still achieve efficient and stable data output on the basis of simplifying the experimental steps, thereby effectively improving the performance of sequencing and saving time and labor costs.

[0112] Example 2

[0113] Experimental design: The same as in Example 1, DNA fragmentation was performed using commercial standard DNA (NA12878, Coriell Institute), and then a control group and an experimental group were set up, and libraries were prepared based on 10 ng of fragmented DNA. The control group used the conventional library construction method, that is, the library construction kit (Hieff Biotechnology Co., Ltd., Shanghai) was used. Libraries were prepared using the OnePot II DNA Library Prep Kit for MGI (Cat. No. 13321ES96) strictly according to the manufacturer's instructions. For the experimental group, libraries were prepared according to the following experimental steps. Libraries prepared for both the experimental and control groups were sequenced using a DNBSEQ-2000 sequencer using a PE150 sequencing type and a sequencing depth of 30×. Off-line data were analyzed, and performance metrics including data utilization, alignment rate, duplication rate, and GC bias were analyzed.

[0114] Experimental library building steps:

[0115] 2.1 DNA fragmentation, end repair, and end A addition

[0116] Same as step 1.1 of Example 1.

[0117] 2.2 Adapter ligation, circularization reaction and rolling circle amplification

[0118] The product DNA obtained in 2.1 was subjected to adapter ligation, circularization reaction and rolling circle amplification. The adapter sequences are shown in Table 3, and the specific reaction systems and procedures are shown in Tables 10 and 11, respectively.

[0119] Table 10

[0120] DNA30μL5×Working Buffer210μL4 DNA Ligase2μLq DNA ligase2μLst 3.0 DNA polymerase2μLAdapter A (2.5μM) 2μLAdapter B (2.5μM) 2μL Total 50μL

[0121] The formula of 5× working Buffer 2 is 100mM Tris-HCl, 50mM MgCl2, 500mM KCl, 100mM NH4Cl, 25mM DTT, 5mM NAD 1, 5mM ATP, 2.5mM dNTP; T4 DNA Ligase was purchased from BGI (catalog number: 1000004279); Taq DNA ligase was purchased from BGI (catalog number: 1000008610); Bst 3.0 DNA polymerase was purchased from NEB (catalog number M0374S).

[0122] Table 11

[0123] Hot cover 45℃25℃30min45℃30min4℃Hold

[0124] After the reaction was completed, 20 μL stop buffer (0.1 M EDTA) was added to each reaction system.

[0125] 2.3 DNB quantification

[0126] Same as step 1.3 of Example 1.

[0127] 2.4 Sequencing

[0128] Same as step 1.4 of Example 1.

[0129] 2.5 Data Analysis

[0130] The data analysis steps were the same as step 1.5 of Example 1. The specific data statistics and analysis results are shown in Tables 12 and 13, respectively.

[0131] Table 12 Statistics of log-off data

[0132]

[0133] Table 13 Mutation analysis

[0134]

[0135] Compared to the traditional method (i.e., the control group), the library preparation reaction system used in this example (experimental group) achieved the application of only one-step PCR reaction in the same reaction system. By controlling the temperature, the three steps of adapter ligation, circularization, and rolling circle amplification can be completed. This simplifies the traditional three-step independent operation into a one-step operation under the same reaction system, greatly reducing the operation process, simplifying the experimental steps, and effectively reducing the time required for the reaction. In addition, the data analysis results presented by the experimental group show that the library preparation method used in this example (experimental group) can still achieve efficient and stable data output on the basis of greatly simplifying the experimental steps, thereby effectively improving the performance of sequencing and saving time and labor costs.

[0136] Specifically, according to the off-machine data statistics shown in Table 12, the duplication rate of the off-machine data of the experimental group was much lower than that of the control group, and it was superior to the control group in terms of data volume (Clean reads), mapping rate, coverage, and coverage of at least 10×. At the same time, according to the data analysis results shown in Table 13, the number of SNP and Indel mutations (total SNPs and Total Indels) detected in the data produced by the experimental group was greater than that of the control group, and the corresponding coverage in the SNP and InDel databases (Fraction of SNPs in dbSNP and Fraction of InDels in dbSNP) was also greater than that of the control group. In addition, other parameters, such as the number of heterozygotes (Heterozygous) and homozygotes (Homozygous), were better than or comparable to those of the control group. This shows that the library preparation method (experimental group) used in this example can achieve efficient and stable data output on the basis of simplifying the experimental steps, thereby effectively improving the sequencing performance and saving time and labor costs.

[0137] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0138] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

[0139]

[0140]

[0141]

[0142]

[0143]

Claims

1. A reaction system for preparing DNA nanoballs (DNBs), comprising: connector; enzyme, wherein the enzyme comprises DNA ligase; and Buffer, Wherein the connector includes connector A and connector B, The linker A comprises a first chain and a second chain, wherein the first chain comprises a sequence a, and the second chain comprises a sequence a' and a sequence b, wherein the sequence a and the sequence a' are complementary; and The linker B comprises a third chain and a fourth chain, wherein the third chain comprises sequence c and sequence e, and the fourth chain comprises sequence e', sequence f and sequence b', wherein the sequence b' is complementary to the sequence c, and the sequence e is complementary to the sequence e'. The sequence b is complementary to the sequence b'.

2. The reaction system according to claim 1, wherein the 3' end of the first strand of the adapter A further comprises a base T, and the base T protrudes to form a sticky T end; Optionally, the 3' end of the third strand of the adapter B further comprises a base T, and the base T protrudes to form a sticky T end; Optionally, the 5' ends of the first chain of linker A, the second chain of linker A and the fourth chain of linker B are phosphorylated.

3. The reaction system according to claim 2, wherein the first Tm value of the sequence e and the sequence e' close to the sticky T terminus of the third strand of the linker B is higher than the second Tm value of the sequence b' and the sequence c away from the sticky T terminus of the third strand of the linker B, Optionally, the first Tm value of sequence e and sequence e' is 45 to 70°C; the second Tm value of sequence b' and sequence c is 30 to 40°C; and the third Tm value of sequence b' and sequence b is 45 to 70°C. The reaction system according to claim 3 , wherein the sequence b′ is partially complementary to the sequence c, and the sequence b′ is completely complementary to the sequence b. The reaction system according to claim 4 , wherein the sequence length of the sequence c is shorter than the sequence length of the sequence b′.

6. The reaction system according to any one of claims 1 to 5, wherein the third chain further comprises a sequence d, wherein the sequence d is located between the sequence c and the sequence e, Optionally, the sequence f also includes a sample tag sequence, Optionally, the sequence f does not match the sequence d.

7. The method according to any one of claims 1 to 6, wherein the length of the sequence b and the sequence b' is 8-20 bp, Optionally, the length of the sequence c is 3-15 bp, Optionally, the length of the sequence e is 10-25 bp, and the length of the sequence e' is 3-24 bp.

8. The reaction system according to any one of claims 1 to 7, wherein the ligation temperature of the DNA ligase is 12 to 70°C, Optionally, the DNA ligase is T4 DNA ligase and / or Taq DNA ligase.

9. according to the reaction system described in any one of claim 1 to 8, wherein said buffer comprises Tris-HCl, Mg 2+ , DTT and ATP; Optionally, the pH value of the buffer is between 4.0 and 9.0, Preferably, the buffer contains 5-500 mM Tris-HCl, 1-500 mM Mg 2+ , 1-50mM DTT and 1-50mM ATP, Optionally, wherein the Mg 2+ Derived from MgCl2.

10. The reaction system according to any one of claims 1 to 9, wherein the enzyme further comprises DNA polymerase, Optionally, the reaction temperature of the DNA polymerase is 30 to 70°C, Optionally, the DNA polymerase is selected from any one of the following or a combination thereof: Phi29 DNA polymerase, Bst DNA polymerase and Bsm DNA polymerase.

11. The reaction system according to claim 10, wherein the buffer further comprises K + NH4 + , NAD and dNTP, Preferably, the buffer further comprises 1-500 mM K + 1-500mM NH4 + , 1-50 mM NAD and 1-50 mM dNTP.

12. The reaction system according to any one of claims 1 to 11, wherein the first chain sequence is as shown in SEQ ID NO: 1, Optionally, the sequence of the second chain is as shown in SEQ ID NO: 2, Optionally, the sequence of the third chain is as shown in SEQ ID NO: 5, Optionally, the sequence of the fourth chain is shown in SEQ ID NO:

7.

13. A method for preparing DNB in ​​a single system, comprising: contacting the reaction system for preparing DNB according to any one of claims 1 to 12 with a DNA to be tested; At a first temperature, the DNA to be tested is connected to a linker to form a linker A-DNA-linker B product; At a second temperature, cyclizing the linker A-DNA-linker B product to form a cyclized product; and At a third temperature, the circularized product is subjected to rolling circle amplification to obtain DNBs.

14. The method according to claim 13, wherein the 3' end of the DNA to be tested has a sticky A end, Optionally, the DNA to be tested is DNA obtained by adding A to the 3' end and / or natural DNA with a sticky A end at the 3' end. Optionally, the 5' end of the DNA to be tested has phosphorylation modification.

15. The method according to claim 13 or 14, wherein at a first temperature, the test DNA is ligated to an adapter to form an adapter A-DNA-adapter B product, comprising: At the first temperature, under the action of DNA ligase, the sticky A end of the 3' end of the DNA to be tested is connected to the sticky T end of the adapter A and the sticky T end of the adapter B, respectively, to form an adapter A-DNA-adapter B product. Optionally, the first temperature is 12 to 37°C, preferably 12 to 25°C.

16. The method according to claim 13 or 14, wherein at the second temperature, cyclizing the adapter A-DNA-adapter B product to form a cyclized product comprises: At the second temperature, the sequence b' of the fourth chain of the adapter B is melted to form a single chain, and combines with the sequence b of the second chain of the adapter A to form a quasi-cyclic product. Optionally, under the action of the DNA ligase, the sequence b' of the fourth chain of the linker B is connected to the sequence a of the second chain of the linker A to form a cyclized product. Optionally, the second temperature is 37 to 70°C, preferably 37 to 65°C.

17. The method according to claim 13 or 14, wherein at the third temperature, under the action of DNA polymerase, the circularized product is subjected to rolling circle amplification to obtain DNB, Optionally, the third temperature is 30 to 70°C.

18. The method of any one of claims 13 to 17, wherein the second temperature is the same as the third temperature.

19. The method according to any one of claims 13 to 18, further comprising: The nucleic acid is fragmented and optionally end-repaired and end-A-added to obtain the DNA to be tested.

20. A kit comprising the reaction system for preparing DNB according to any one of claims 1 to 12, Optionally, the kit further comprises sequencing primers, Optionally, the second strand of adapter A is combined with all or part of sequencing primer sequence 1 for sequencing; Optionally, the sequence e' and the partial sequence f of the fourth strand of the adapter B are combined with the sequencing primer sequence 2 for sequencing; Optionally, the sequence f also includes a sample tag sequence.

21. Use of the reaction system for preparing DNB according to any one of claims 1 to 12 in sequencing.

22. A sequencing method comprising: Prepare DNB according to the method for preparing DNB in ​​a single system according to any one of claims 13 to 19; and The DNBs were sequenced using DNB-SEQ.