In-situ labeling method of living cell mitochondrial ribonucleic acid and application thereof

Abstract

The invention discloses an in-situ labeling method of living cell mitochondrial ribonucleic acid and application of the in-situ labeling method. The invention provides a methylene quinone precursor probe as shown in a formula (I) or a formula IX. Both the photosensitizer and the methylene quinone precursor probe have the properties of entering cells and enriching into mitochondria, and the methylene quinone precursor probe does not have the ability to bind with single-stranded nucleic acid. The method comprises the following steps: sequentially co-incubating test cells with a photosensitizer and a methylene quinone precursor probe, and irradiating by using light corresponding to an excitation wave band required by the photosensitizer, so that an azido phenyl protecting group of the probe is removed, and mitochondrial nucleic acid is combined with a methylene quinone intermediate, namely, the mitochondrial nucleic acid is labeled in situ by using the methylene quinone intermediate. After the marked cells are subjected to cell lysis and nucleic acid extraction, the marked nucleic acid can be enriched and purified through streptavidin magnetic beads for subsequent transcriptome analysis. # imgabs0 #

Description

Technical Field

[0001] The present invention belongs to the field of transcriptomics, and relates to the labeling of ribonucleic acid in fine cell regions. Specifically, the present invention relates to an in-situ labeling method for mitochondrial ribonucleic acid in living cells and its application. The present invention can be used to study the changes of mitochondrial transcriptome at different times and spaces. Background Art

[0002] The subcellular localization changes of ribonucleic acid and its asymmetric distribution in cells not only provide a material basis for the regional organization of cell functions, but also provide a spatial regulation dimension for gene expression. In cells, the cellular transcriptome composed of ribonucleic acid often has the characteristic of heterogeneous distribution. Therefore, developing a live-cell local transcriptome research tool with high spatio-temporal resolution and universality is of great significance for analyzing its spatial distribution and subsequent functional research.

[0003] Mitochondria are the "energy factories" in all cells, and the dynamic changes of biomacromolecules inside them play a crucial role in the regulation of various life processes and signaling pathways. Compared with other organelles, mitochondria also have their own independent transcription-translation system. In recent years, the transcriptome in mitochondria has been reported to be closely related to life activities such as the functional activation of immune cells and the migration of cancer cells. Therefore, capturing, separating, and analyzing the mitochondrial transcriptome under dynamic changes can help us further understand related biological problems. Traditional methods are based on the strategy of separating mitochondria, which are cumbersome to operate. Moreover, due to the similarity of membrane structures, the isolated mitochondria are often contaminated by other membrane-bound organelles in the cell, thus affecting the accuracy of subsequent analysis. More critically, such techniques cannot maintain the in-situ and real information in the living state.

[0004] In recent years, researchers have developed enzyme-catalyzed proximity labeling techniques and protein fusion expression techniques to in-situ label mitochondrial ribonucleic acid and its transcriptome in living cells, and achieve subsequent separation and analysis. These two types of techniques generate reactive intermediates through enzymes or protein-small molecule dye conjugates specifically expressed in subcellular regions, thereby achieving the labeling of the transcriptome in specific cell regions. However, both of the above two types of techniques require genetic modification of target cells, thus limiting their application in difficult-to-transfect cells, such as samples of stem cells, immune cells, primary cells, and clinical tissues.

[0005] In 2021, researchers reported a brand-new strategy for capturing the mitochondrial proteome in living cells, namely CAT-Prox. This technique uses a photosensitizer that can autonomously localize in the mitochondrial region and an azidophenyl-protected methylenequinone probe. Under blue light irradiation, the protecting group of the probe is removed to generate a methylenequinone intermediate for labeling protein residues. However, this technique is only limited to the labeling and analysis of the proteome, and the photocatalytic labeling of other biological macromolecules such as nucleic acids is still blank. Summary of the Invention

[0006] The present invention aims to provide a method capable of efficiently labeling mitochondrial ribonucleic acid, breaking through the application scope limitations of existing proximity labeling techniques, so as to achieve the analysis of highly specific and dynamic mitochondrial internal ribonucleic acid and the transcriptome composed thereof in a variety of difficult-to-transfect cell lines. To this end, the invention provides an in-situ labeling method for mitochondrial ribonucleic acid in living cells.

[0007] The present invention provides a compound (methylenequinone precursor probe).

[0008] The compound is a compound represented by formula (Ⅰ), a derivative of the compound represented by formula (Ⅰ), or an analogue of the compound represented by formula (Ⅰ).

[0009]

[0010] The derivative of the compound represented by formula (Ⅰ) refers to a compound derived from the compound represented by formula (Ⅰ) based on basic chemical knowledge and having the same or similar effects as the compound represented by formula (Ⅰ).

[0011] The analogue of the compound represented by formula (Ⅰ) refers to a compound obtained by group substitution based on the compound represented by formula (Ⅰ) according to basic chemical knowledge and having the same or similar effects as the compound represented by formula (Ⅰ).

[0012] The compound is a compound represented by formula (Ⅸ), a derivative of the compound represented by formula (Ⅸ), or an analogue of the compound represented by formula (Ⅸ).

[0013]

[0014] In formula (Ⅸ), R1 is 4-azidobenzyl, o-nitrobenzyl, or 1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethoxy;

[0015] In formula (Ⅸ), R2 is alkyl, phenyl, amide group, biotin group, alkyne group, or azide group.

[0016] The derivative of the compound represented by formula (Ⅸ) refers to a compound derived from the compound represented by formula (Ⅸ) based on basic chemical knowledge and having the same or similar effects as the compound represented by formula (Ⅸ).

[0017] Analogues of the compound represented by formula (IX) refer to compounds obtained by substituting groups based on the compound represented by formula (IX) relying on basic chemical knowledge and having the same or similar effects as the compound represented by formula (IX).

[0018] The present invention also protects the use of any one of the above-mentioned compounds; the use is as follows (a1) or (a2):

[0019] (a1) Use in labeling mitochondrial nucleic acids of living cells;

[0020] (a2) Use in preparing a kit for labeling mitochondrial nucleic acids of living cells.

[0021] The present invention also protects the use of a photosensitizer and any one of the above-mentioned compounds; the use is as follows (a1) or (a2):

[0022] (a1) Use in labeling mitochondrial nucleic acids of living cells;

[0023] (a2) Use in preparing a kit for labeling mitochondrial nucleic acids of living cells.

[0024] The present invention also protects the use of any one of the above-mentioned compounds; the use is as follows (b1) or (b2):

[0025] (b1) Use in mitochondrial transcriptome analysis;

[0026] (b2) Use in preparing a kit for mitochondrial transcriptome analysis.

[0027] The present invention also protects the use of a photosensitizer and any one of the above-mentioned compounds; the use is as follows (b1) or (b2):

[0028] (b1) Use in mitochondrial transcriptome analysis;

[0029] (b2) Use in preparing a kit for mitochondrial transcriptome analysis.

[0030] The present invention also protects a method for labeling mitochondrial nucleic acids of living cells, comprising the following steps: sequentially co-incubating the cells with a photosensitizer and any one of the above-mentioned compounds, and then performing blue light irradiation.

[0031] Specifically, the method sequentially comprises the following steps:

[0032] (1) Co-incubating the cells with a photosensitizer;

[0033] (2) Co-incubating the cells with any one of the above-mentioned compounds;

[0034] (3) Irradiate the cells with blue light.

[0035] The above steps also include a washing step.

[0036] Specifically, in the step (1), the concentration of the photosensitizer used is in the nM level.

[0037] Specifically, in the step (1), the concentration of the photosensitizer used is 25 nM - 50 nM.

[0038] Specifically, in the step (2), the concentration of the compound used is in the μM level.

[0039] Specifically, in the step (2), the concentration of the compound used is 50 μM.

[0040] Specifically, the cells are cells cultured to a cell density of more than 90%.

[0041] Exemplarily, the step (1) is: placing the cells in a culture medium containing a photosensitizer and culturing for 30 minutes, then discarding the culture medium, then washing with PBS buffer, then placing the cells in a culture medium and culturing for 5 minutes, and then discarding the culture medium.

[0042] Exemplarily, the step (2) is: placing the cells in a culture medium containing the compound and culturing for 30 minutes, then discarding the culture medium, then washing with PBS buffer, then placing the cells in a culture medium and culturing for 5 minutes, and then discarding the culture medium.

[0043] Exemplarily, the step (3) is: irradiating the cells with a blue light source for 15 minutes.

[0044] The present invention also provides a method for mitochondrial transcriptome analysis, which sequentially includes the following steps:

[0045] Label the mitochondrial nucleic acids of living cells by using the above method;

[0046] Collect the cells, perform lysis and nucleic acid extraction, and then enrich and purify the target nucleic acid by using streptavidin magnetic beads;

[0047] Take the target nucleic acid and perform transcriptome analysis.

[0048] The present invention also provides a kit, which includes any one of the above-mentioned compounds.

[0049] The kit further includes a photosensitizer.

[0050] The use of the kit is to label mitochondrial nucleic acids and / or perform mitochondrial transcriptome analysis.

[0051] The present invention also provides a method for preparing the compound shown in formula (I), which comprises the following steps:

[0052] (1) Reacting compound a with compound b to obtain compound c;

[0053] (2) Reacting compound c with LiOH to obtain compound d;

[0054] (3) Reacting compound d with compound e to obtain compound f;

[0055] (4) Reacting compound f with trifluoroacetic acid to obtain compound g;

[0056] (5) Reacting compound g with compound h to obtain the said compound;

[0057] The said compound a is as shown in formula (III);

[0058] The said compound b is methyl (S)-6-amino-2-((tert-butoxycarbonyl)amino)hexanoate hydrochloride;

[0059] The said compound c is as shown in formula (IV);

[0060] The said compound d is as shown in formula (V);

[0061] The said compound e is N-(2-(2-(2-aminoethoxy)ethoxy)ethyl)-5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanamide;

[0062] The said compound f is as shown in formula (VI);

[0063] The said compound g is as shown in formula (VII);

[0064] The said compound h is (3-carboxypropyl)triphenylphosphonium bromide;

[0065]

[0066] The CAS number of the said compound b is 99532-86-2.

[0067] The CAS number of the said compound e is 138529-46-1.

[0068] The CAS number of the said compound h is 17857-14-6.

[0069] A photosensitizer is a substance that can achieve the following functions: a substance that catalyzes the removal of an azidophenyl group from a methylenequinone precursor probe to generate a methylenequinone active intermediate.

[0070] Specifically, the photosensitizer responds to blue light irradiation to exert its catalytic function.

[0071] As an example, the photosensitizer is a compound represented by formula (II).

[0072] The methylenequinone active intermediate is a compound, as shown in formula (VIII);

[0073]

[0074] Principle of operation: Both the photosensitizer and the methylenequinone precursor probe have the property of being able to enter cells and accumulate in mitochondria, and the methylenequinone precursor probe does not have the ability to bind to single-stranded nucleic acids; under blue light irradiation, the photosensitizer catalyzes the reduction of the azidophenyl group and its removal from the compound, in-situ forming a highly electrophilic methylenequinone intermediate, which has the ability to specifically bind to single-stranded nucleic acids (DNA or RNA). In the present invention, after the test cells are co-incubated with the photosensitizer and the methylenequinone precursor probe in sequence, they are irradiated with light corresponding to the excitation wavelength band required by the photosensitizer, so that the azidophenyl protecting group of the probe is removed, and the mitochondrial nucleic acids bind to the methylenequinone intermediate, that is, the mitochondrial nucleic acids are in-situ labeled with the methylenequinone intermediate. For the cells that have completed the labeling step, after cell lysis and nucleic acid extraction, the labeled nucleic acids can be enriched and purified by streptavidin magnetic beads for subsequent transcriptome analysis.

[0075] Since enzyme-based labeling relies on gene transfection to introduce labeling enzymes exogenously, it is not applicable to a variety of difficult-to-transfect cell lines, limiting its scope of application. In addition, subcellular transcriptome research methods based on organelle isolation often lose the in-situ information of the organelles themselves. The method of the present invention can efficiently and in-situ capture the mitochondrial transcriptome of cells, achieving good mitochondrial transcriptomics specificity.

[0076] In Example 4, using the method provided by the present invention, a mitochondrial abundance ratio of 62.9% was obtained in HeLa cells (compared with the mitochondrial transcriptome abundance ratio of 1.5% in the whole human transcriptome, it was increased by about 40 times), and all reported mitochondrial transcriptome components were identified. In Example 5, using the method provided by the present invention, a mitochondrial abundance ratio of 42.7% was obtained in RAW 264.7 cells, and all reported mitochondrial transcriptome components were identified. To further demonstrate that the present invention can study ribonucleic acids including the transcriptome in mitochondria during dynamic changes. In Examples 6 and 7, the mitochondrial transcriptome and other ribonucleic acids during the differentiation of RAW264.7 cells stimulated with lipopolysaccharide were further captured and analyzed, proving that the present invention can capture the mitochondrial transcriptome of RAW264.7 cells at different lipopolysaccharide stimulation times with a specificity of about 40% and analyze the abundance changes of different components therein.

[0077] The present invention has developed a tool for in-situ mitochondrial transcriptome capture in living cells, capable of analyzing mitochondrial transcriptomes and ribonucleic acids with high spatio-temporal resolution. The method proposed by the present invention uses a bioorthogonal photocatalytic proximity labeling strategy for the study of mitochondrial transcriptomes. In a living cell sample, a photosensitizer molecule localized to mitochondria and a methylene quinone precursor probe are successively added for incubation, and then the sample is irradiated with visible blue light to achieve chemical labeling of the transcriptome in mitochondria for subsequent enrichment of mitochondrial transcriptomes and high-throughput sequencing omics analysis.

[0078] Advantages of the present invention: ① It is not necessary to perform gene-level operations on cells, and it can be used to analyze the mitochondrial transcriptomes of a series of cell lines such as cancer cells, immune cells, and stem cells that are difficult to transfect, as well as primary cell mitochondrial transcriptomes isolated from living tissues, so as to analyze the differences in mitochondrial transcriptomes in different types of cells; ② By analyzing the mitochondrial transcriptomes of cells during dynamic processes such as cell differentiation and immune response, it is possible to achieve an understanding of the impact of mitochondrial transcriptomes on cell function regulation under dynamic conditions; ③ By combining transcriptome capture technology with proteome capture technology, it is possible to analyze the associations among the epi-transcriptome, transcriptome, and proteome inside mitochondria from multiple dimensions such as transcription, translation, and modification, thereby exploring the specific internal mechanisms of mitochondrial function changes during certain dynamic processes. Brief Description of the Drawings

[0079] Figure 1 It is a schematic diagram of the chemical formula and synthesis route of the methylene quinone precursor probe.

[0080] Figure 2 It is the hydrogen spectrum of the methylene quinone precursor probe.

[0081] Figure 3 It is the carbon spectrum of the methylene quinone precursor probe.

[0082] Figure 4 It is a schematic diagram of the process for in-situ labeling and subsequent identification of single-stranded nucleic acids in intracellular mitochondria.

[0083] Figure 5 It is the result of the corrected enrichment factor obtained by fluorescence quantitative PCR analysis in Example 3.

[0084] Figure 6 It is the result of the transcriptome analysis in Example 4.

[0085] Figure 7 It is the result of the corrected enrichment factor obtained by fluorescence quantitative PCR analysis in Example 5.

[0086] Figure 8 It is the result of the transcriptome analysis in Example 6.

[0087] Figure 9Results of transcriptome analysis in Example 7. Detailed implementation manners

[0088] The present invention will be further described in detail below in conjunction with the detailed implementation manners. The provided examples are only for clarifying the present invention, rather than limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0089] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified. Unless otherwise specified, the quantitative tests in the following examples are all set with three repeated experiments, and the results are averaged. Unless otherwise specified, cell culture is carried out in a cell culture incubator (37 °C, containing 5% carbon dioxide). Magnetic stirrer bar: A magnetic stirrer bar used in conjunction with a magnetic stirrer. Lipopolysaccharide: Sigma-Aldrich, product catalog number L6529. DCM: Dichloromethane. DMF: N,N-Dimethylformamide. MeOH: Methanol. THF: Tetrahydrofuran. HATU: 2-(7-Azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate. DIPEA: N,N-Diisopropylethylamine. DAST: Diethylaminosulfur trifluoride, CAS number 38078-09-0. Compound a1: 4-Aminobenzyl alcohol, CAS number 623-04-1, product of Bidepharm. Compound a4: Methyl 3-formyl-4-hydroxybenzoate, CAS number 24589-99-9, product of Bidepharm. Compound b: Methyl (S)-6-amino-2-((tert-butoxycarbonyl)amino)hexanoate hydrochloride, CAS number 99532-86-2, product of Bidepharm. Compound e: N-(2-(2-(2-Aminoethoxy)ethoxy)ethyl)-5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanamide, CAS number 138529-46-1, product of Bidepharm. Compound h: (3-Carboxypropyl)triphenylphosphonium bromide, CAS number 17857-14-6, product of Bidepharm.

[0090] The photosensitizer used in the examples is the compound shown in formula (II), with the chemical name bis[2-(2,4-difluorophenyl)-5-trifluoromethylpyridine][2-2'-bi(4-tert-butylpyridine)]iridium bis(hexafluorophosphate), CAS number 870987-63-6, product of Bidepharm.

[0091]

[0092] Example 1: Preparation of Methylene Quinone Precursor Probe

[0093] The preparation flow chart of the methylene quinone precursor probe is shown in Figure 1 。

[0094] 1. Preparation of Compound a2

[0095] Add compound a1 (6.2 g) and a magnetic stir bar into a round-bottom flask. Then, add 70 mL of 6 mol / L hydrochloric acid aqueous solution under stirring in an ice bath. Then, slowly add 125 mL of NaNO2 aqueous solution (containing 8.2 g of NaNO2), and continue stirring in the ice bath for 20 minutes. Subsequently, add 150 mL of NaN3 aqueous solution (containing 20 g of NaN3), and continue stirring in the ice bath for 1.5 hours. Then, add 200 mL of deionized water. Then, extract three times with ethyl acetate (200 mL of ethyl acetate each time) and combine the organic phases. Then, wash twice with saturated NaHCO3 aqueous solution (100 mL each time), then wash once with 100 mL of saturated NaCl aqueous solution, then dry with anhydrous Na2SO4, and then concentrate by rotary evaporation under reduced pressure to constant weight to obtain a crude product. Dissolve the crude product in the mobile phase (the mobile phase in step 1 consists of 1 volume part of ethyl acetate and 3 volume parts of petroleum ether), then load it onto a silica gel column (the packing of the silica gel column is silica gel of 100 - 200 mesh), then elute with the mobile phase, collect the target product and concentrate by rotary evaporation under reduced pressure to constant weight to obtain a yellow crystalline product, which is compound a2. The yield of compound a2 is 6 g, and the yield rate is 81%.

[0096] 2. Preparation of Compound a3

[0097] Add compound a2 (3.0 g), a magnetic stir bar and 30 mL of DCM into a reaction flask. Slowly add phosphorus tribromide (16.6 g) under stirring in an ice bath, and then continue stirring and reacting in the ice bath for 12 hours. Then, add 100 mL of water to stop the reaction. Then, extract three times with DCM (40 mL of DCM each time) and combine the organic phases. Then, dry with anhydrous Na2SO4, and then concentrate by rotary evaporation under reduced pressure to constant weight to obtain a yellow liquid product, which is compound a3. The yield of compound a3 is 2.6 g, and the yield rate is 61%.

[0098] 3. Preparation of Compound a5

[0099] Dissolve compound a3 (840 mg) and compound a4 (848 mg) in 15 mL of DMF, then add K2CO3 (552 g), stir at room temperature for 12 hours, and then add 100 mL of saturated NH4Cl aqueous solution to stop the reaction. Then, extract three times with ethyl acetate (30 mL of ethyl acetate is added each time) and combine the organic phases. Then dry over anhydrous Na2SO4, and then concentrate by rotary evaporation under reduced pressure to constant weight to obtain the crude product. Dissolve the crude product in the mobile phase (the mobile phase in step 3 consists of 1 volume part of ethyl acetate and 3 volume parts of petroleum ether), then load it onto a silica gel column (the packing of the silica gel column is silica gel of 100 - 200 mesh), then elute with the mobile phase, collect the target product and concentrate by rotary evaporation under reduced pressure to constant weight to obtain a light yellow liquid product, which is compound a5. The yield of compound a5 is 689 mg and the yield rate is 55%.

[0100] 4. Preparation of compound a6

[0101] Dissolve compound a5 (500 mg) in 10 mL of DCM / MeOH (DCM / MeOH consists of 2 volume parts of DCM and 1 volume part of MeOH), then add NaBH4 (237 mg), stir at room temperature for 6 hours, and then add 100 mL of saturated NH4Cl aqueous solution to stop the reaction. Then, extract three times with ethyl acetate (30 mL of ethyl acetate is added each time) and combine the organic phases. Then dry over anhydrous Na2SO4, and then concentrate by rotary evaporation under reduced pressure to constant weight to obtain a light yellow liquid product, which is compound a6. The yield of compound a6 is 480 mg and the yield rate is 95%.

[0102] 5. Preparation of compound a7

[0103] Add compound a6 (939 mg), a magnetic stir bar and 20 mL of DCM to a reaction flask, then add DAST (885 μL) dropwise under stirring in an ice bath, then react at room temperature for 2 h, and then add 40 mL of saturated NH4Cl aqueous solution to stop the reaction. Then, extract three times with ethyl acetate (30 mL of ethyl acetate is added each time) and combine the organic phases. Then dry over anhydrous Na2SO4, and then concentrate by rotary evaporation under reduced pressure to constant weight to obtain the crude product. Dissolve the crude product in the mobile phase (the mobile phase in step 5 consists of 1 volume part of ethyl acetate and 3 volume parts of petroleum ether), then load it onto a silica gel column (the packing of the silica gel column is silica gel of 100 - 200 mesh), then elute with the mobile phase, collect the target product and concentrate by rotary evaporation under reduced pressure to constant weight to obtain a light yellow solid product, which is compound a7. The yield of compound a7 is 848 mg and the yield rate is 90%.

[0104] 6. Preparation of compound a

[0105] Dissolve compound a7 (157 mg) in 8 mL of THF / H2O (THF / H2O consists of 3 volumes of THF and 1 volume of H2O), then add 1.5 mL of 1 M aqueous LiOH solution under ice-bath conditions, then stir at room temperature for 12 hours, then add H2O to make the volume of the system 20 mL, and then add 1 mol / L aqueous HCl solution under ice-bath conditions until the pH value of the system is 3. Then, extract three times with ethyl acetate (add 10 mL of ethyl acetate each time) and combine the organic phases. Then dry with anhydrous Na2SO4, and then concentrate by rotary evaporation under reduced pressure to constant weight to obtain a light yellow solid product, which is compound a. The yield of compound a is 140 mg, and the yield is 93%.

[0106] 7. Preparation of compound c

[0107] Add compound a (300 mg), a magnetic stir bar and 30 mL of DMF to a reaction flask, then add HATU (3.8 g) and DIPEA (2.4 g) under stirring, then add dropwise 5 mL of compound b solution (containing 450 mg of compound b, the solvent is DMF), then stir at room temperature for 12 hours, and add 50 mL of water to stop the reaction. Then, extract three times with dichloromethane (add 20 mL of dichloromethane each time) and combine the organic phases. Then dry with anhydrous Na2SO4, and then concentrate by rotary evaporation under reduced pressure to constant weight to obtain the crude product. Dissolve the crude product in the mobile phase (the mobile phase in step 7 consists of 1 volume of ethyl acetate and 1 volume of petroleum ether), then load it onto a silica gel column (the packing of the silica gel column is silica gel of 100 - 200 mesh), then elute with the mobile phase, collect the target product and concentrate by rotary evaporation under reduced pressure to constant weight to obtain a light yellow liquid product, which is compound c. The yield of compound c is 420 mg, and the yield is 77%.

[0108] 8. Preparation of compound d

[0109] Dissolve compound c (271 mg) in 8 mL of THF / H2O (THF / H2O consists of 3 volumes of THF and 1 volume of H2O), then add 1.5 mL of 1 M aqueous LiOH solution under ice-bath conditions, then stir at room temperature for 12 hours, then add H2O to make the volume of the system 20 mL, and then add 1 mol / L aqueous HCl solution under ice-bath conditions until the pH value of the system is 3. Then, extract three times with ethyl acetate (add 10 mL of ethyl acetate each time) and combine the organic phases. Then dry with anhydrous Na2SO4, and then concentrate by rotary evaporation under reduced pressure to constant weight to obtain a light yellow solid product, which is compound d. The yield of compound d is 242 mg, and the yield is 91%.

[0110] 9. Preparation of compound f

[0111] Compound d (540 mg), a magnetic stir bar, and 30 mL of DMF were added to a reaction flask. Then, HATU (3.8 g) and DIPEA (2.4 g) were added under stirring, followed by dropwise addition of 10 mL of a solution of compound e (containing 560 mg of compound e in DMF as the solvent). The mixture was then stirred at room temperature for 12 h, and 50 mL of water was added to stop the reaction. Then, extraction was performed three times with dichloromethane (20 mL each time), and the organic phases were combined. The combined organic phase was dried over anhydrous Na2SO4 and then concentrated by rotary evaporation under reduced pressure to a constant weight to obtain the crude product. The crude product was dissolved in the mobile phase (the mobile phase in step 9 consisted of 3 parts by volume of ethyl acetate and 1 part by volume of petroleum ether), then loaded onto a silica gel column (the packing of the silica gel column was silica gel of 100 - 200 mesh), and then eluted with the mobile phase. The target product was collected and concentrated by rotary evaporation under reduced pressure to a constant weight to obtain a pale yellow liquid product, which was compound f. The yield of compound f was 630 mg, and the yield was 71%.

[0112] 10. Preparation of compound g

[0113] Compound f (871 mg) was dissolved in 10 mL of DCM. Then, trifluoroacetic acid (1.5 mL) was added under ice - bath conditions, and the mixture was stirred at room temperature for 2 h. Then, H2O was added until the volume of the system reached 20 mL, and then saturated aqueous sodium bicarbonate solution was added under ice - bath conditions until the pH value of the system reached 9. Then, extraction was performed three times with dichloromethane (10 mL each time), and the organic phases were combined. The combined organic phase was dried over anhydrous Na2SO4 and then concentrated by rotary evaporation under reduced pressure to a constant weight to obtain a light yellow solid product, which was compound g. The yield of compound g was 705 mg, and the yield was 90%.

[0114] 11. Preparation of methylenequinone precursor probe

[0115] Compound g (880 mg), a magnetic stir bar, and 30 mL of DMF were added to a reaction flask. Then, HATU (3.8 g) and DIPEA (2.4 g) were added under stirring, followed by dropwise addition of 10 mL of a solution of compound h (containing 650 mg of compound h in DMF as the solvent). The mixture was then stirred at room temperature for 12 h, and 50 mL of water was added to stop the reaction. Then, extraction was performed three times with dichloromethane (20 mL each time), and the organic phases were combined. The combined organic phase was dried over anhydrous Na2SO4 and then concentrated by rotary evaporation under reduced pressure to a constant weight to obtain the crude product. The crude product was dissolved in the mobile phase (the mobile phase in step 11 consisted of 10 parts by volume of DCM and 1 part by volume of MeOH), then loaded onto a silica gel column (the packing of the silica gel column was silica gel of 100 - 200 mesh), and then eluted with the mobile phase. The target product was collected and concentrated by rotary evaporation under reduced pressure to a constant weight to obtain a pale yellow solid product, which was the methylenequinone precursor probe. The yield of the methylenequinone precursor probe was 530 mg, and the yield was 44%.

[0116] 12. Characterization of methylenequinone precursor probes

[0117] The hydrogen spectrum of the methylenequinone precursor probe is shown in Figure 2 .

[0118] The carbon spectrum of the methylenequinone precursor probe is shown in Figure 3 .

[0119] The molecular weight was identified using a Bruker Fourier transform high-resolution mass spectrometer as 1115.4982 (theoretical calculated value: chemical formula C 60 H 73 FN8O8PS positive ion molecular weight is 1115.4988).

[0120] After the above identification, the methylenequinone precursor probe is a compound with the structural formula shown in formula (I). The methylenequinone precursor probe has a biotin group.

[0121]

[0122] Example 2. Establishment of the method

[0123] The method for in-situ labeling of single-stranded nucleic acids in intracellular mitochondria includes the following steps:

[0124] 1. Cells are pre-plated in a culture dish and cultured until the cell density reaches over 90%. Discard the culture medium, add PBS buffer for washing once (the purpose is to remove dead cells floating during adherent cell culture), and then discard the PBS buffer.

[0125] 2. After completing step 1, add a culture medium containing a photosensitizer (the concentration of the photosensitizer is generally at the nM level and varies according to different cell types) to the culture dish, then culture for 30 minutes, then discard the culture medium, then add PBS buffer for washing twice (the purpose is to remove excess photosensitizer outside the cells), and then discard the PBS buffer.

[0126] 3. After completing step 2, add a culture medium to the culture dish, then culture for 5 minutes, and then discard the culture medium (the purpose is to remove as much free photosensitizer in the cells as possible).

[0127] 4. After completing step 3, add a culture medium containing a methylenequinone precursor probe (the concentration is generally 50 μM) to the culture dish, then culture for 30 minutes, then discard the culture medium, then add PBS buffer for washing twice (the purpose is to remove excess methylenequinone precursor probe outside the cells), and then discard the PBS buffer.

[0128] 5. After completing step 4, add a culture medium to the petri dish, then incubate for 5 minutes, and then discard the culture medium (the purpose is to remove as much as possible the free methylene quinone precursor probe inside the cells).

[0129] 6. After completing step 5, irradiate the cells in the petri dish with a blue light LED light source for 15 minutes (during this period, a large amount of active intermediates will be generated, so that the ribonucleic acid in the mitochondria is fully labeled), then remove the blue light source, collect the cells with a cell scraper, and store them at -80 °C.

[0130] The cells obtained in the above steps are the cells that have been in-situ labeled with mitochondrial single-stranded nucleic acid in the cells.

[0131] The cells that have been in-situ labeled with mitochondrial single-stranded nucleic acid in the cells can be subjected to subsequent analysis, so as to conduct transcriptome research. If fluorescence quantitative PCR (qPCR) analysis is required subsequently, 1×10 6 cells need to be collected. If high-throughput sequencing analysis is required subsequently, 1×10 7 cells need to be collected.

[0132] See the Figure 4 .

[0133] Example 3: In-situ labeling and transcriptome analysis of single-stranded nucleic acid in mitochondria of HeLa cells

[0134] The culture medium in this example refers to DMEM medium containing 10% fetal bovine serum.

[0135] I. Treatment of the experimental group (set 2 repeated treatments)

[0136] 1. Seed HeLa cells in a 10-cm diameter petri dish, and culture them with a culture medium until the cell density is above 90% (at this time, the number of cells in the petri dish is about 1×10 7 cells), discard the culture medium, add PBS buffer to wash once, and then discard the PBS buffer.

[0137] 2. After completing step 1, add a culture medium containing 50 nM photosensitizer to the petri dish, incubate for 30 minutes, then discard the culture medium, then add PBS buffer to wash twice, and then discard the PBS buffer.

[0138] 3. After completing step 2, add a culture medium to the petri dish, incubate for 5 minutes, and then discard the culture medium.

[0139] 4. After completing step 3, add a culture medium containing 50 μM methylene quinone precursor probe to the petri dish, incubate for 30 minutes, then discard the culture medium, then add PBS buffer to wash twice, and then discard the PBS buffer.

[0140] 5. After completing Step 4, add a culture medium to the petri dish, incubate for 5 minutes, and then discard the culture medium.

[0141] 6. After completing Step 5, irradiate the cells in the petri dish with a blue light LED light source for 15 minutes, then remove the blue light source, and collect the cells with a cell scraper (i.e., the cell sample of the experimental group), and store it at -80 °C.

[0142] II. Control Group Treatments (2 replicates are set for each)

[0143] Control Group 1: The difference from the treatment of the experimental group is only that the following step "add a culture medium containing 50 nM photosensitizer to the petri dish" is reduced, and a cell sample without photosensitizer is obtained.

[0144] Control Group 2: The difference from the treatment of the experimental group is only that the following step "add a culture medium containing 50 μM methylene quinone precursor probe to the petri dish" is reduced, and a cell sample without probe is obtained.

[0145] Control Group 3: The difference from the treatment of the experimental group is only that the following steps "irradiate the cells in the petri dish with a blue light LED light source for 15 minutes, and then remove the blue light source" are reduced, and a cell sample without blue light irradiation is obtained.

[0146] Control Group 4: Seed HeLa cells in a petri dish with a diameter of 10 cm, and culture them with a culture medium until the cell density is above 90% (at this time, the number of cells in the petri dish is about 1×10 7 cells), discard the culture medium, add PBS buffer for washing, then discard the PBS buffer, and collect the cells with a cell scraper (i.e., the cell sample of the untreated group), and store it at -80 °C.

[0147] III. Preparation of Nucleic Acid Samples

[0148] The test cell samples are respectively: the cell sample of the untreated group, the cell sample of the experimental group, the cell sample without photosensitizer, the cell sample without probe, or the cell sample without blue light irradiation.

[0149] 1. Take the test cell sample, and use TRIzol reagent (fully named TRIzol TM reagent, Thermo Fisher, product catalog number 15596018CN, operate according to the instruction manual) to extract RNA to obtain an RNA sample.

[0150] 2. Take the RNA sample obtained in Step 1, and use streptavidin magnetic beads (fully named Dynabeads TM MyOne TMEnrichment was performed using streptavidin C1 from Thermo Fisher (product catalog number 65001) according to the instructions to obtain the enriched RNA sample.

[0151] IV. Perform fluorescence quantitative PCR analysis

[0152] Take the RNA samples obtained from each of the test cell samples prepared in step III and the enriched RNA sample, and perform the following steps in sequence:

[0153] 1. Use the II First Strand cDNA Synthesis Kit from New England Biology (product catalog number E6560L) to perform reverse transcription according to the instructions to obtain the reverse transcription product.

[0154] 2. Take the reverse transcription product obtained in step 1 and use PowerUp TM SYBR TM Green Premix from Thermo Fisher (product catalog number A25742) and specific primer pairs to perform fluorescence quantitative PCR analysis on the StepOne Plus fluorescence quantitative PCR detection system from Applied Biosystem.

[0155] The targets to be detected are GAPDH, ACTNB, MTCO1, and MTND1. GAPDH and ACTNB are reported non-mitochondrial mRNAs. MTCO1 and MTND1 are reported mitochondrial-specific mRNAs.

[0156] Abundance of the target in the enriched RNA sample ÷ Abundance of the target in the RNA sample = Original enrichment factor. Take the original enrichment factor of the untreated cell sample as reference 1 and calculate the corrected enrichment factor.

[0157] The specific primer pairs for detecting GAPDH are as follows:

[0158] GAPDH_F (SEQ ID NO: 1): TGTCAAGCTCATTTCCTGGTAT;

[0159] GAPDH_R (SEQ ID NO: 2): CTCTCTTCCTCTTGTGCTCTTG.

[0160] The specific primer pairs for detecting ACTNB are as follows:

[0161] ACTNB_F (SEQ ID NO: 3): AGGCACCAGGGCGTGAT;

[0162] ACTNB_R (SEQ ID NO: 4): GCCCACATAGGAATCCTTCTGAC.

[0163] The specific primer pairs for detecting MTCO1 are as follows:

[0164] MTCO1_F (SEQ ID NO: 5): AGCCCACTTCCACTATGTCC;

[0165] MTCO1_R (SEQ ID NO: 6): TGGCGTAGGTTTGGTCTAGG.

[0166] The specific primer pairs for detecting MTND1 are as follows:

[0167] MTND1_F (SEQ ID NO: 7): CGATTCCGCTACGACCAACT;

[0168] MTND1_R (SEQ ID NO: 8): GGAATGCTGGAGATTGTAATGGG.

[0169] The results of the enrichment multiple correction value are shown in Figure 5 . The results show that the treatment in the experimental group significantly enriched mitochondrial nucleic acids.

[0170] Example 4. In-situ labeling and transcriptome analysis of single-stranded nucleic acids in mitochondria of HeLa cells

[0171] The culture media in this example all refer to DMEM culture media containing 10% fetal bovine serum.

[0172] I. Preparation of cell samples

[0173] Take HeLa cells as the cell samples before treatment (2 replicate samples).

[0174] Take HeLa cells and operate according to Step 1 of Example 3 to obtain the cell samples after treatment (2 replicate samples).

[0175] II. Preparation of nucleic acid samples

[0176] The test cell samples are respectively: the cell samples before treatment, the cell samples after treatment.

[0177] Proceed according to Step 3 of Example 3 to obtain the enriched RNA samples.

[0178] III. Transcriptome analysis

[0179] Respectively take the enriched RNA samples obtained from each test cell sample prepared in Step 3 and perform the following steps in sequence:

[0180] 1. Use SMART- Total RNA Pico Input (ZapR TM Mammalian) kit (TAKARA, catalog number 634357, operate according to the instructions) to prepare a sequencing library to obtain a library solution.

[0181] 2. Take the library solution and perform paired-end sequencing of 150 bp by Annoroad Gene Co., Ltd. using the Illumina HiSeq X Ten sequencer with a sequencing volume of 3 G to obtain the original sequencing results. First, confirm the data quality of the original sequencing results through the FastQC program package, then remove the sequencing adapters through the Cutadapt program package, and screen out the too long and too short sequencing Reads. Then, use the HISAT2 software package to perform sequence alignment with the human genome data packet GRCh38 (human genome assembly GRCh38, hg38). Then, use the HTSeq software package to count the Read counts of each gene, and use the DESeq2 software package to perform differential expression analysis of genes.

[0182] The results are shown in Figure 6 . Figure 6 A) in indicates the correlation analysis of different mitochondrial ribonucleic acids in two biological replicates. The closer the correlation coefficient R value is to 1, the higher the similarity of the same RNA in the two groups of sequencing samples, that is, the better the technical reproducibility. Figure 6 Figure B) in indicates the proportion of mitochondrial RNA in the sequencing results of the samples before and after labeling, indicating that through the labeling and enrichment of this method, mitochondrial RNA can be effectively captured and analyzed. Figure 6 Figure C) in indicates the analysis of the enrichment multiple and significance of different RNAs in the labeled samples. Near the upper right corner, that is, the RNA samples that are significantly present and significantly enriched in the samples are basically all mitochondrial RNAs. Figure 6 Figure D) in indicates the analysis of the enrichment degree of specific different types of RNAs (including mRNA, rRNA, tRNA) in mitochondria in the sequencing results, indicating that this method can effectively capture and analyze different types of RNAs.

[0183] Example 5. In-situ labeling and transcriptome analysis of single-stranded nucleic acids in mitochondria of RAW264.7 cells. The culture medium in this example refers to DMEM medium containing 10% fetal bovine serum.

[0184] I. Treatment of the experimental group (set 2 repeated treatments)

[0185] 1. Seed RAW264.7 cells in a 10-cm diameter culture dish and culture them with medium until the cell density is over 90% (at this time, the number of cells in the culture dish is approximately 1×10 7 cells). Discard the medium, add PBS buffer to wash once, and then discard the PBS buffer.

[0186] 2. After completing step 1, add medium containing 25 nM photosensitizer to the culture dish, culture for 30 minutes, then discard the medium, then add PBS buffer to wash twice, and then discard the PBS buffer.

[0187] 3. After completing step 2, add medium to the culture dish, culture for 5 minutes, and then discard the medium.

[0188] 4. After completing step 3, add medium containing 50 μM methylene quinone precursor probe to the culture dish, culture for 30 minutes, then discard the medium, then add PBS buffer to wash twice, and then discard the PBS buffer.

[0189] 5. After completing step 4, add medium to the culture dish, culture for 5 minutes, and then discard the medium.

[0190] 6. After completing step 5, irradiate the cells in the culture dish with a blue light LED light source for 15 minutes, then remove the blue light source, and collect the cells with a cell scraper (i.e., the experimental group cell sample), and store it at -80 °C.

[0191] II. Control group treatment (set 2 replicates for each)

[0192] Control group 1: The only difference from the treatment of the experimental group is that the following step "add medium containing 25 nM photosensitizer to the culture dish" is reduced, and the cell sample of the photosensitizer-free group is obtained.

[0193] Control group 2: The only difference from the treatment of the experimental group is that the following step "add medium containing 50 μM methylene quinone precursor probe to the culture dish" is reduced, and the cell sample of the probe-free group is obtained.

[0194] Control group 3: The only difference from the treatment of the experimental group is that the following steps "irradiate the cells in the culture dish with a blue light LED light source for 15 minutes, and then remove the blue light source" are reduced, and the cell sample of the blue light irradiation-free group is obtained.

[0195] Control group 4: Seed HeLa cells in a 10-cm diameter culture dish and culture them with medium until the cell density is over 90% (at this time, the number of cells in the culture dish is approximately 1×10 7Discard the culture medium, add PBS buffer for washing, then discard the PBS buffer, and collect the cells with a cell scraper (i.e., the cell sample of the untreated group), and store it at -80 °C.

[0196] III. Preparation of nucleic acid samples

[0197] The test cell samples are respectively: the cell sample of the untreated group, the cell sample of the experimental group, the cell sample without photosensitizer, the cell sample without probe, or the cell sample without blue light irradiation.

[0198] The method is the same as step III of Example 3.

[0199] IV. Perform fluorescence quantitative PCR analysis

[0200] Respectively take the RNA samples and the enriched RNA samples obtained from each of the test cell samples prepared in step III, and successively perform the following steps:

[0201] 1. Use II First Strand cDNA Synthesis Kit (New England Biology, product catalog number E6560L, operate according to the instruction manual) for reverse transcription to obtain the reverse transcription product.

[0202] 2. Take the reverse transcription product obtained in step 1, and use PowerUp TM SYBR TM Green Premix (Thermo Fisher, product catalog number A25742, operate according to the instruction manual) and specific primer pairs for fluorescence quantitative PCR analysis in the StepOne Plus fluorescence quantitative PCR detection system of Applied Biosystem.

[0203] The detection targets are GAPDH, ACTNB, MTCO1, and MTND1 respectively. GAPDH and ACTNB are reported non-mitochondrial mRNAs. MTCO1 and MTND1 are reported mitochondrial-specific mRNAs.

[0204] Abundance of the target in the enriched RNA sample ÷ Abundance of the target in the RNA sample = Enrichment multiple original value. Take the enrichment multiple original value of the cell sample of the untreated group as reference 1, and calculate the enrichment multiple correction value.

[0205] The specific primer pairs for detecting GAPDH are as follows:

[0206] GAPDH_F (SEQ ID NO: 9): TGCTGAGTATGTCGTGGAGT;

[0207] GAPDH_R (SEQ ID NO: 10): GTTCACACCCATCACAAACA.

[0208] The specific primer pair for detecting ACTNB is as follows:

[0209] ACTNB_F (SEQ ID NO: 11): CAGGTCATCACTATTGGCAA;

[0210] ACTNB_R (SEQ ID NO: 12): AGGTCTTTACGGATGTCAAC.

[0211] The specific primer pair for detecting MTCO1 is as follows:

[0212] MTCO1_F (SEQ ID NO: 13): GAGCTGCTGTTCGGTGTCC;

[0213] MTCO1_R (SEQ ID NO: 14): TGCCAGTGGTAGAGATGGTTG.

[0214] The specific primer pair for detecting MTND1 is as follows:

[0215] MTND1_F (SEQ ID NO: 15): ACACAGCAAGACGAGAAGACC;

[0216] MTND1_R (SEQ ID NO: 16): AGAAGAGCGATGGTGAGAGC.

[0217] The results of the enrichment multiple correction value are shown in Figure 7 . The results show that the treatment of the experimental group significantly enriched mitochondrial nucleic acids.

[0218] Example 6. Effects of Lipopolysaccharide Stimulation on the Mitochondrial Transcriptome of RAW264.7 Cells

[0219] In this example, the medium refers to DMEM medium containing 10% fetal bovine serum.

[0220] I. Treatment of the experimental group (set 2 repeated treatments)

[0221] 1. Seed RAW264.7 cells in a 10-cm diameter culture dish and culture them in a medium containing 0.2 μg / mL lipopolysaccharide until the cell density is over 90% (at this time, the number of cells in the culture dish is about 1×10 7(Remove the culture medium, add PBS buffer for washing once, and then discard the PBS buffer. Preparation method of the culture medium containing 0.2 μg / mL lipopolysaccharide: Add the lipopolysaccharide stock solution to the culture medium. Lipopolysaccharide stock solution: Dissolve lipopolysaccharide in DMSO to make its concentration 20 mg / ml.)

[0222] 2. The same as item 2 in Step 1 of Example 5.

[0223] 3. The same as item 3 in Step 1 of Example 5.

[0224] 4. The same as item 4 in Step 1 of Example 5.

[0225] 5. The same as item 5 in Step 1 of Example 5.

[0226] 6. The same as item 6 in Step 1 of Example 5.

[0227] II. Control group treatment (set 2 repeated treatments)

[0228] 1. Seed RAW264.7 cells in a 10-cm diameter culture dish and culture them with the culture medium containing DMSO until the cell density is over 90% (at this time, the number of cells in the culture dish is about 1×10 7 (Remove the culture medium, add PBS buffer for washing once, and then discard the PBS buffer. Preparation method of the culture medium containing DMSO: Replace the lipopolysaccharide stock solution with an equal volume of DMSO, and the others are the same as the culture medium containing 0.2 μg / mL lipopolysaccharide.)

[0229] 2. The same as item 2 in Step 1 of Example 5.

[0230] 3. The same as item 3 in Step 1 of Example 5.

[0231] 4. The same as item 4 in Step 1 of Example 5.

[0232] 5. The same as item 5 in Step 1 of Example 5.

[0233] 6. After completing Step 5, irradiate the cells in the culture dish with a blue light LED light source for 15 minutes, then remove the blue light source, and collect the cells with a cell scraper (i.e., the control group cell sample), and store it at -80°C.

[0234] III. Preparation of nucleic acid samples

[0235] The test cell samples are respectively: the test group cell sample and the control group cell sample.

[0236] The method is the same as Step 3 of Example 3.

[0237] IV. Perform fluorescence quantitative PCR analysis

[0238] Respectively take the enriched RNA samples obtained from each of the test cell samples prepared in Step 3.

[0239] The method is the same as Step 3 of Example 4.

[0240] The results are shown in Figure 8 . Figure 8 A) of Figure 8 and B) of Figure 8 respectively represent the correlation analysis between the replicate group samples under the conditions of LPS treatment and DMSO treatment for 24 hours. The closer the R value is to 1, the stronger the correlation between the replicate group samples, indicating that the method has high reproducibility.

[0241] Example 7. Differential Analysis of the Mitochondrial Transcriptome of RAW264.7 Cells under Different Lipopolysaccharide Stimulation Times

[0242] In this example, the culture medium refers to DMEM medium containing 10% fetal bovine serum. Preparation method of the culture medium containing 0.2 μg / mL lipopolysaccharide: Add the lipopolysaccharide stock solution to the culture medium. Lipopolysaccharide stock solution: Dissolve lipopolysaccharide in DMSO to make its concentration 20 mg / ml.

[0243] I. Preparation of 2h cell samples

[0244] 1. Seed RAW264.7 cells (0h cell samples) in a 10-cm diameter culture dish, culture with the culture medium containing 0.2 μg / mL lipopolysaccharide for 2 hours, then aspirate the supernatant, add the culture medium, and culture until the cell density is over 90% (at this time, the number of cells in the culture dish is about 1×10 7 cells), discard the culture medium, add PBS buffer to wash once, and then discard the PBS buffer.

[0245] 2. The same as Step 2 of Step 1 in Example 5.

[0246] 3. The same as Step 3 of Step 1 in Example 5.

[0247] 4. The same as Step 4 of Step 1 in Example 5.

[0248] 5. The same as Step 5 of Step 1 in Example 5.

[0249] 6. After completing Step 5, irradiate the cells in the culture dish with a blue LED light source for 15 minutes, then remove the blue light source, and collect the cells with a cell scraper (i.e., 2h cell samples), and store them at -80°C.

[0250] II. Preparation of 8h cell samples

[0251] 1. Seed RAW264.7 cells in a 10-cm diameter culture dish and culture them in a medium containing 0.2 μg / mL lipopolysaccharide for 8 hours. Then aspirate the supernatant, add fresh medium, and culture until the cell density is over 90% (at this time, the number of cells in the culture dish is approximately 1×10 7 cells), discard the medium, wash once with PBS buffer, and then discard the PBS buffer.

[0252] 2. The same as step 2 in step 1 of Example 5.

[0253] 3. The same as step 3 in step 1 of Example 5.

[0254] 4. The same as step 4 in step 1 of Example 5.

[0255] 5. The same as step 5 in step 1 of Example 5.

[0256] 6. After completing step 5, irradiate the cells in the culture dish with a blue light LED light source for 15 minutes, then remove the blue light source, and collect the cells with a cell scraper (i.e., the 8h cell sample), and store it at -80 °C.

[0257] III. Preparation of 24h cell sample

[0258] 1. Seed RAW264.7 cells in a 10-cm diameter culture dish and culture them in a medium containing 0.2 μg / mL lipopolysaccharide for 24 hours. Then aspirate the supernatant, add fresh medium, and culture until the cell density is over 90% (at this time, the number of cells in the culture dish is approximately 1×10 7 cells), discard the medium, wash once with PBS buffer, and then discard the PBS buffer.

[0259] 2. The same as step 2 in step 1 of Example 5.

[0260] 3. The same as step 3 in step 1 of Example 5.

[0261] 4. The same as step 4 in step 1 of Example 5.

[0262] 5. The same as step 5 in step 1 of Example 5.

[0263] 6. After completing step 5, irradiate the cells in the culture dish with a blue light LED light source for 15 minutes, then remove the blue light source, and collect the cells with a cell scraper (i.e., the 24h cell sample), and store it at -80 °C.

[0264] IV. Preparation of nucleic acid sample

[0265] The test cell samples are: 0h cell sample, 2h cell sample, 8h cell sample, 24h cell sample.

[0266] The method is the same as step 3 in Example 3.

[0267] V. Perform fluorescence quantitative PCR analysis

[0268] Respectively take the enriched RNA samples obtained from the 2-hour cell samples, the enriched RNA samples obtained from the 8-hour cell samples, and the enriched RNA samples obtained from the 24-hour cell samples.

[0269] The method is the same as step three of Example 4.

[0270] The results are shown in Figure 9 . Figure 9 A) of shows the dimensionality reduction clustering analysis of samples under different treatment times, proving that for biological replicate samples under different LPS treatment times, there is a certain similarity between biological replicates of different groups, and it has a certain clustering trend. Figure 9 B) of shows the change and analysis of the relative content of mitochondrial RNA under different treatment times, proving that this method can be effectively applied to analyze the abundance changes of different components in the mitochondrial transcriptome under a dynamically changing environment.

[0271] The above has described the present invention in detail. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although the present invention gives specific embodiments, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application and are made with conventional techniques known in the art. Some basic features can be applied according to the scope of the following appended claims.

Claims

1. A compound, which is a compound represented by formula (I), a derivative of the compound represented by formula (I), or an analogue of the compound represented by formula (I); 2. A compound, which is a compound represented by formula (IX), a derivative of the compound represented by formula (IX), or an analogue of the compound represented by formula (IX); In formula (IX), R1 is 4-azidobenzyl, o-nitrobenzyl, or 1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethoxy; In formula (IX), R2 is an alkyl group, a phenyl group, an amide group, a biotin group, an alkyne group, or an azide group.

3. Use of the compound according to claim 1 or 2; the use is as follows (a1) or (a2): (a1) Use in labeling mitochondrial nucleic acids of living cells; (a2) Use in preparing a kit for labeling mitochondrial nucleic acids of living cells.

4. Use of a photosensitizer and a compound; the use is as follows (a1) or (a2): (a1) Use in labeling mitochondrial nucleic acids of living cells; (a2) Use in preparing a kit for labeling mitochondrial nucleic acids of living cells; The compound is the compound according to claim 1 or 2.

5. Use of the compound according to claim 1 or 2; the use is as follows (b1) or (b2): (b1) Use in mitochondrial transcriptome analysis; (b2) Use in preparing a kit for mitochondrial transcriptome analysis.

6. Use of a photosensitizer and a compound; the use is as follows (b1) or (b2): (b1) Use in mitochondrial transcriptome analysis; (b2) Use in preparing a kit for mitochondrial transcriptome analysis; The compound is the compound according to claim 1 or 2.

7. A method for labeling mitochondrial nucleic acids of living cells, comprising the following steps: sequentially co-incubating living cells with a photosensitizer and the compound according to claim 1 or 2, and then performing blue light irradiation.

8. A method for mitochondrial transcriptome analysis, sequentially comprising the following steps: Labeling mitochondrial nucleic acids of living cells by using the method according to claim 7; Collecting cells, performing lysis and nucleic acid extraction, and then enriching and purifying the target nucleic acid by using streptavidin magnetic beads; Taking the target nucleic acid and performing transcriptome analysis.

9. A kit, comprising the compound according to claim 1 or 2.

10. A preparation method of the compound represented by formula (I) according to claim 1, comprising the following steps: (1) Reacting compound a with compound b to obtain compound c; (2) Reacting compound c with LiOH to obtain compound d; (3) Reacting compound d with compound e to obtain compound f; (4) Reacting compound f with trifluoroacetic acid to obtain compound g; (5) Reacting compound g with compound h to obtain the compound according to claim 1; The compound a is as shown in formula (III); The compound b is methyl (S)-6-amino-2-((tert-butoxycarbonyl)amino)hexanoate hydrochloride; The compound c is as shown in formula (IV); The compound d is as shown in formula (V); The compound e is N-(2-(2-(2-aminoethoxy)ethoxy)ethyl)-5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanamide; The compound f is as shown in formula (VI); The compound g is as shown in formula (VII); The compound h is (3-carboxypropyl)triphenylphosphonium bromide;

Images