A special synergistic adjuvant for metarhizium rileyi mr006
By combining lecithin adjuvant with Metarhizium anisopliae Mr006, the problems of unstable efficacy and slow insecticidal speed in pest control were solved, achieving high-efficiency control of beet armyworm and rice stem borer, and providing an environmentally friendly biological control method for pests.
Patent Information
- Application Number
- CN202510432614.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-08
- Publication Date
- 2026-01-09
- Estimated Expiration
- 2045-04-08
AI Technical Summary
Existing entomopathogenic fungi, such as Metarhizium anisopliae, have unstable efficacy and slow insecticidal speed in pest control. Furthermore, the long-term use of chemical agents has led to pest resistance. Therefore, alternative measures need to be found to improve insecticidal efficacy and environmental friendliness.
The combined application of lecithin adjuvant and Metarhizium anisopliae Mr006 enhances the adhesion and stability of the fungus to pests by increasing spore germination rate, mycelial growth and sporulation, regulating the lipid metabolism of pests, reducing the pests' resistance to fungi, and utilizing agricultural organosilicon and green orange peel oil to improve permeability and efficacy.
It significantly improved the control effect of Metarhizium anisopliae Mr006 on beet armyworm and rice stem borer, shortened the infection time, enhanced insecticidal activity and control efficacy, and provided technical support for green agriculture.
Smart Images

Figure CN120249168B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of microbial pesticides, and particularly relates to a special synergistic adjuvant for Metarhizium rileyi Mr006, which is used for improving the prevention and control of lepidopteran pests such as Spodoptera exigua and Chilo suppressalis. BACKGROUND
[0002] Entomopathogenic fungi are a class of microorganisms that were first identified as insect pathogens, and are also an important resource that can be developed into environmentally friendly biological pesticides. Entomopathogenic fungi are numerous in species, grow and reproduce rapidly, and are easy to produce in large quantities. Under suitable conditions, they can cause a fungal epidemic in insect populations, effectively controlling the growth of insect population density. In addition, the infection of pests can be achieved not only through the body wall, but also through the digestive tract and respiratory tract of the host. Due to its unique mode of infection and its advantages in quantity and target object, entomopathogenic fungi have become the preferred object of biological pest control. Today, various entomopathogenic fungi such as Beauveria bassiana, Metarhizium rileyi, and Metarhizium anisopliae have been developed and widely used in the control of pests in farmland, greenhouse, and other environments. Research has found that the use of fungi to control pests is not only environmentally friendly, but also overcomes the development of insect resistance to chemical pesticides.
[0003] Although entomopathogenic fungi have potential as a biological insecticide, their actual effect is greatly influenced by environmental factors such as temperature and humidity. Therefore, in practical application, their control effect is not stable, and the insecticidal speed is relatively slow. These problems limit the popularization and application of entomopathogenic fungi in agricultural control. In order to overcome these challenges, scholars at home and abroad are actively seeking effective methods to improve the insecticidal effect of entomopathogenic fungi to enhance their application in biological control.
[0004] It has been reported that the addition of nutrients can increase the sporulation of entomopathogenic fungi or promote the germination of spores, thereby shortening the infection time of target pests and achieving the effect of improving the infection toxicity. Surfactants are a commonly used carrier and one of the most important adjuvants, which have excellent wetting and penetration properties, can reduce the surface tension of the hydrophobic conidiospores of entomopathogenic fungi, and thus enhance their insecticidal effect. However, there are few examples of the combined use of other types of adjuvants with entomopathogenic fungi, and the compatibility and synergistic effect need to be explored.
[0005] Metarhizium rileyi Mr006 was isolated and identified from the cadavers of Spodoptera exigua infected with entomopathogenic fungi in the corn planting area of Taihe by the biological control team of the Institute of Plant Protection and Agricultural Product Quality and Safety of Anhui Academy of Agricultural Sciences. The Metarhizium rileyi Mr006 has been disclosed in CN202210572361.8 and preserved in the China General Microbiological Culture Collection Center on May 9, 2022, with the address being No. 1, Beichen West Road, Chaoyang District, Beijing, and the preservation number being CGMCC NO. 40171.
[0006] The specific sequencing results are as follows (540bp):
[0007] GCTACCTGATTCGAGGTCACTCTTGGAGAAGTTTGTGCGTTTTACGGCAGTGGCCGCGCCGCGCTCCTGTTGCGAGGTTGTGCTACTACGCAGAGGAGGCCGCGACGGGGCCGCCAATTCATTTCGGGGGCGGCGCCGCAGGGAACCGCCTGAGCGGCCCGGCTGACAATCGCCGGCCCCCAACACCAAACCGCGGGGGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTTGTATGATTCCACTCAGACGTGCCAAAGGCTAAGAGATACAGAGTTTCGGTCCCGCGGCGGGCGCCTGTTTCCGGGCGGGCTCTGGACGAGCCCGGTCCGGGGCAAATGACCCGCCGAGGCAACAGGAAAAGGGTATAAGTTCACATGGGGTTGGGAGTGA
[0008] Long-term chemical drugs have led to the resistance of pests to traditional pesticides, and the large-scale use of chemical agents has also brought a series of environmental ecological problems, which have forced to find alternative measures. As a widely used insect pathogenic microorganism, Metarhizium rileyi Mr006 and other entomopathogenic fungi have shown good insecticidal effect in previous laboratory studies, but there are some shortcomings such as unstable control effect, narrow insecticidal spectrum, slow effect, etc. in field use. In order to develop and promote the application of entomopathogenic fungi in biological control of pests, in addition to the technology of combined application of fungi and drugs, the compatibility of different types of adjuvants with Metarhizium rileyi Mr006 is explored, the effects of adjuvants on germination rate, colony diameter and spore yield are determined, and the synergistic effect of adjuvants on insecticidal toxicity is further evaluated, so as to obtain an application technology for improving the efficient control of Metarhizium rileyi Mr006, and also provide a new method for green control of harmful organisms. SUMMARY
[0009] The application belongs to the technical field of microbial pesticides, and particularly relates to a special synergistic adjuvant for Metarhizium rileyi Mr006, which is used for improving the prevention and control of lepidopteran pests such as Spodoptera exigua and Chilo suppressalis.
[0010] The lecithin adjuvant is used for improving the spore germination rate, mycelium growth and spore production of Metarhizium rileyi.
[0011] The lecithin adjuvant is used for improving the insecticidal activity or insecticidal time effect of Metarhizium rileyi on Spodoptera exigua.
[0012] The lecithin adjuvant is used for improving the prevention and control effect of Metarhizium rileyi on crop pests, and the crop pests are Spodoptera exigua and Chilo suppressalis.
[0013] Preferably, the Metarhizium rileyi is Metarhizium rileyi Mr006.
[0014] The microbial composition containing Metarhizium rileyi comprises Metarhizium rileyi and lecithin, the concentration of the Metarhizium rileyi spore suspension is 1.0*10 6 spores / mL-1.0*10 9 spores / mL, and the mass concentration of lecithin in the composition is 0.05-1%.
[0015] Preferably, the concentration of the Metarhizium rileyi spore suspension is 1.0*10 6 spores / mL-1.0*10 8 spores / mL, and the mass concentration of lecithin in the composition is 0.05-0.5%.
[0016] The adjuvant type screened in the application is as follows:
[0017] The agricultural organosilicon is mainly composed of ethoxy-modified trisiloxane, is a polyether-modified special organosilicon surfactant, has low surface tension, super strong spreading property, excellent permeability, high efficiency of internal absorption and conduction, can enhance the adhesion of pesticide solution, and improves the utilization rate of pesticides.
[0018] The green peel orange oil is extracted from unique raw materials of green peel orange, the main component of which is D-limonene, the penetration intensity and physical sealing effect are improved, and therefore the pesticide efficacy is improved.
[0019] Lecithin, specifically animal-derived lecithin, is mainly extracted from animal tissues or by-products such as egg yolk, dairy products (milk), etc. The most common source is egg yolk lecithin. Animal-derived lecithin has a high content of phosphatidylcholine (PC) (60-70%), as well as phosphatidylethanolamine (PE) and phosphatidylinositol (PI). It has the functions of emulsification and oil decomposition, and can be used as a surfactant in agriculture to help pesticides adhere uniformly to plant leaves or insect bodies, thereby improving efficacy. However, due to its high cost, its application is relatively limited. In the present invention, animal-derived lecithin is used, which can be extracted from milk or egg yolk.
[0020] PDMS-01 is a dimethylpolysiloxane-containing wetting composition (Patent Application No. 2022108986649) developed by the Institute of Plant Protection and Agricultural Product Quality and Safety of Anhui Academy of Agricultural Sciences.
[0021] Compared with the prior art, the present invention has the following beneficial technical effects:
[0022] The present invention proves that lecithin adjuvant has good compatibility with Metarhizium rileyi Mr006, can effectively promote sporulation, significantly improve the insecticidal activity of Metarhizium rileyi Mr006, effectively shorten the infection time of the target pests, and improve the insecticidal time efficiency of Metarhizium rileyi Mr006. When Metarhizium rileyi Mr006 is combined with lecithin, lecithin has a synergistic effect on Metarhizium rileyi Mr006, which can improve the control efficiency of Spodoptera exigua and Chilo spp., but has no effect on the control efficiency of Ostrinia furnacalis.
[0023] Lecithin can be used as a carrier for conidia of Metarhizium rileyi, improving its adhesion and stability on the surface of pests; by regulating the lipid metabolism of pests, it can reduce the resistance of pests to Metarhizium rileyi. At the same time, the antioxidant effect of lecithin can protect the activity of conidia of Metarhizium rileyi and improve its infection efficiency.
[0024] The combination of Metarhizium rileyi and lecithin has a significant synergistic effect in the control of agricultural pests. Lecithin can enhance the adhesion and stability of Metarhizium rileyi, improve its lethality to pests, and has high safety to non-target organisms, providing new technical support for the development of green agriculture. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 Effect of different treatments on the germination rate of Metarhizium rileyi Mr006
[0026] Figure 2 Effect of different treatments on the colony diameter of Metarhizium rileyi Mr006
[0027] Figure 3 Effect of different treatments on the sporulation yield per unit area of Metarhizium rileyi Mr006 DETAILED DESCRIPTION
[0028] The application can be better understood in accordance with the following examples. However, it will be readily apparent to those skilled in the art that the examples described are for purposes of illustration only and should not be so limited.
[0029] Example 1, Screening Test of Special Synergistic Adjuvant for Metarhizium rileyi Mr006
[0030] Metarhizium rileyi Mr006 has good effect on Spodoptera frugiperda, Spodoptera exigua, Spodoptera litura and so on. Based on this, the effects of four adjuvants (silicone, orange peel oil, lecithin, PDMS-01) on the germination rate, colony diameter and sporulation of Metarhizium rileyi Mr006 were studied to determine the compatibility of the test adjuvants with entomopathogenic fungi and to determine the effect of adjuvants on insecticidal toxicity, thereby providing a theoretical basis for exploring the efficient application of Metarhizium rileyi Mr006.
[0031] I. Materials and Methods
[0032] 1. Test strains and insects
[0033] The test entomopathogenic fungi Metarhizium rileyi Mr006 were provided by the Institute of Plant Protection and Agricultural Product Quality and Safety of Anhui Academy of Agricultural Sciences.
[0034] The Spodoptera exigua used in this test were artificially bred in the laboratory, and the environmental conditions of the insect breeding room were temperature (27±1℃), relative humidity (70±10%), and photoperiod L:D=16h:8h.
[0035] The Chilo suppressalis population was a gift from Professor Qiu Lin of Hunan Agricultural University, and the breeding conditions were temperature (28±1)℃, relative humidity 70%-80%, and photoperiod 16L:8D, and 3rd instar larvae with uniform size and good growth were selected for testing.
[0036] The Ostrinia furnacalis were all bred in the laboratory and were bred in the insect breeding room at a temperature of (27±1)℃, relative humidity of 50%-75%, and photoperiod of L / / D=14h / / 10h, and 3rd instar larvae of the same age were selected for testing.
[0037] 2. Culture medium
[0038] Sabouraud Maltose Agar with Yeast Extract (SMAY): 75g of powdered SMAY reagent was weighed, stirred uniformly in an appropriate amount of distilled water until no lumps or fine powders were formed, boiled on an electric stove until the water boiled, and then sterilized to 1L in a 121℃ high-pressure steam sterilization pot for 20min.
[0039] 3. Test adjuvant
[0040] Adjuvant a - one kind of organosilicon, adjuvant b - one kind of plant essential oil, adjuvant c - one kind of lecithin, adjuvant d - PDMS-01, wherein the adjuvant d is configured by Anhui Academy of Agricultural Sciences.
[0041] 4. Test method
[0042] 4.1 Test of the influence of four adjuvants on the growth of Metarhizium rileyi Mr006
[0043] The four adjuvants (organosilicon, orange oil, lecithin, and PDMS-01) were filtered into centrifuge tubes, shaken for 3 minutes, and then placed in an ultra-clean workbench for standby. After the culture medium was sterilized, two concentrations (0.5% and 0.05%) were prepared in the ultra-clean workbench (see Table 1 for details), and about 15 mL of culture medium was poured into each plate and cooled. Metarhizium rileyi Mr006 was cultured on SMAY plates for 14 days, and the spores were washed off using sterile water containing 0.05% Tween-80, collected in a beaker, stirred thoroughly with a magnetic stirrer, and diluted to the appropriate concentration. The spore concentration was checked using a microscope and a hemocytometer, and adjusted to 1.0 x 10 8 spores / mL as the mother liquor. 2 μL of the prepared 1 x 10 7 spores / mL suspension was added to the center of each cooled plate.
[0044] Table 1 Treatment of Metarhizium rileyi Mr006 with four adjuvants
[0045]
[0046]
[0047] Note: Adjuvant a: organosilicon; Adjuvant b: orange oil; Adjuvant c: lecithin; Adjuvant d: PDMS-01
[0048] 4.1.1 Effect of adjuvants on spore germination
[0049] In a 50 mL centrifuge tube, 18 mL of SMY culture solution and 2 mL of spore solution with different adjuvants (see Table 1) were added in sequence, and the final concentration of spores was 1.0 x 10 7 spores per milliliter. Then, the centrifuge tube was tied with a rubber band and placed in a shaking bed, set at a temperature of (28 ± 1) °C and a rotation speed of 150 r / min. Metarhizium rileyi Mr006 was cultured for 18 hours and then removed. The spore germination was observed using a microscope. Each treatment was repeated three times, and 100 spores were observed each time. The number of germinated spores was recorded, and the spore germination rate was calculated. At the same time, the spore solution without adjuvant was used as a control group for the experiment.
[0050] 4.1.2 Effect of adjuvants on mycelial growth
[0051] The SMAY medium was added with an appropriate amount of adjuvant to prepare a medium containing 0.05% and 0.5% adjuvant, respectively. The spore suspension was inoculated in the center of the medium containing different concentrations of adjuvant, and the medium was closed and cultured in an incubator. After 15 days of culture, the colony diameter was measured by cross method. Each treatment was repeated 3 times, and the medium without adjuvant was set as a control group.
[0052] 4.1.3 Effect of adjuvant on spore production
[0053] Spores were scraped from each colony of Metarhizium rileyi Mr006 cultured for 15 days using a glass coating rod and transferred into sterile water containing 0.05% Tween-80. After mixing and shaking for 10 minutes, the spore solution was appropriately diluted, and the spore concentration was checked under a microscope using a hemocytometer. The spore production per unit area of each treatment was calculated using the spore concentration and colony diameter to compare the spore production under different treatment conditions.
[0054] 4.2 Determination of insecticidal activity of Metarhizium rileyi Mr006
[0055] The prepared spore suspension was diluted to 1.0 x 10 8 spores / mL, 1.0 x 10 7 spores / mL, 1.0 x 10 6 spores / mL, 1.0 x 10 5 spores / mL, and 1.0 x 10 4 spores / mL. 0.05% Tween-80 aqueous solution was used as a control. The 3rd instar larvae were placed in a tea strainer with a brush and soaked in the spore suspension for 20 seconds, then taken out and placed on sterile filter paper to absorb excess water, and then transferred to artificial feed for feeding. The number of dead insects was recorded every day for 11 consecutive days. The test used a 12-hole cell culture plate, and the paper was sprayed with sterile water for moisturizing. Each treatment had 3 replicates, and each replicate had 24 heads. The method for determining insecticidal activity of different concentrations of adjuvant added to the above spore suspension was the same as above.
[0056] 4.3 Determination of control effect on different pests by potting test
[0057] Twelve pots of rice seedlings, soybean seedlings, and corn seedlings cultured in sterile soil were selected indoors, respectively, and 20 3rd instar larvae of Chilo suppressalis, Spodoptera exigua, and Ostrinia furnacalis were introduced into each pot, i.e. 5 pots for each treatment (i.e. 5 x 1 replicates), and 240 larvae of Chilo suppressalis, Spodoptera exigua, and Ostrinia furnacalis, respectively. 1.0 x 10 7 spores / mL of Metarhizium rileyi Mr006 spore suspension, 1.0 x 10 7Spores / mL Metarhizium rileyi Mr006 spore suspension + 0.5% lecithin adjuvant, 0.5% lecithin adjuvant, 0.05% Tween-80 aqueous solution, placed in a greenhouse for 14 days of moisture isolation culture, check the death situation, calculate the corrected mortality rate.
[0058] II. Results and analysis
[0059] 1. Effect of four adjuvants on the germination rate of Metarhizium rileyi Mr006
[0060] Table 2 Effect of different treatments on the germination rate of Metarhizium rileyi Mr006
[0061]
[0062] (a1: 0.5% silicone, b1: 0.5% bergamot oil, c1: 0.5% lecithin, d1: 0.5% PDMS-01, a2: 0.05%
[0063] silicone, b2: 0.05% bergamot oil, c2: 0.05% lecithin, d2: 0.05% PDMS-01)
[0064] From Figure 1 and Table 2, the four adjuvants showed different effects on the germination rate of Metarhizium rileyi Mr006 due to different concentrations and types. Except for 0.05% silicone, the rest of the treatments had a significant difference (p<0.01) compared with the control group. The 0.5% silicone treatment inhibited germination, the 0.5% and 0.05% PDMS-01 treatments did not germinate, and the 0.5% bergamot oil and 0.5% and 0.05% lecithin treatments promoted germination.
[0065] 2. Effect of four adjuvants on the colony diameter of Metarhizium rileyi Mr006
[0066] Table 3 Effect of different treatments on the colony diameter of Metarhizium rileyi Mr006
[0067]
[0068] (a1: 0.5% silicone, b1: 0.5% bergamot oil, c1: 0.5% lecithin, d1: 0.5% PDMS-01, a2: 0.05%
[0069] silicone, b2: 0.05% bergamot oil, c2: 0.05% lecithin, d2: 0.05% PDMS-01)
[0070] From Figure 2From Table 3, it can be seen that the four additives had different effects on the colony diameter of Metarhizium rileyi Mr006 due to different concentrations and types. The 0.5% silicone, 0.5% orange peel oil, 0.5% and 0.05% PDMS-01 additives had inhibitory effects on colony growth, and the 0.5% and 0.05% lecithin had no significant difference (p < 0.05) compared with the control group.
[0071] 3. Effects of four additives on the sporulation yield per unit area of Metarhizium rileyi Mr006
[0072] Table 4 Effects of different treatments on the sporulation yield per unit area of Metarhizium rileyi Mr006
[0073]
[0074] (a1: 0.5% silicone, b1: 0.5% orange peel oil, c1: 0.5% lecithin, d1: 0.5% PDMS-01, a2: 0.05% silicone, b2: 0.05% orange peel oil, c2: 0.05% lecithin, d2: 0.05% PDMS-01)
[0075] From Figure 3 From Table 4, it can be seen that the four additives had different effects on the sporulation yield per unit area of Metarhizium rileyi Mr006 due to different concentrations and types. The 0.5% lecithin had a promoting effect on the sporulation yield per unit area of Metarhizium rileyi Mr006, with a sporulation yield of 3.180 × 10 7 / cm 2 , which was significantly different (p < 0.01) compared with the control group. The other treatments had inhibitory effects on the sporulation yield of Metarhizium rileyi Mr006, which was extremely significantly different (p < 0.01) compared with the control group, and the treatments with 0.5% and 0.05% PDMS-01 additives did not produce spores.
[0076] The above test results show that silicone, orange peel oil, lecithin, and PDMS-01 have different effects on the growth of Metarhizium rileyi Mr006 due to different concentrations and types. The 0.5% and 0.05% PDMS-01 had inhibitory effects on spore germination, colony growth, and sporulation, and had poor compatibility with Metarhizium rileyi Mr006. The addition of 0.5% lecithin in the culture medium resulted in the highest sporulation yield per unit area of Metarhizium rileyi Mr006, which was 3.18 × 10 8 / cm 2 , which was 121.28% higher than the control group of 1.4373 × 10 8 / cm 2 , and had a significant promoting effect on sporulation. The other treatments had inhibitory effects on the sporulation yield of Metarhizium rileyi Mr006.
[0077] The concentration of 0.5% lecithin adjuvant has good compatibility with Metarhizium rileyi Mr006, which can promote sporulation. Subsequently, 0.5% lecithin will be added to the spore solution for soaking pest larvae such as Spodoptera exigua, and the LC 50 (50% lethal concentration), LT 50 (50% lethal time) will be determined to study whether the lecithin adjuvant can improve the infection toxicity and shorten the infection time of the target pests.
[0078] Table 5 LC 50 (50% lethal concentration) of Spodoptera exigua larvae by Metarhizium rileyi Mr006 and lecithin adjuvant
[0079]
[0080] 4. Determination of insecticidal activity of Metarhizium rileyi Mr006
[0081] From Table 5, the addition of 0.05% and 0.5% lecithin can reduce the LC 50 (50% lethal concentration) of Metarhizium rileyi Mr006 to Spodoptera exigua, with a reduction of more than 26 times for 0.5% lecithin, significantly improving the insecticidal activity of Metarhizium rileyi Mr006 to Spodoptera exigua.
[0082] Table 6 LT
[0083] Metarhizium rileyi Mr006 treatment concentration (spores / mL) Median lethal time LT50 50 (d)]]> 10 6 ]] 12.63±3.05a 10 7 ]] 11.12 ± 1.51 ab 10 8 ]] 8.77 ± 1.55 bc 10 6 + 0.05% lecithin 12.61±3.09a 10 7 + 0.05% lecithin 9.42 ± 1.01 abc 10 8 + 0.05% lecithin 7.75 ± 1.31 bc 10 6 + 0.5% lecithin 9.09 ± 0.53 abc 10 7 + 0.5% lecithin 7.46±1.13c 10 8 + 0.5% lecithin 7.06±0.48c
[0084] From Table 6, the addition of 0.05% and 0.5% lecithin can reduce the LT 50 (50% lethal time) of Metarhizium rileyi Mr006 to Spodoptera exigua. Among them, the addition of 0.5% lecithin to spore suspensions of 1.0×10 6 spores / mL, 1.0×10 7 spores / mL, and 1.0×10 8 spores / mL can shorten the LT 50 values by 3.54d, 3.66d, and 1.71d, respectively, effectively shortening the infection time of the target pests and improving the insecticidal time of Metarhizium rileyi Mr006 to Spodoptera exigua.
[0085] 5. Pot experiment to determine the control effect on different pests
[0086] Table 7 Control effect of Metarhizium rileyi Mr006 + lecithin adjuvant on Spodoptera exigua
[0087]
[0088]
[0089] As shown in Table 7, after adding 0.5% lecithin adjuvant, the average corrected mortality of L. lecanicum Mr006 to Spodoptera exigua was increased from 40.68% to 62.07%, which proved that 0.5% lecithin could improve the control effect of L. lecanicum Mr006 on Spodoptera exigua.
[0090] Table 8 Control effect of L. lecanicum Mr006 + lecithin adjuvant on Chilo suppressalis
[0091]
[0092] As shown in Table 8, after adding 0.5% lecithin adjuvant, the average corrected mortality of L. lecanicum Mr006 to Chilo suppressalis was increased from 38.33% to 52.54%, which proved that 0.5% lecithin could improve the control effect of L. lecanicum Mr006 on Chilo suppressalis.
[0093] Table 9 Control effect of L. lecanicum Mr006 + lecithin adjuvant on Ostrinia nubilalis
[0094]
[0095]
[0096] As shown in Table 9, after adding 0.5% lecithin adjuvant, the average corrected mortality of L. lecanicum Mr006 to Ostrinia nubilalis was basically unchanged, which proved that 0.5% lecithin had no effect on the control effect of L. lecanicum Mr006 on Ostrinia nubilalis.
[0097] The results of the early experiment showed that the lecithin adjuvant had good compatibility with Beauveria bassiana Bb455 and Metarhizium anisopliae Ma40 preserved in the laboratory, and could promote sporulation, but had no effect on the LC 50 (median lethal concentration), LT 50 (median lethal time) of the target pests.
[0098] The above only describes the preferred embodiments of the present application, and those skilled in the art can make appropriate improvements without departing from the raw materials of the present application, and these improvements are also within the protection scope of the present application.
Claims
1. Use of lecithin for increasing the spore germination rate and the amount of spores produced by Metarhizium rileyi, characterized in that, The mass concentration of lecithin is 0.5%, and the Metarhizium rileyi is Metarhizium rileyi Mr006 with a preservation number of CGMCC NO.40171.
2. Use of lecithin for increasing the insecticidal activity or the persistence of the insecticidal action of Metarhizium leucotogipes against Spodoptera exigua, characterized in that, The mass concentration of lecithin is 0.5%, the Metarhizium rileyi is Metarhizium rileyi Mr006, the preservation number is CGMCC NO.40171, and the spore suspension concentration of the Metarhizium rileyi is 1.0×10 6 spores / mL. 9 spores / mL.
3. Use of lecithin for increasing the efficacy of Metarhizium rileyi against crop pests, characterized in that, The crop pest is Spodoptera exigua or Chilo suppressalis; the mass concentration of lecithin is 0.5%, and the Metarhizium rileyi is Metarhizium rileyi Mr006 with a preservation number of CGMCC NO.40171.
4. A microbial composition comprising Metarhizium rileyi, characterized in that, The composition comprises Metarhizium rileyi and lecithin. The concentration of the suspension of Metarrhizium anisopliae spores is 1.0 x 10 6 spores / mL - 1.0 x 10 9 spores / mL; The mass concentration of lecithin in the composition is 0.5%. The Metarhizium rileyi is Metarhizium rileyi Mr006 with a preservation number of CGMCC NO.40171.
Citation Information
Patent Citations
Culture medium for promoting spore production of metarhizium ledebusii Mr006 as well as preparation and application of culture medium
CN115747130A
Insecticidal composition containing beauveria bassiana and preparation method thereof
CN109511682A
Application of lecithin in preparation of microsporidia biopesticide
CN115960813A