Primer group and kit for detecting EWSR1 non-ETS fused round cell sarcoma and application of primer group and kit

Abstract

The invention relates to the field of biological detection, in particular to a primer group and a kit for fusing round cell sarcoma by using EWSR1 non-ETS and a use method. The EWSR1 non-ETS fused round cell sarcoma detection primer group comprises nine primer sequences, namely a primer group A and a primer group B. The primer group A and the primer group B are used for detecting EWSR1 non-ETS fused round cell sarcoma. According to the invention, the variation types of the EWSR1 non-ETS fusion sarcoma are divided into five variation types, the five fusion variation types are divided into two groups, two groups of upstream and downstream amplification primer groups are designed in a targeted manner, and each fusion variation type can be amplified to obtain a target product peak with the size of 100-250 bp, so that the target product peak can be amplified to obtain a target product peak with the size of 100-250 bp. The primer provided by the invention can be used for detecting five variation types fused by three types of genes at one time. Through combined application of the primer group, multiple fluorescent PCR and high-resolution capillary electrophoresis, the lowest detection limit is 10 copies, and the sensitive and efficient detection method for the EWSR1 non-ETS fused round cell sarcoma is provided and has the characteristics of simplicity, convenience, accurate result and economic benefit.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection, and particularly relates to a primer set, a kit and an application for detecting EWSR1 non-ETS fusion round cell sarcoma. Background Art

[0002] EWSR1 non-ETS fusion round cell sarcoma is a type of round and spindle cell sarcoma with the fusion of EWSR1 gene and non-ETS family genes, belonging to a kind of Ewing-like sarcoma. This type of sarcoma was reclassified as "round cell sarcoma with EWSR1 non-ETS fusion" in the 2020 WHO classification, with characteristic fusion genes, mainly including three fusion types: EWSR1::NFATC2, FUS::NFATC2 and EWSR1::PATZ1. The tumor cells of EWSR1::NFATC2 or FUS::NFATC2 fusion sarcoma are mostly small to medium-sized round or spindle-shaped, arranged in cords, small nests, trabeculae or pseudoacinar patterns, with eosinophilic or transparent cytoplasm, the nuclear morphology can be consistent or significantly pleomorphic, chromatin is densely stained or vacuolated, nucleoli are small or prominent, with hyaline or myxoid stroma, and the number of mitotic figures can be more or less. 50% of the cases show diffuse positivity for CD99, punctate positivity for AE1 / AE3 adjacent to the nucleus, can express NKX2.2, PAX7, focally express CD138, and show high expression of Ki-67. The tumor cells of EWSR1-PATZ1 fusion sarcoma are small round or spindle-shaped cells, often accompanied by fibrous stroma, and necrosis and mitotic figures can be obvious or not obvious.

[0003] EWSR1 non-ETS fusion round cell sarcoma is very rare, with complex and diverse histomorphology, and has certain similarities in histological and immunohistochemical characteristics with various round cell and spindle cell bone and soft tissue sarcomas such as Ewing sarcoma, CIC-rearranged sarcoma, sarcoma with BCOR genetic alterations, myoepithelial tumor, extraskeletal myxoid chondrosarcoma, ossifying fibromyxoid tumor, sclerosing epithelioid fibrosarcoma, etc., and needs to be differentiated from multiple bone and soft tissue sarcomas in clinical diagnosis. It is difficult to make a differential diagnosis solely based on histomorphology and immunohistochemical expression, and there is an urgent need for a sensitive and efficient method for detecting genetic variations.

[0004] The main methods for clinically detecting gene variations of such tumors include fluorescence in situ hybridization, polymerase chain reaction (PCR) method, next-generation sequencing, etc. Fluorescence in situ hybridization is suitable for the detection of a single fusion gene and is not suitable for screening multiple variations. Next-generation sequencing based on RNA / DNA is costly, has complex procedures, a long detection cycle, and is difficult to implement clinically. Summary of the Invention

[0005] To solve the above technical problems, based on the combined application method of multiplex fluorescence PCR and high-resolution capillary electrophoresis, the present application provides a primer set, a kit and their applications for detecting EWSR1 non-ETS fusion round cell sarcoma, which are characterized by being simple and convenient, having accurate results and being economically favorable.

[0006] The present invention sorted out the literature reports and the samples detected in the local laboratory, totaling more than a hundred cases of EWSR1 non-ETS sarcoma fusion gene data, unified the reference gene transcripts, and summarized 5 variant combination types according to the 3 common types of gene fusions in EWSR1 non-ETS fusion sarcoma (EWSR1::NFATC2, FUS::NFATC2, and EWSR1::PATZ1): T1: EWSR1 Exon5 :: NFATC2 Exon3; T2: EWSR1 Exon6 :: NFATC2 Exon3; T3: EWSR1 Exon8 :: NFATC2 Exon3; T4: FUS Exon6 :: NFATC2 Exon3; T5: EWSR1 Exon8 :: PATZ1 Eoxn1 (11 cleavage and fusion sites).

[0007] The 5 variant types are divided into the NFATC2-related fusion genes in tube A and the EWSR1::PATZ1-related fusion genes in tube B. Based on the above tube separation, specific upstream and downstream primers for each variant type are designed and combined for tube testing. The present invention also designs two sets of upstream and downstream amplification primer combinations to meet the purpose of amplifying target product peaks with a size of 100 - 250 bp for each fusion type.

[0008] According to the primer set for detecting EWSR1 non-ETS fusion round cell sarcoma in the specific embodiment of the present invention, it includes at least one of primer set A and primer set B, wherein Primer set A: includes upstream primers SEQ ID NO.1 - 4 and downstream primer SEQ ID NO.5, SEQ ID NO.1: 5’-TGATACCACCACTGCTACA-3’; SEQ ID NO.2: 5’-GGATATGGACAGAGTAACTACA-3’; SEQ ID NO.3: 5’-GCAGGAGTCTGGAGGATT-3’; SEQ ID NO.4: 5’-GGCAATCAAGACCAGAGT-3’; SEQ ID NO.5: 5'-GTAAGAGCCTGACTGACTG-3'; Primer set B: includes upstream primers SEQ ID NO. 6, 7 and downstream primers SEQ ID NO.8, 9, SEQ ID NO.6: 5'-GCAGGAGTCTGGAGGATT-3'; SEQ ID NO.7: 5'-TGGAGGCATGAGCAGAG-3'; SEQ ID NO.8: 5'-TTCTCTTGAACCGCAACC-3'; SEQ ID NO.9: 5'-AGGAGGAAGGTCGATGTAG-3'.

[0009] Among them, primer set A detects EWSR1 Exon5 :: NFATC2 Exon3, EWSR1 Exon6 :: NFATC2Exon3, EWSR1 Exon8 :: NFATC2 Exon3 and FUS Exon6 :: NFATC2 Exon3.

[0010] Primer set B detects EWSR1 Exon8 :: PATZ1 Eoxn1 (11 breakpoint fusion sites).

[0011] For the EWSR1 non-ETS fusion round cell sarcoma detection primer set according to the specific embodiment of the present invention, the upstream primer is also labeled with a fluorescent group.

[0012] For the EWSR1 non-ETS fusion round cell sarcoma detection primer set according to the specific embodiment of the present invention, the fluorescent group is selected from FAM, VIC or TAMRA.

[0013] Preferably, the combination of the primer sequence and the fluorescent group is as follows: In primer set A, Upstream EWSR1 fluorescent primer SEQ ID NO.1: 5'- TGATACCACCACTGCTACA - FAM-3'.

[0014] Upstream EWSR1 fluorescent primer SEQ ID NO.2: 5'- GGATATGGACAGAGTAACTACA - FAM-3'.

[0015] Upstream EWSR1 fluorescent primer SEQ ID NO.3: 5'- GCAGGAGTCTGGAGGATT - FAM-3'.

[0016] Upstream FUS fluorescent primer SEQ ID NO.4: 5’- GGCAATCAAGACCAGAGT - VIC-3’.

[0017] In primer set B, Upstream EWSR1 fluorescent primer SEQ ID NO.6: 5’- GCAGGAGTCTGGAGGATT - FAM-3’; Upstream EWSR1 fluorescent primer SEQ ID NO.7: 5’- TGGAGGCATGAGCAGAG - VIC-3’.

[0018] The present invention provides a kit for detecting EWSR1 non-ETS fusion round cell sarcoma. The kit includes the above-mentioned primer set for detecting EWSR1 non-ETS fusion round cell sarcoma, wherein primer set A and primer set B are respectively arranged in two different tubes.

[0019] According to the detection kit of the specific embodiment of the present invention, it further includes a positive control, a negative control, a PCR reaction buffer, a nucleic acid template and ddH2O.

[0020] Preferably, the negative control is pure water.

[0021] Preferably, the positive control is a plasmid containing a fusion gene, and the sequence of the fusion gene is SEQ ID NO.12 - SEQ ID NO.16.

[0022] SEQ ID NO.12: T1 type EWSR1 Exon5 :: NFATC2 Exon3 fusion gene: 5’-gttatactactccaactgccccccaggcatacagccagcctgtccaggggtatggcactggtgcttatgataccaccactgctacagtcaccaccacccaggcctcctatgcagctcagtctgcatatggcactcagcctgcttatccagcctatgggcagcagccagcagccactgcacctacaagcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcagctccatggctacatggaaaacaagcctctgggacttcagatcttcattgggacagctgatgagcggatc-3’。

[0023] SEQ ID NO.13: T2-type EWSR1 Exon6 :: NFATC2 Exon3 fusion gene: 5’-ctgcttatccagcctatgggcagcagccagcagccactgcacctacaagAccgcaggatggaaacaagcccactgagactagtcaacctcaatctagcacagggggttacaaccagcccagcctaggatatggacagagtaactacagttatccccaggtacctgggagctaccccatgcagccagtcactgcacctccatcctaccctcctaccagcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcag-3’。

[0024] SEQ ID NO.14: T3-type EWSR1 Exon8 :: NFATC2 Exon3 fusion gene: 5’-gttcattccgacaggaccaccccagtagcatgggtgtttatgggcaggagtctggaggattttccggaccaggagagaaccggagcatgagtggccctgataaccggggcaggggaagagggggatttgatcgtggaggcatgagcagaggtgggcggggaggaggacgcggtggaatgggcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcag-3’.

[0025] SEQ ID NO.15, T4-type FUS Exon6::NFATC2 Exon3 fusion gene: 5’-gtaactatggccaagatcaatcctccatgagtagtggtggtggcagtggtggcggttatggcaatcaagaccagagtggtggaggtggcagcggtggctatggacagcaggaccgtggaggccgcggcaggggtggcagtggtggcggcggcggcggcggcggtggtggttacaaccgcagcagtggtggctatgaacccagaggtcgtggaggtggccgtggaggcagaggtggcatgggcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcag-3’.

[0026] SEQ ID NO.16: T5-type EWSR1 Exon8::PATZ1 Eoxn1 fusion gene: 5’-gttcattccgacaggaccaccccagtagcatgggtgtttatgggcaggagtctggaggattttccggaccaggagagaaccggagcatgagtggccctgataaccggggcaggggaagagggggatttgatcgtggaggcatgagcagaggtgggcggggaggaggacgcggtggaatgggaggtgttcactgatgccaaccggctccggcagcacgaggcccagcacggtgtcaccagcctccagctgggctacatcgaccttcctcctccgaggctgggtgagaatgggctacccatctctgaagaccccgacggcccccgaaagaggagccggaccaggaagcaggtggcttgtgagatctgcggcaagatcttccgtgatgtgtatcatcttaaccggcacaagctgtcccactctggggagaagccctactcctgccctgtgtgtgggttgcggttcaagagaaaagac-3’。

[0027] The detection kit according to the specific embodiment of the present invention further includes primers for the internal reference gene HPRT1.

[0028] Preferably, the primer sequences of the internal reference gene HPRT1 are as follows: SEQ ID NO.10: 5’-CCCTGGCGTCGTGATTAGTG-3’; SEQ ID NO.11: 5’-GAGCACACAGAGGGCTACAA-3’.

[0029] Preferably, the downstream primer sequence of the internal reference gene is labeled with a fluorophore.

[0030] More preferably, the combination of the downstream primer sequence of the internal reference gene and the fluorophore is: 5’- GAGCACACAGAGGGCTACAA - ROX-3’.

[0031] Advantages of the present invention: The present invention classifies the mutation types of EWSR1 non-ETS fusion round cell sarcoma into 5 mutation types, divides the 5 fusion mutation types into two groups, and specifically designs two sets of upstream and downstream amplification primer sets. Each fusion mutation type can amplify a target product peak with a size of 100-250 bp. Thus, the primers provided by the present invention can detect 5 mutation types of 3 types of gene fusions at one time.

[0032] By combining the primer set of the present invention with multiplex fluorescence PCR and high-resolution capillary electrophoresis, the lowest detection limit is 10 copies. The detection results of the kit are all consistent with the morphological diagnosis results, and the methodological consistency reaches 100%. Thus, the present invention provides a sensitive and efficient detection method for EWSR1 non-ETS fusion round cell sarcoma, which has the characteristics of simple and convenient operation, accurate results, and economic preference. Brief Description of the Drawings

[0033] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0034] Figure 1 It shows that the kit has a good detection effect on the T1 type EWSR1 Exon5 :: NFATC2 Exon3 fusion gene in the range of 1-1000 copies. The product is a FAM peak of 179 bp, and the lowest detection limit is 1 copy.

[0035] Figure 2 It shows that the kit has a good detection effect on the T2 type EWSR1 Exon6 :: NFATC2 Exon3 fusion gene in the range of 10-1000 copies. The product is a FAM peak of 151 bp, and the lowest detection limit is 10 copies.

[0036] Figure 3 It shows that the kit has a good detection effect on the T3 type EWSR1 Exon8 :: NFATC2 Exon3 fusion gene in the range of 10-1000 copies. The product is a FAM peak of 200 bp, and the lowest detection limit is 10 copies.

[0037] Figure 4 It shows that the kit has a good detection effect on the T4 type FUS Exon6 :: NFATC2 Exon3 fusion gene in the range of 10-1000 copies. The product is a VIC peak of 243 bp, and the lowest detection limit is 10 copies.

[0038] Figure 5 The kit shows good detection results for the T5 type EWSR1 Exon8::PATZ1 Exon1 fusion gene in the range of 1 - 1000 copies. The product is a VIC peak of 134 bp, and the lowest detection limit is 1 copy.

[0039] Figure 6 The kit shows that 24 samples have the T1 type EWSR1 Exon5::NFATC2 Exon3 fusion (a), and the PCR amplification products of the positive samples are verified by Sanger sequencing (b). Detailed implementation manners

[0040] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be described in detail below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other implementation manners obtained by those of ordinary skill in the art without creative efforts fall within the scope protected by the present invention.

[0041] Example 1 Primer design The present invention sorted out literature reports and local laboratory test samples, with a total of more than a hundred cases of EWSR1 non-ETS sarcoma fusion gene data. By uniformly referring to gene transcripts, 5 variant combination types (Table 1) were summarized based on 3 common types of gene fusions in EWSR1 non-ETS fusion sarcomas (EWSR1::NFATC2, FUS::NFATC2, and EWSR1::PATZ1), and the 5 variant types were divided into tube A for NFATC2-related fusion genes and tube B for EWSR1::PATZ1-related fusion genes. Based on the above tube division, specific upstream and downstream primers for each variant type were designed and combined for tube testing. The primer sets in each tube needed to meet the following requirements simultaneously: ① The primer combination in each tube can amplify all target fragments in this tube; ② The total number of primers should be as small as possible to reduce unnecessary cross-reactions; ③ The difference in the amplification products of each primer pair is greater than or equal to 2 bp to meet the resolution requirements of a high-resolution capillary electrophoresis instrument; ④ Each amplified fragment needs to be greater than 100 bp to avoid primer dimer interference and as small as possible and less than or equal to 250 bp to be applicable to the highly degraded nucleic acids in the most common paraffin tumor specimens in clinical practice; ⑤ The primer combination in each tube has no non-specific amplification with genomic DNA.

[0042] Meanwhile, since the break-fusion points of the PATZ1 gene (NM_014323) in tube B are scattered in the exon 1 region, the present invention simultaneously designs two sets of upstream and downstream amplification primer combinations to meet the purpose that target product peaks with a size of 100-250 bp can be amplified for each fusion type.

[0043] According to the above principles, multiple primer combinations were designed, optimized and tested. Finally, the multiplex primer combination for the characteristic variation of EWSR1 non-ETS sarcoma was adopted. It can detect 5 variation types of 3 major gene fusions at one time by binding specific fluorophores (Table 1). The lowest detectable limit is 10 copies, and the shortest detection time is 240 minutes. Primer set A detects the fusions of EWSR1::NFATC2 and FUS::NFATC2, primer set B detects EWSR1::PATZ1, and primer set C detects the expression of the internal reference gene HPRT1 to control the nucleic acid quality of the quality control samples.

[0044] Table 1 Design of the detection kit and primer sequences used

[0045] The reaction systems in each tube are shown in Table 2: Table 2 Reaction systems in each tube (taking 25 μL as an example)

[0046] Note: The 2×PCR reaction buffer contains Taq enzyme, Mg 2+ , PCR buffer, dNTPs, etc.

[0047] In addition to the reaction systems in tubes A, B, and C, the kit also includes a positive control and a negative control. The negative control is pure water, and the positive control is a plasmid standard product (1000 copies / μl) inserted with the fusion gene fragment. The gene variations corresponding to the positive control in each tube and their inserted nucleotide sequences are as follows: Tube A, T1 type EWSR1 Exon5 :: NFATC2 Exon3 fusion: 5’-gttatactactccaactgccccccaggcatacagccagcctgtccaggggtatggcactggtgcttatgataccaccactgctacagtcaccaccacccaggcctcctatgcagctcagtctgcatatggcactcagcctgcttatccagcctatgggcagcagccagcagccactgcacctacaagcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcagctccatggctacatggaaaacaagcctctgggacttcagatcttcattgggacagctgatgagcggatc-3’。

[0048] Tube A, T2 type EWSR1 Exon6 :: NFATC2 Exon3 fusion: 5’-ctgcttatccagcctatgggcagcagccagcagccactgcacctacaagAccgcaggatggaaacaagcccactgagactagtcaacctcaatctagcacagggggttacaaccagcccagcctaggatatggacagagtaactacagttatccccaggtacctgggagctaccccatgcagccagtcactgcacctccatcctaccctcctaccagcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcag-3’。

[0049] Tube A, T3 type EWSR1 Exon8 :: NFATC2 Exon3 fusion: 5’-gttcattccgacaggaccaccccagtagcatgggtgtttatgggcaggagtctggaggattttccggaccaggagagaaccggagcatgagtggccctgataaccggggcaggggaagagggggatttgatcgtggaggcatgagcagaggtgggcggggaggaggacgcggtggaatgggcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcag-3’。

[0050] Tube A, T4-type FUS Exon6 :: NFATC2 Exon3 fusion: 5’-gtaactatggccaagatcaatcctccatgagtagtggtggtggcagtggtggcggttatggcaatcaagaccagagtggtggaggtggcagcggtggctatggacagcaggaccgtggaggccgcggcaggggtggcagtggtggcggcggcggcggcggcggtggtggttacaaccgcagcagtggtggctatgaacccagaggtcgtggaggtggccgtggaggcagaggtggcatgggcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcag-3’。

[0051] Tube B, T5-type EWSR1 Exon8 :: PATZ1 Eoxn1 fusion: 5’-gttcattccgacaggaccaccccagtagcatgggtgtttatgggcaggagtctggaggattttccggaccaggagagaaccggagcatgagtggccctgataaccggggcaggggaagagggggatttgatcgtggaggcatgagcagaggtgggcggggaggaggacgcggtggaatgggaggtgttcactgatgccaaccggctccggcagcacgaggcccagcacggtgtcaccagcctccagctgggctacatcgaccttcctcctccgaggctgggtgagaatgggctacccatctctgaagaccccgacggcccccgaaagaggagccggaccaggaagcaggtggcttgtgagatctgcggcaagatcttccgtgatgtgtatcatcttaaccggcacaagctgtcccactctggggagaagccctactcctgccctgtgtgtgggttgcggttcaagagaaaagac-3’。

[0052] The PCR amplification program used for detection is as follows: Table 3 Amplification program

[0053] Add the obtained PCR amplification product, HiDi and Liz600 molecular internal standard, perform electrophoresis on a high-resolution capillary electrophoresis instrument (ABI3500), and use Gene Mapper software to analyze the molecular weight of the amplification product.

[0054] The detection results and their interpretation criteria are shown in Table 4 below.

[0055] Table 4 Result interpretation criteria

[0056] First, check if there is a 190 bp ROX amplification peak in Tube C. If not, it is judged that the nucleic acid quality control fails and nucleic acid needs to be extracted again for the experiment; if so, the nucleic acid quality control is passed.

[0057] Secondly, check if there is an amplification peak with the corresponding fluorescence color and size in Tube A or Tube B: The 179 / 151 / 200 product peaks of FAM fluorescence in Tube A respectively correspond to the T1 / T2 / T3 types of EWSR1::NFATC2 fusion, and the 243 bp product peak of VIC fluorescence corresponds to the T4 type of FUS::NFATC2 fusion; The product peaks between 100 - 250 bp of FAM or VIC fluorescence in Tube B all correspond to the EWSR1::PATZ1 fusion at different fusion sites; If there are no above - mentioned product peaks in both Tube A and Tube B, it is judged as negative, and no relevant gene fusion is detected.

[0058] Example 2 Performance Test The performance of the above - mentioned kit was detected. Plasmids inserted with corresponding fusion gene fragments (T1 - T5) were used as fusion gene detection standards, and were formulated into gradient standard solutions with corresponding concentrations (1, 10, 100, 1000 copies / μl) as amplification templates. Using the kit of the present invention and its detection procedure, the detection results of T1 - T5 type mutants are as Figures 1-5 shown.

[0059] Figure 1 It shows that the detection of the T1 type EWSR1 Exon5::NFATC2 Exon3 fusion gene has a good detection effect in the range of 1 - 1000 copies. The product is a FAM peak of 179 bp, and the lowest detection limit is 1 copy.

[0060] Figure 2 It shows that the detection of the T2 type EWSR1 Exon6::NFATC2 Exon3 fusion gene has a good detection effect in the range of 10 - 1000 copies. The product is a FAM peak of 151 bp, and the lowest detection limit is 10 copies.

[0061] Figure 3 It shows that the detection of the T3 type EWSR1 Exon8::NFATC2 Exon3 fusion gene has a good detection effect in the range of 10 - 1000 copies. The product is a FAM peak of 200 bp, and the lowest detection limit is 10 copies.

[0062] Figure 4 It shows that the detection of the T4 type FUS Exon6::NFATC2 Exon3 fusion gene has a good detection effect in the range of 10 - 1000 copies. The product is a VIC peak of 243 bp, and the lowest detection limit is 10 copies.

[0063] Figure 5The detection shows that the T5 type EWSR1 Exon8 :: PATZ1 Exon1 fusion gene has a good detection effect within the range of 1 - 1000 copies. The product is a VIC peak of 134bp, and the lowest detection limit is 1 copy.

[0064] Example 3 The detection performance of the kit was tested using 24 real tumor samples (18 cases of Ewing sarcoma, 6 cases of Ewing-like sarcoma including 3 cases of sarcoma with BCOR genetic abnormalities, 2 cases of CIC rearrangement sarcoma, and 1 case of EWSR1 non-ETS sarcoma).

[0065] All samples passed nucleic acid quality control. Only 1 case of EWSR1::NFATC2 fusion was detected. Sanger sequencing was performed on the PCR amplification products of the positive samples, and the results were consistent with those detected by this kit, as Figure 6 shown.

[0066] The histological types of the samples were analyzed. The histological diagnosis of the positive sample was consistent with the result of EWSR1 non-ETS sarcoma as shown in Table 5. The detection results of the remaining cases were all negative.

[0067] Table 5 Detection results of real tumor samples

[0068] In summary, the detection results of the kit for 24 tumor patient samples were all consistent with the morphological diagnosis results, and the methodological consistency reached 100%.

[0069] As described above, the above are only specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention can easily think of changes or substitutions, which should all be covered within the protection scope of the present invention. Therefore, the protection scope of the present invention should be subject to the protection scope of the claims.

Claims

1. A primer set for detecting EWSR1 non-ETS fusion round cell sarcoma, characterized in that, The primer set includes at least one of primer set A and primer set B, where Primer set A: includes upstream primers SEQ ID NO.1-4 and downstream primer SEQ ID NO.5, SEQ ID NO.1: 5’-TGATACCACCACTGCTACA-3’; SEQ ID NO.2: 5’-GGATATGGACAGAGTAACTACA-3’; SEQ ID NO.3: 5’-GCAGGAGTCTGGAGGATT-3’; SEQ ID NO.4: 5’-GGCAATCAAGACCAGAGT-3’; SEQ ID NO.5: 5’-GTAAGAGCCTGACTGACTG-3’; Primer set B: includes upstream primers SEQ ID NO.6, 7 and downstream primers SEQ ID NO.8, 9, SEQ ID NO.6: 5’-GCAGGAGTCTGGAGGATT-3’; SEQ ID NO.7: 5’-TGGAGGCATGAGCAGAG-3’; SEQ ID NO.8: 5’-TTCTCTTGAACCGCAACC-3’; SEQ ID NO.9: 5’-AGGAGGAAGGTCGATGTAG-3’.

2. The EWSR1 non-ETS fusion round cell sarcoma detection primer set according to claim 1, characterized in that, The upstream primer is also labeled with a fluorescent group.

3. The EWSR1 non-ETS fusion round cell sarcoma detection primer set according to claim 2, characterized in that, The fluorescent group is selected from FAM, VIC or TAMRA.

4. EWSR1 non-ETS fusion round cell sarcoma detection kit, characterized in that, The kit includes the EWSR1 non-ETS fusion round cell sarcoma detection primer set according to any one of claims 1-3.

5. The detection kit for EWSR1 non-ETS fusion round cell sarcoma according to claim 4, characterized in that, The kit further includes a positive control, a negative control, a PCR reaction buffer, a nucleic acid template and ddH2O.

6. The detection kit for EWSR1 non-ETS fusion round cell sarcoma according to claim 5, wherein The negative control is pure water.

7. The detection kit for EWSR1 non-ETS fusion round cell sarcoma according to claim 5, characterized in that, The positive control is a plasmid containing a fusion gene, and the sequence of the fusion gene is SEQ ID NO.12-SEQ ID NO.

16.

8. The detection kit for EWSR1 non-ETS fusion round cell sarcoma according to claim 5, characterized in that, The kit further includes primers for the internal reference gene HPRT1.

9. The detection kit for EWSR1 non-ETS fusion round cell sarcoma according to claim 8, characterized in that, The primer sequences of the internal reference gene HPRT1 are as follows: SEQ ID NO.10: 5’-CCCTGGCGTCGTGATTAGTG-3’; SEQ ID NO.11: 5’-GAGCACACAGAGGGCTACAA-3’.

Images