New xylaria species and application thereof

Abstract

The invention provides a xylaria new species and application thereof, the xylaria new species belongs to xylaria, is named as # imgabs0 # (FCATAS 14861), is preserved in the China Center for Type Culture Collection (CCTCC), has the preservation number of CCTCC NO: M 2025949, and is preserved on April 30, 2025. According to the xylaria new species provided by the invention, the scavenging capacity of mycelia on DPPH free radicals reaches 12.39%, the maximum scavenging capacity on ABTS free radicals reaches 91.21%, the maximum total antioxidant capacity reaches 8.9 micromoles Trolox / g, the antioxidant capacity is high, and the xylaria new species and the mycelia have industrial application prospects.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and particularly relates to a new species of Xylaria and its application. Background Art

[0002] Genus Xylaria Xylaria It belongs to the family Xylariaceae. Species of this genus are widely distributed throughout the world and there are many of them. There are about more than 300 species of Xylaria, which mainly grow in warm and humid places, and are saprophytic or parasitic. Fungi of the genus Xylaria are widely distributed in the southern regions of China. According to statistics, there are as many as 61 species. In recent years, scholars at home and abroad have conducted in-depth research on fungi of the genus Xylaria. Many species have certain medicinal values, and some fungi of the genus Xylaria can grow on the culture medium and form fruiting bodies, which improves the utilization value of fungi of the genus Xylaria. Summary of the Invention

[0003] In view of this, the purpose of the present invention is to provide a new species of Xylaria and its application, to provide a new species of Xylaria that can be applied to the preparation of antioxidant products.

[0004] The technical solution of the present invention is realized as follows: A kind of Xylaria, the new species of Xylaria belongs to the genus Xylaria Xylaria , named , is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC NO: M2025949, and the preservation date is April 30, 2025.

[0005] Furthermore, the ITS sequence of the is shown as SEQ ID NO.1.

[0006] The present invention provides the application of the above-mentioned Xylaria in the preparation of food additives, feed additives or additives for daily chemical products.

[0007] Furthermore, the is applied in the preparation of additives for antioxidant preparations.

[0008] Even further, the antioxidant includes scavenging DPPH free radicals or / and scavenging ABTS free radicals.

[0009] Even further, the additive for antioxidant preparations includes the mycelium or its extract.

[0010] Compared with the prior art, the beneficial effects of the present invention are: The new species of Xylaria isolated and purified by the present invention , It is easy to culture, has a high antioxidant capacity of mycelium, the scavenging ability of DPPH free radicals reaches 12.39%, the scavenging ability of ABTS free radicals reaches the maximum value of 91.21%, and the maximum total antioxidant capacity is 8.9 μmol Trolox / g. It can be used as an antioxidant in various fields.

[0011] Biological preservation information: , It is preserved in the China Center for Type Culture Collection, with the address at No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The preservation number is CCTCC NO: M 2025949, and the preservation date is April 30, 2025. Description of the drawings

[0012] Figure 1 is for the screening of the present invention Performance on PDA medium. Specific implementation manners

[0013] To better understand the technical content of the present invention, specific examples are provided below to further illustrate the present invention.

[0014] Unless otherwise specified, the experimental methods used in the embodiments of the present invention are all conventional methods.

[0015] Unless otherwise specified, the materials, reagents, etc. used in the embodiments of the present invention can all be obtained from commercial channels.

[0016] Example 1 - Isolation and identification 1.1 Isolation of the strain Collected from Qixianling National Forest Park, Baoting County, Hainan Province on September 24, 2023, the strain was isolated and cultured using aseptic operation techniques. The surface of the stroma was disinfected with 75% ethanol. After allowing it to air dry naturally, it was transversely cut with a sterilized blade under a stereomicroscope to fully expose the ascus structure. Subsequently, a single spore was picked from the ascus with a sterile inoculation needle and quickly inoculated onto a pre-prepared PDA plate medium. The inoculated medium was placed in a constant temperature incubator and cultured at 25 ± 1°C. After the spores germinated to form colonies, purification and transfer were carried out in a timely manner to obtain a single strain. The obtained pure cultures were respectively used for morphological observation research of the anamorph stage and strain resource preservation.

[0017] 1.2 Morphological observation In the study of the macroscopic morphology in the sexual stage, a super-depth-of-field microscopic imaging system was used to observe the fruiting bodies in multiple dimensions. The macroscopic traits such as the morphological characteristics, color changes, and attachment patterns of the stroma and perithecia were recorded; the orifice morphology and the internal structure of the perithecia were observed through longitudinal sections; meanwhile, the distribution characteristics of pigment particles between the stroma surface and the perithecia were noted. For the microscopic morphology observation, a method combining multiple microscopic techniques was adopted. Distilled water and Melzer's reagent were used as mounting media to prepare microscopic specimens respectively. Under an optical microscope, the overall morphological characteristics of the asci were observed using water-mounted slides, and the size parameters of the spore-containing part and the tail were measured; the morphological characteristics of the ascospores, including shape, color, and the position and length of the germ slit, were recorded. The amyloid property of the apical ring of the asci was detected using Melzer's reagent, and its morphological parameters were measured.

[0018] Morphological characteristics: The stroma is cylindrical, unbranched, with a blunt apex, 5.5 - 9.2 cm long and 3 - 5 mm wide; initially white on the surface, turning black when mature, with longitudinal wrinkles and perithecial protrusions; white inside, grayish-black in the center, solid; with a stipe, smooth, twisted; the perithecia are obovate or elliptical, 500 - 750 μm long and 200 - 300 μm wide; the orifice is papillate. The asci are cylindrical, containing 8 spores, arranged in a single row, 54 - 66×3 - 4 μm, the spore-containing part is 20 - 35 μm long; the apical ring turns blue in Melzer's reagent, rectangular or inverted-cap-shaped, 1.2 - 1.8 μm long and 1.5 - 2 μm wide. The ascospores are brown, unicellular, unequal-sided elliptical, tapering at both ends, (4.5 -)5.0 - 5.6(5.9)×(2.8)3.0 - 3.6(3.8) μm (Me = 5.4×3.4 μm, N = 30), the germ slit is straight, about 1 / 2 of the spore.

[0019] 1.3 Molecular biological identification A kit was used for genomic DNA extraction. The specific experimental steps are as follows: First, transfer an appropriate amount of stroma tissue or mycelial culture to a 1.5 mL sterile centrifuge tube, add 450 μL of lysis buffer (Buffer PAL), and place a small steel bead into it. Use a tissue homogenizer to grind it thoroughly for 3 minutes, then place it in a 65°C water bath for 30 minutes, and mix it by shaking every 10 minutes during this period. After the water bath is completed, add an equal volume of phenol-chloroform-isoamyl alcohol mixture (25:24:1), mix it thoroughly, and centrifuge at 12,000 rpm for 5 minutes to collect the supernatant. Take 300 μL of the supernatant and mix it evenly with 450 μL of binding buffer (Buffer GWP), transfer it to an adsorption column, and discard the waste liquid after centrifuging at 12,000 rpm for 1 minute. Add 500 μL of inhibitor removal solution (Buffer PW1) and washing solution (Buffer PW2) in sequence for washing, and centrifuge at 12,000 rpm for 1 minute each time and discard the waste liquid, where Buffer PW2 needs to be washed repeatedly once. After washing is completed, centrifuge the adsorption column empty for 2 minutes to remove the residual liquid. Finally, transfer the adsorption column to a new 1.5 mL sterile centrifuge tube, add 70 μL of preheated elution buffer (Buffer AE), let it stand at room temperature for 3 - 5 minutes, and then centrifuge for 1 minute to collect the DNA solution.

[0020] The extracted DNA samples need to be immediately labeled and numbered, and stored in a -18°C refrigerator for future use. Protective gloves should be worn throughout the experimental operation process to avoid damage caused by reagent contact with the skin. Using the extracted fungal DNA as a template, PCR sequence amplification is performed on the ITS and ACT gene fragments. The amplification system for this experiment is 50 μL: the specific components and dosages are shown in Table 1; the primer names used for different gene fragments are shown in Table 2; the PCR amplification products are sent to BGI (Guangzhou) Co., Ltd. for sequencing.

[0021] Table 1 PCR amplification reaction system

[0022] Table 2 Primers used

[0023] Sequencing and analysis were performed on the ITS-rDNA sequence and ACT sequence of the strain, and the sequence results were compared through the BLAST program. The results showed that the strain belongs to the genus Xylaria Xylaria , and Xylaria sp. (A HMH-2021) with a similarity of 88.95%. Combining morphological characteristics identification, it was determined that this fungus is a fungal strain of the genus Xylaria, named .

[0024] Related sequences: ACT (SEQ ID NO.2): CTAACGCTATATGTCAGAGCTGTTTTCGTAAGTCTTCTCCAATTCTCACTGCTCGGCTCCGACCCCGCTTGTGGATTCATCTTCTGACCTCTGCACACAGCGTCCATTGTCGGTCGTCCCCGTCACAAGGGGTAAGTTGCCATTCTCCCCGCCGATAAGCCGCTGGCTTGGCCTCTCTGGACGTCTGCTCATCGTCTGCTCGCAGTATCATGATTGGTATGGGCCAGAAGGACTCGTAA ITS (SEQ ID NO.1): TTTGACTGGTGACAGCGGAGGGTCATTAAAGAGTTGCAAAACTCCCAACCCATGTGGACATACCTTCTGTTGCCTCGGTGGGGCCGCGGGAGCCCGGGCATGCCCGGAGCCGCCGCGGATCAAACCTGCCAGTGGCCCTCATGAACTCTGTTTAATTAGTTTACTTCTGAACCTATAACTAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCGACCCTTAAGCCCTCGTTGCTTAGTGTTGGGAGTGTACCAGATGGTAGCTCCCCAAAGTCAGTGGCGGAGTCGGTTCCAGGCTCTAGACGTAGTAGAATATCTCGTCTGCAGCTGGGCCCGGTCCCCTGCCGTAAAACACCATTATTTCTCAAGGTTGACCTCGAATCAGGTAAGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA Example 2 - antioxidant activity The strain was cultured by liquid culture method. First, the strain preserved at -80°C was inoculated onto a PDA solid medium plate and placed in an incubator at 25°C for activation culture. Wait until the mycelium covers the plate and set it aside for use. Subsequently, use a sterile pipette tip to punch out mycelium blocks at the edge of the well-grown colony, and inoculate 5 blocks into each conical flask containing 300 mL of liquid medium. Place the inoculated conical flask in a constant temperature shaker and perform shaking culture at a rotation speed of 160 r / min and a constant temperature of 25°C under light-shielded conditions.

[0025] After the culture is completed, take out the shaking flask, obtain the mycelium by suction filtration, place the mycelium obtained by suction filtration in an oven at 60°C and dry it to a constant weight before taking it out. Grind the dried mycelium into powder and sieve it to obtain mycelium powder, which is set aside as a sample. The determination of the antioxidant capacity of the mycelium uses a detection kit from Beijing Solarbio Science & Technology Co., Ltd., and the index is determined according to the instructions of the detection kit.

[0026] (1)Determination of DPPH free radical scavenging ability 1) Preparation of solutions: Reagent 1: Self-prepared absolute ethanol, about 60 mL is required, and it is stored at room temperature.

[0027] Reagent 2: The powder is placed in an EP tube in the bottle. Before use, add 6.08 mL of Reagent 1 and shake to dissolve. According to the required amount of the test, prepare a working solution according to the ratio of Reagent 2:Reagent 1 (V:V) = 4:21, and prepare and use it immediately.

[0028] 2) Sample treatment: Weigh about 0.05 g of the sample, add 1 mL of the extraction solution, and place it in a water bath at 40°C for extraction for 30 min; centrifuge at 10000 r / min at room temperature for 10 min, take the supernatant, and place it on ice for further measurement.

[0029] 3) Measurement steps: ① Preheat the spectrophotometer for 30 min, adjust the wavelength to 515 nm, and zero with absolute ethanol.

[0030] ② Add 25 μL of the extraction solution and 975 μL of the working solution to the blank tube; add 25 μL of the supernatant and 975 μL of the working solution to the measurement tube; add 25 μL of the supernatant and 975 μL of Reagent 1 to the control tube. Mix well, and let it stand in the dark at room temperature for 30 min. Measure the absorbance at 515 nm. Record them as A 空白 、A 测定 、A 对照 。

[0031] 4) Calculation of DPPH free radical scavenging rate: DPPH free radical scavenging rate D% = [A 空白 - (A 测定 - A 对照 )] ÷ A空白 ×100%.

[0032] (2)Determination of ABTS free radical scavenging ability 1) Preparation of solutions: Reagent II: Add 3 mL of distilled water before use and dissolve it thoroughly.

[0033] Preparation of Reagent III working solution: Prepare the Reagent III working solution according to the ratio of Reagent III (μL): distilled water (mL) = 1 μL: 12 mL based on the sample volume, and prepare it freshly for immediate use.

[0034] Preparation of Reagent IV working solution: Prepare the Reagent IV working solution according to the ratio of Reagent IV: Reagent I (V:V) = 1:9 based on the sample volume, and prepare it freshly for immediate use.

[0035] Preparation of ABTS working solution: Prepare it according to the ratio of Reagent I: Reagent II: Reagent III working solution (V:V:V) = 76:5:4 based on the sample volume before use, prepare it freshly for immediate use, store it in the dark at room temperature, and must be used within 30 min.

[0036] 2) Sample treatment: Weigh about 0.05 g of the sample, add 1 mL of the extraction solution, and place it in a water bath at 40 °C for extraction for 30 min; centrifuge at 10000 r / min at room temperature for 10 min, take the supernatant, and place it on ice for measurement.

[0037] 3) Measurement steps: ① Preheat the spectrophotometer for 30 min and adjust the wavelength to 405 nm.

[0038] ② Add 50 μL of distilled water, 100 μL of Reagent IV working solution, and 850 μL of ABTS working solution to the blank tube; add 50 μL of the supernatant, 100 μL of Reagent IV working solution, and 850 μL of ABTS working solution to the measurement tube; add 50 μL of distilled water and 950 μL of Reagent I to the control tube. Mix well, let it stand in the dark at room temperature for 6 min. Measure the absorbance at 405 nm. Record them as A 空白 、A 测定 、A 对照 .

[0039] 4) Calculation of ABTS free radical scavenging rate: ABTS free radical scavenging rate D% = [A 空白 - (A 测定 - A 对照 )] ÷ A 空白 ×100%.

[0040] (3)Determination of total antioxidant capacity (FRAP method) 1) Preparation of solutions: Mixed solution (prepared and used immediately): Mix Reagent 1, Reagent 2, and Reagent 3 in a ratio of 10:1:1, and pre-warm at 37 °C before use.

[0041] 2) Sample treatment: Weigh approximately 0.1 g of the sample, add 1 mL of extraction solution, and homogenize in an ice bath. Then centrifuge at 10000 r / min for 10 min at 4 °C, take the supernatant, and place it on ice for measurement.

[0042] 3) Measurement steps: ① Preheat the spectrophotometer for 30 min and adjust the wavelength to 593 nm.

[0043] ② Add 50 μL of extraction solution and 950 μL of mixed solution to the blank tube; add 50 μL of the sample and 950 μL of mixed solution to the measurement tube. Mix well and react for 20 min.

[0044] ③ Zero with double-distilled water, use a 1 mL glass cuvette to measure the absorbance at 593 nm, △A = A 测定 -A 空白 .

[0045] 4) Total antioxidant capacity calculation formula: Standard curve: y = 2.4832x + 0.0134 R 2 = 0.9996 x: Trolox concentration (μmol / mL) y: Absorbance difference △A Unit definition: The total antioxidant capacity of the sample is expressed by the amount of antioxidant Trolox obtained from the standard curve.

[0046] Total antioxidant capacity (μmol Trolox / mL) = (△A - 0.0134) ÷ 2.4832 = 0.4027 × (△A - 0.0134).

[0047] Antioxidant results are as follows: (1) DPPH radical scavenging ability of hyphae During the whole growth process, the change of the DPPH radical scavenging ability of hyphae generally shows three stages. The scavenging ability is relatively low in the initial stage of 5 - 8 d; it significantly increases in the middle stage of 11 - 14 d and reaches a peak of 12.39% on the 14th d; in the later stage of 17 - 20 d, the scavenging ability fluctuates, and the activity of antioxidant substances weakens, decreasing from 9.57% to 6.48%.

[0048] (2) ABTS radical scavenging ability of hyphae During the whole growth process, the change trend of the ability of hyphae to scavenge ABTS free radicals was similar to that of DPPH. Overall, it presented three stages, and both reached a peak on the 11th day, indicating that the antioxidant substances in the hyphae might have higher activity at this time point. The ABTS scavenging ability reached a maximum value of 91.21% on the 11th day.

[0049] (3) Total antioxidant capacity of hyphae The overall antioxidant capacity fluctuated greatly during the cultivation process. It decreased slightly in the initial stage, showed a significant increase in the middle stage and reached the maximum value, and showed a certain decrease in the later stage. The change trend of the overall antioxidant capacity was similar to that of the scavenging ability of ABTS and DPPH free radicals during the whole growth process. The total antioxidant capacity reached the maximum value of 8.9 μmol Trolox / g on the 14th day.

[0050] The above is the preferred implementation mode of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements are also regarded as the protection scope of the present invention.

Claims

1. A Xylaria, characterized in that, The Xylaria belongs to the genus Xylaria Xylaria , and is taxonomically named . It is deposited in the China Center for Type Culture Collection, with the deposit number CCTCC NO: M2025949 and the deposit date of April 30, 2025.

2. A Xylaria according to claim 1, characterized in that, The said ITS sequence is as shown in SEQ ID NO.

1.

3. Use of a Xylaria described in claim 1 or 2, characterized in that, The said Application in the preparation of an additive for an antioxidant preparation 4. The application of Xylaria described in claim 3, characterized in that, The antioxidant activity includes scavenging DPPH free radicals and / or ABTS free radicals.

5. The application of Xylaria described in claim 3, characterized in that, The antioxidant preparation additive includes the mycelium or its extract.

Images