A new species of Xylaria and its application

Abstract

The present invention provides a new species of Xylaria and its application, the new species of Xylaria belongs to the genus Xylaria Xylaria , named (FCATAS 14861), deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 2025949, and a deposit date of April 30, 2025. The new species of Xylaria provided by the present invention has a mycelium scavenging ability of 12.39% for DPPH free radicals, a maximum scavenging ability of 91.21% for ABTS free radicals, and a maximum total antioxidant capacity of 8.9 μmol Trolox / g, showing high antioxidant capacity and promising industrial applications.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, in particular to a new species of Xylaria officinalis and applications thereof. Background Art

[0002] Xylaria Xylaria Belonging to the Xylariaceae family, this genus is widely distributed worldwide and contains numerous species, numbering approximately 300. They primarily thrive in warm, humid environments, acting as saprotrophs or parasites. Xylaria is widely distributed in southern my country, with a population estimated at 61. In recent years, scholars both domestically and internationally have conducted in-depth research on Xylaria, revealing that many species possess medicinal properties. Furthermore, some can grow and form fruiting bodies on culture media, further enhancing their utility. Summary of the Invention

[0003] In view of this, the purpose of the present invention is to propose a new species of Xylaria and its application, and to provide a new species of Xylaria that can be used to prepare antioxidant products.

[0004] The technical solution of the present invention is achieved as follows:

[0005] A new species of Xylaria, belonging to the genus Xylaria Xylaria , named , deposited in the China Center for Type Culture Collection, the deposit number is CCTCC NO: M2025949, and the deposit date is April 30, 2025.

[0006] Furthermore, the The ITS sequence is shown in SEQ ID NO.1.

[0007] The present invention provides the use of the above-mentioned Xylaria officinalis in the preparation of food additives, feed additives or daily chemical product additives.

[0008] Furthermore, the Application in the preparation of antioxidant preparation additives.

[0009] Furthermore, the anti-oxidation includes scavenging DPPH free radicals and / or scavenging ABTS free radicals.

[0010] Furthermore, the antioxidant preparation additive includes the mycelium or its extracts.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] New species of Xylaria isolated and purified by the present invention The culture is simple, the mycelium has high antioxidant capacity, the scavenging capacity of DPPH free radicals reaches 12.39%, the scavenging capacity of ABTS free radicals reaches a maximum of 91.21%, and the maximum total antioxidant capacity is 8.9 μmol Trolox / g. It can be used as an antioxidant in various fields.

[0013] Biodeposit Information:

[0014] , deposited in the China Center for Type Culture Collection, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with the deposit number CCTCC NO: M 2025949 and the deposit date April 30, 2025. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Screening for the present invention Performance on PDA medium. DETAILED DESCRIPTION

[0016] In order to better understand the technical content of the present invention, specific examples are provided below to further illustrate the present invention.

[0017] Unless otherwise specified, the experimental methods used in the examples of the present invention are all conventional methods.

[0018] Unless otherwise specified, the materials, reagents, etc. used in the examples of the present invention can be obtained from commercial sources.

[0019] Example 1- Isolation and identification

[0020] 1.1 Isolation of strains

[0021] On September 24, 2023, it was collected from Qixianling National Forest Park, Baoting County, Hainan Province, and the strain was isolated and cultured using aseptic operation techniques. The surface of the stroma was disinfected with 75% ethanol. After it was naturally air-dried, it was cut horizontally with a sterilized blade under a stereomicroscope to fully expose the ascus structure. Subsequently, a sterile inoculation needle was used to pick a single spore from the ascocarp and quickly inoculated onto a pre-prepared PDA flat culture medium. The inoculated culture medium was placed in a constant temperature incubator and cultured at 25±1°C. After the spores germinated to form colonies, they were purified and transferred in time to obtain a single strain. The pure cultures obtained were used for morphological observation and research of the asexual stage and for the preservation of strain resources.

[0022] 1.2 Morphological observation

[0023] In the study of the macroscopic morphology of the sexual stage, an ultra-depth-of-field microscopy system was used to observe the fruiting bodies in multiple dimensions. Macroscopic characteristics, such as the morphological characteristics, color changes, and attachment patterns of the stroma and perithecia were recorded. The morphology of the orifice and the internal structure of the perithecia were observed through longitudinal sections. The distribution of pigment granules on the surface of the stroma and between the perithecia was also observed. Microscopic morphological observations were conducted using a combination of various microscopic techniques. Microscopic specimens were prepared using distilled water and Metzger's reagent as floats, respectively. Under an optical microscope, water slides were used to observe the overall morphological characteristics of the ascus, and the dimensional parameters of the spore-bearing area and tail were measured. The morphological characteristics of the ascospores, including shape, color, and the location and length of the bud suture, were recorded. Metzger's reagent was used to detect the starch content of the ascus apical ring and determine its morphological parameters.

[0024] Morphological characteristics: The stroma is cylindrical, unbranched, with a blunt apex, 5.5-9.2 cm long and 3-5 mm wide. The surface is initially white, turning black upon maturity, with longitudinal wrinkles and raised perithecia. The interior is white with a gray-black, full center. The perithecia are smooth, stalked, and twisted. The perithecia are obovate or elliptical, 500-750 μm long and 200-300 μm wide, with a papillate pore. The ascus is cylindrical, with eight spores arranged in a single row, measuring 54-66 × 3-4 μm, with the spore-bearing portion measuring 20-35 μm. The apical ring appears blue in Melzer's reagent, is rectangular or inverted, and measures 1.2-1.8 μm long and 1.5-2 μm wide. Ascospores are brown, unicellular, unequally elliptical, narrowed at both ends, (4.5~)5.0~5.6(5.9)×(2.8)3.0~3.6(3.8)μm (Me=5.4×3.4 μm, N=30), with a straight suture, about 1 / 2 of the spore.

[0025] 1.3 Molecular Biological Identification

[0026] The genomic DNA was extracted using a kit. The specific experimental steps are as follows:

[0027] First, transfer appropriate subtelomeric tissue or mycelial culture to a 1.5 mL sterile centrifuge tube, add 450 μL of lysis buffer (Buffer PAL) and small steel balls. Grind thoroughly with a tissue disruptor for 3 minutes, then place in a 65°C water bath for 30 minutes, vortexing every 10 minutes. After incubation, add an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1) and mix thoroughly. Centrifuge at 12,000 rpm for 5 minutes, and collect the supernatant. Mix 300 μL of the supernatant with 450 μL of binding buffer (Buffer GWP), transfer to the adsorption column, centrifuge at 12,000 rpm for 1 minute, and discard the waste liquid. Wash with 500 μL of inhibitor removal buffer (Buffer PW1) and rinse buffer (Buffer PW2), centrifuging at 12,000 rpm for 1 minute each time and discarding the waste liquid. Repeat the Buffer PW2 wash cycle once. After washing, drain the column for 2 minutes to remove any residual liquid. Finally, transfer the adsorption column to a new 1.5 mL sterile centrifuge tube, add 70 μL of preheated elution buffer (Buffer AE), let it stand at room temperature for 3-5 minutes, and then centrifuge for 1 minute to collect the DNA solution.

[0028] Extracted DNA samples should be immediately labeled and stored at -18°C until needed. Protective gloves should be worn throughout the experiment to prevent contact with skin. PCR amplification of ITS and ACT gene fragments was performed using the extracted fungal DNA as a template. The amplification system for this experiment was 50 μL: Specific components and amounts are shown in Table 1; primers used for different gene fragments are shown in Table 2. PCR amplification products were sent to BGI (Guangzhou) Co., Ltd. for sequencing.

[0029] Table 1 PCR amplification reaction system

[0030]

[0031] Table 2 Primers used

[0032]

[0033] The ITS-rDNA sequence and ACT sequence of the strain were sequenced and analyzed, and the sequence results were compared using the BLAST program. The results showed that the strain belonged to the genus Xylaria. Xylaria ,and Xylaria sp. (A HMH-2021) has a similarity of 88.95%. Combined with morphological characteristics, the fungus was identified as a strain of the genus Xylaria and named .

[0034] Related sequences:

[0035] ACT (SEQ ID NO.2):

[0036] CTAACGCTATATGTCAGAGCTGTTTTCGTAAGTCTTCTCCAATTCTCACTGCTCGGCTCCGACCCCGCTTGTGGATTCATCTTCTGACCTCTGCACACAGCGTCCATTGTCGGTCGTCCCCGTCACAAGGGGTAAGTTGCCATTCTCCCCGCCGATAAGCCGCTGGCTTGGCCTCTCTGGACGTCTGCTCATCGTCTGCTCGCAGTATCATGATTGGTATGGGCCAGAAGGACTCGTAA

[0037] ITS (SEQ ID NO.1):

[0038] TTTGACTGGTGACAGCGGAGGGTCATTAAAGAGTTGCAAAACTCCCAACCCATGTGGACATACCTTCTGTTGCCTCGGTGGGGCCGCGGGAGCCCGGGCATGCCCGGAGCCGCCGCGGATCAAACCTGCCAGTGGCCCTCATGAACTCTGTTTAATTAGTTTACTTCTGAACCTATAACTAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCGACCCTTAAGCCCTCGTTGCTTAGTGTTGGGAGTGTACCAGATGGTAGCTCCCCAAAGTCAGTGGCGGAGTCGGTTCCAGGCTCTAGACGTAGTAGAATATCTCGTCTGCAGCTGGGCCCGGTCCCCTGCCGTAAAACACCATTATTTCTCAAGGTTGACCTCGAATCAGGTAAGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

[0039] Example 2 - Antioxidant activity

[0040] The strain was cultured using a liquid culture method. First, inoculate the strain, stored at -80°C, onto a PDA solid culture plate and place it in a 25°C incubator for activation. Wait until the mycelium has fully grown on the plate before use. Subsequently, use a sterile pipette tip to remove mycelial fragments from the edge of a well-growing colony. Five fragments per bottle were inoculated into an Erlenmeyer flask containing 300 mL of liquid culture medium. The inoculated Erlenmeyer flask was placed in a thermostatic shaker and incubated at 160 rpm and a constant temperature of 25°C in the dark.

[0041] After the incubation period, the shake flasks were removed and the mycelium was collected by filtration. The filtered mycelium was then dried in a 60°C oven to a constant weight before removal. The dried mycelium was ground into powder and sieved to obtain mycelial powder for future use as a sample. The antioxidant capacity of the mycelium was determined using a test kit from Beijing Solebold Technology Co., Ltd., according to the kit instructions.

[0042] (1) Determination of DPPH free radical scavenging ability

[0043] 1) Solution preparation:

[0044] Reagent 1: Prepare anhydrous ethanol, about 60 mL is needed, and store at room temperature.

[0045] Reagent 2: Place the powder in an EP tube within the bottle. Add 6.08 mL of Reagent 1 and shake to dissolve immediately before use. Prepare a working solution using the required amount of Reagent 2: Reagent 1 (V:V) at a ratio of 4:21. Prepare and use immediately.

[0046] 2) Sample processing:

[0047] Weigh about 0.05 g of sample, add 1 mL of extraction solution, and place in a 40°C water bath for 30 min; centrifuge at 10,000 rpm for 10 min at room temperature, collect the supernatant, and place on ice for testing.

[0048] 3) Determination steps:

[0049] ① Preheat the spectrophotometer for 30 minutes, adjust the wavelength to 515 nm, and zero with anhydrous ethanol.

[0050] ② Add 25 μL of extract and 975 μL of working solution to the blank tube; add 25 μL of supernatant and 975 μL of working solution to the assay tube; and add 25 μL of supernatant and 975 μL of reagent 1 to the control tube. Mix thoroughly and incubate at room temperature in the dark for 30 minutes. Measure the absorbance at 515 nm. Record the values ​​as A and B. 空白 、A 测定 、A 对照 .

[0051] 4) Calculation of DPPH free radical scavenging rate:

[0052] DPPH free radical scavenging rate D%=[A 空白 -(A 测定 -A 对照 )]÷A 空白 ×100%.

[0053] (2) Determination of ABTS free radical scavenging ability

[0054] 1) Solution preparation:

[0055] Reagent 2: Add 3 mL of distilled water before use and dissolve thoroughly.

[0056] Preparation of Reagent 3 working solution: Prepare Reagent 3 working solution according to the sample volume at the ratio of Reagent 3 (μL): distilled water (mL) = 1μL:12mL. Prepare it before use.

[0057] Preparation of Reagent 4 working solution: Prepare Reagent 4 working solution according to the sample volume at a ratio of Reagent 4: Reagent 1 (V:V) = 1:9 and use it immediately.

[0058] Preparation of ABTS working solution: Before use, prepare the working solution of reagent 1: reagent 2: reagent 3 (V:V:V) at a ratio of 76:5:4 based on the sample volume. Store at room temperature away from light and use within 30 minutes.

[0059] 2) Sample processing:

[0060] Weigh about 0.05 g of sample, add 1 mL of extraction solution, and place in a 40°C water bath for 30 min; centrifuge at 10,000 rpm for 10 min at room temperature, collect the supernatant, and place on ice for testing.

[0061] 3) Determination steps:

[0062] ① Preheat the spectrophotometer for 30 minutes and adjust the wavelength to 405nm.

[0063] ② Add 50 μL of distilled water, 100 μL of Reagent 4 working solution, and 850 μL of ABTS working solution to the blank tube; add 50 μL of supernatant, 100 μL of Reagent 4 working solution, and 850 μL of ABTS working solution to the assay tube; and add 50 μL of distilled water and 50 μL of 950 μL of Reagent 1 distilled water to the control tube. Mix thoroughly and incubate at room temperature in the dark for 6 minutes. Measure the absorbance at 405 nm. Record as A, B, C, and D, respectively. 空白 、A 测定 、A 对照 .

[0064] 4) Calculation of ABTS free radical scavenging rate:

[0065] ABTS free radical scavenging rate D%=[A 空白 -(A 测定 -A对照 )]÷A 空白 ×100%.

[0066] (3) Determination of total antioxidant capacity (FRAP method)

[0067] 1) Solution preparation:

[0068] Mixed solution (prepared and used immediately): Mix reagent 1, reagent 2, and reagent 3 in a ratio of 10:1:1 and preheat to 37°C before use.

[0069] 2) Sample processing:

[0070] Weigh about 0.1 g of sample, add 1 mL of extraction solution and homogenize in an ice bath, then centrifuge at 10,000 r / min and 4°C for 10 min, collect the supernatant and place on ice for testing.

[0071] 3) Determination steps:

[0072] ① Preheat the spectrophotometer for 30 minutes and adjust the wavelength to 593nm.

[0073] ② Add 50 μL of the extract and 950 μL of the mixed solution to the blank tube; add 50 μL of the sample and 950 μL of the mixed solution to the assay tube. Mix thoroughly and react for 20 minutes.

[0074] ③ Adjust to zero with double distilled water, use a 1mL glass cuvette, and measure the absorbance at 593nm. △A=A 测定 -A 空白 .

[0075] 4) Calculation formula for total antioxidant capacity:

[0076] Standard curve: y = 2.4832x + 0.0134 R 2 =0.9996

[0077] x: Trolox concentration (μmol / mL)

[0078] y: Absorbance difference △A

[0079] Unit definition: The total antioxidant capacity of the sample is expressed by the amount of the antioxidant Trolox obtained from the standard curve.

[0080] Total antioxidant capacity (μmol Trolox / mL) = (△A-0.0134) ÷ 2.4832 = 0.4027 × (△A-0.0134).

[0081] The antioxidant results are as follows:

[0082] (1) Mycelial DPPH free radical scavenging ability

[0083] The changes in the DPPH radical scavenging ability of mycelium showed three stages throughout the growth process. The scavenging ability was relatively low in the initial stage (5-8 days). The scavenging ability increased significantly in the middle stage (11-14 days) and reached a peak of 12.39% on the 14th day. In the late stage (17-20 days), the scavenging ability fluctuated and the activity of antioxidant active substances weakened, decreasing from 9.57% to 6.48%.

[0084] (2) Mycelial ABTS free radical scavenging ability

[0085] Throughout the growth process, the mycelial activity for scavenging ABTS free radicals and DPPH showed similar trends. Overall, there were three stages, with both peaking on the 11th day, suggesting that the antioxidant activity of the mycelium may be higher at this time point. The ABTS scavenging capacity reached a maximum of 91.21% on the 11th day.

[0086] (3) Total antioxidant capacity of mycelium

[0087] Overall antioxidant capacity fluctuated significantly during the culture process, with a slight decrease in the early stages, a significant increase in the middle stages, and a maximum, followed by a slight decrease in the later stages. The trend of change was similar to that of ABTS and DPPH free radical scavenging capacity throughout the growth process. Total antioxidant capacity reached a maximum of 8.9 μmol Trolox / g on day 14.

[0088] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications are also considered to be within the scope of protection of the present invention.

Claims

1. A Xylaria species, characterized in that The Xylaria species belongs to the genus Xylaria Xylaria , classified as , deposited in the China Center for Type Culture Collection, the deposit number is CCTCC NO: M2025949, and the deposit date is April 30, 2025.

2. A Xylaria mushroom according to claim 1, characterized in that described The ITS sequence is shown in SEQ ID NO.

1.

3. The use of a Xylaria mushroom according to claim 1 or 2, characterized in that described Application in the preparation of antioxidant preparation additives.

4. The use of Xylaria officinalis according to claim 3, characterized in that The anti-oxidation includes scavenging DPPH free radicals and / or scavenging ABTS free radicals.

5. The use of Xylaria officinalis according to claim 3, characterized in that The antioxidant preparation additives include .

Images