Primer probe combination for detecting ermB drug resistance gene based on RPA-CRISPR / Cas12a and application
Through RPA-CRISPR/Cas12a primer probe combination and fluorescence signal detection technology, the insensitivity and inflexibility of ermB resistance gene detection is solved, and the rapid and high specific detection effect is achieved, which is suitable for the detection of ermB resistance genes.
Patent Information
- Application Number
- CN202510446646.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-10
- Publication Date
- 2025-07-08
AI Technical Summary
The failure of the prior art to effectively detect ermB resistance genes has led to high levels of resistance to macrolide antibiotics, which poses challenges to clinical treatment and may lead to the spread of drug-resistant strains in community and hospital settings.
The RPA-CRISPR/Cas12a-based primer probe combination, including specifically designed upstream primers, downstream primers and crRNA probes, combined with recombinase polymerase, dNTP, single-stranded DNA reporter sequence and Cas12a protein, was used to achieve rapid detection of ermB drug-resistant genes through RPA amplification and fluorescence signal detection.
Fast and sensitive detection of ermB drug-resistant genes is achieved, solving the problems of insensitive, long time and high cost of existing methods, and can specifically identify ermB genes within the minimum detection limit of 10copies/μL.
Smart Images

Figure CN120272622A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of gene detection, and in particular to a primer-probe combination for detecting ermB drug-resistant gene based on RPA-CRISPR / Cas12a and its application. Background Art
[0002] Macrolide antibiotics are widely used clinically, mainly for treating infections caused by Gram-positive bacteria, and the phenomenon of bacterial resistance to macrolides is becoming increasingly serious. The erm gene of methylase is one of the important mechanisms leading to high-level macrolide resistance.
[0003] The ermB gene encodes a ribosomal methylase, which promotes the methylation or dimethylation modification of the bacterial ribosome, changes its structure, and then hides the binding site of macrolide antibiotics, preventing the binding of antibiotics to bacteria, thereby enabling bacteria to develop high-level resistance to macrolide antibiotics. This gene is not only present in Streptococcus pneumoniae and Streptococcus suis, but also widely distributed in other pathogenic bacteria, such as Streptococcus gallolyticus, Campylobacter jejuni, Staphylococcus, etc. Once these strains carry the ermB gene, their resistance to macrolide antibiotics will be significantly enhanced, posing a great challenge to clinical treatment. In addition, the spread of the ermB gene may lead to the spread of drug-resistant strains in the community and hospital environments, increasing the treatment difficulty and fatality rate of infections. Therefore, the presence and spread of the ermB gene pose a serious threat to public health and clinical treatment, and it is necessary to strengthen drug resistance monitoring and rational use of antibiotics to curb its further spread.
[0004] Due to its excellent specificity, strong signal transduction ability and good compatibility, the CRISPR / Cas12a system has become one of the most widely used systems in the field of biosensing detection in the CRISPR toolbox. This system specifically recognizes the target nucleic acid sequence through the CRISPR / Cas12a protein and the guide RNA (gRNA), and then uses its unique ability to non-specifically cleave single-stranded DNA (ssDNA) to achieve the detection of the target nucleic acid. The detection process usually combines visualization methods such as fluorescence, and the presence of the target nucleic acid is indicated by the release of fluorescence signals. In recent years, researchers have found that Cas12a can not only target double-stranded DNA, but also be activated by RNA and trans-cleave single-stranded DNA, which makes it show great potential in the field of biosensing beyond genome editing.
[0005] In practical applications, the CRISPR / Cas12a technology has been used to develop a variety of detection platforms, which can not only quickly detect target nucleic acids, but also achieve sensitive detection of small molecules. In addition, the application of this technology in the fields of food safety, environmental monitoring and clinical diagnosis has also been continuously expanded. In the prior art, the detection of ermB resistance gene based on RPA and CRISPR / Cas12a technology has not been achieved. Summary of the Invention
[0006] The object of the present invention is to provide a primer-probe combination for detecting ermB resistance gene based on RPA-CRISPR / Cas12a and its application, so as to solve the problems existing in the above prior art. The primer-probe combination involved in the present invention has good specificity, can not only quickly obtain the detection result, but also solves the problems of low sensitivity, long time and high cost of the current detection method.
[0007] To achieve the above object, the present invention provides the following solutions:
[0008] Technical solution 1: A primer-probe combination for detecting ermB resistance gene based on RPA-CRISPR / Cas12a, which is composed of an upstream primer sequence shown in SEQ ID NO.2, a downstream primer sequence shown in SEQ ID NO.3 and a crRNA probe sequence shown in SEQ ID NO.5.
[0009] Further, the upstream primer sequence and the downstream primer sequence are designed based on the 728bp conserved region specific to the ermB gene, and the 728bp conserved region sequence is shown in SEQ ID NO.1; the crRNA probe sequence is an RNA form that can guide Cas12a to cleave the ermB target gene and the single-stranded DNA reporter sequence.
[0010] Technical solution 2: The application of the primer-probe combination in the preparation of a kit for detecting ermB resistance gene based on RPA-CRISPR / Cas12a.
[0011] Technical solution 3: A kit for detecting ermB resistance gene based on RPA-CRISPR / Cas12a, including the primer-probe combination.
[0012] Further, it also includes recombinase polymerase, dNTP, single-stranded DNA reporter sequence, buffer, Cas12a protein.
[0013] Further, the single-stranded DNA reporter sequence contains at least one of TTT, ATT, TAT, TTA, AAT, ATA, TAA and AAA.
[0014] The reported sequences should at least include TTT, ATT, TAT, TTA, AAT, ATA, TAA and AAA, or combinations of the above sequences.
[0015] Furthermore, the 5' end of the single-stranded DNA reported sequence is modified with Atto 425, BODIPY FL, FAM, Oregon Green 488, TET, JOE, R6G, Yakima Yellow, VIC, HEX, Quasar 570, Cy3, NED, TAMRA, ROX, AquaPhluor 593, Texas Red, Atto 590, Cy5, Quasar 670 or Cy5.5; the 3' end of the single-stranded DNA reported sequence is modified with BHQ1, BHQ2, BHQ3, BBQ650, MGB or Dabcyl.
[0016] Technical solution four: A detection method for rapidly detecting ermB drug resistance gene for non-diagnostic purposes, including using the genomic DNA of the sample to be tested as a template, performing RPA-CRISPR / Cas12a reaction with the above primer-probe combination, irradiating with blue light after the reaction, if fluorescence is observed, the sample to be tested contains ermB drug resistance gene, if no fluorescence is observed, the sample to be tested does not contain ermB drug resistance gene.
[0017] The present invention utilizes the Cas12a protein to cleave the double-stranded DNA substrate at the target site under the guidance of the crRNA probe, releasing the product distal to the PAM, activating the non-specific cleavage of the single-stranded DNA reported sequence, and judging the result by visually observing the fluorescence under the irradiation of a blue light flashlight.
[0018] Furthermore, the reaction system of the RPA-CRISPR / Cas12a reaction includes: 2 μL of DNA template, 2.4 μL of upstream and downstream primers at 10 μM each, 5 μL of recombinase polymerase at 10× concentration, 5 μL of dNTP at 1× concentration, 0.8 μL of crRNA probe at 10 nM, 1 μL of single-stranded DNA reported sequence at 0.5 μM, 140 μL of buffer 1 at 1× concentration, 40 nM of Cas12a and 20 μL of buffer 2 at 1× concentration;
[0019] The components of buffer 1 are 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 g / mL Bovine serum albumin and 280 mM Magnesium acetate; the components of buffer 2 are 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 g / mL Bovine serum albumin.
[0020] Furthermore, the reaction conditions for the RPA-CRISPR / Cas12a reaction are to keep the temperature constant at 37°C and react for 60 minutes.
[0021] Technical solution five: Application of the primer-probe combination, the kit or the detection method in the detection of ermB resistance gene for non-diagnostic purposes.
[0022] The present invention discloses the following technical effects:
[0023] The present invention selects the ermB gene as the detection target gene, designs a set of RPA primers and crRNA probe combinations for the conserved region of this gene, amplifies nucleic acids using the RPA amplification technology, and under the guidance of the crRNA probe, uses the Cas12a enzyme to cut the single-stranded DNA reporter sequence, and detects through fluorescence signals, which can specifically detect the ermB resistance gene quickly, and the lowest detection limit can reach 10 copies / μL. The present invention can not only obtain the results quickly, but also solves the problems of insensitive current detection methods, long time, complex operation and high cost. Description of the Drawings
[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0025] Figure 1 It is the detection result of the ermB resistance gene of Enterococcus faecalis FLL4 and Staphylococcus pseudintermedius SP32 strains;
[0026] Figure 2 It is the fluorescence report result of the crRNA probe based on the amplification product of the optimal RPA primer;
[0027] Figure 3 It is the blue light report result of using the kit to detect the ermB resistance gene recombinant plasmid with sample concentrations of 10 7 copies / μL, 10 5 copies / μL and 10 3 copies / μL and the NC group (water);
[0028] Figure 4The detection results of genomic DNA of different samples (FLL4 (Enterococcus faecalis FLL4), SP32 (Staphylococcus pseudintermedius SP32), Campylobacter jejuni, Enterococcus faecalis, Escherichia coli, Staphylococcus aureus, Shigella flexneri, Salmonella typhimurium, Streptococcus pneumoniae)) were detected using the kit prepared in Example 2;
[0029] Figure 5 The fluorescence signal results of ermB resistance gene recombinant plasmid samples and the NC group (water) with different concentrations (10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 1 copy / μL and 0.1 copy / μL) were detected using the kit prepared in Example 2. Detailed implementation manners
[0030] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation embodiments of the present invention.
[0031] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.
[0032] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0033] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the specification of the present invention, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.
[0034] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.
[0035] Unless otherwise specified, the test methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, are all reagents and materials that can be obtained commercially.
[0036] The Campylobacter jejuni (C. jejuni) ATCC33291, Enterococcus faecalis (E. faecalis) ATCC29212, Escherichia coli (E. coli) ATCC25922, Staphylococcus aureus (S. aureus) ATCC29213, Shigella flexneri (S. flexneri) ATCC12022, Salmonella typhimurium (S. typhimurium) ATCC14028, Streptococcus pneumoniae (S. pneumoniae) ATCC49619 used in the examples of the present invention are all standard strains purchased; FLL4 (Enterococcus faecalis FLL4) was isolated by the Veterinary Drug Residue Benchmark Laboratory of Huazhong Agricultural University and deposited in the China Center for Type Culture Collection, with the deposit number CCTCC NO: M 2025359; SP32 (Staphylococcus pseudintermedius SP32) was isolated by the Veterinary Drug Residue Benchmark Laboratory of Huazhong Agricultural University and deposited in the China Center for Type Culture Collection, with the deposit number CCTCC NO: M2025360, and the deposit date was March 3, 2025.
[0037] Example 1
[0038] 1. Identification of ermB resistance gene
[0039] After resuscitating Enterococcus faecalis FLL4 and Staphylococcus pseudintermedius SP32, genomic DNA was extracted. The specific method was as follows: The resuscitated bacterial solution was centrifuged at 14000 rpm for 30 minutes, the supernatant was aspirated and discarded, 20 μL of sterile water was added, boiled for 30 min and then placed on ice bath for 15 min, and then centrifuged at 14000 rpm for 5 minutes. The supernatant was aspirated, which was the extracted DNA. After measuring its purity and concentration, it was stored at -20 °C for later use.
[0040] Using the extracted genomic DNA of FLL4 and SP32 bacteria as templates, PCR amplification was carried out with specific primers for the ermB gene (F: CCGTTTACGAAATTGGAACAGGTAAAGGGC (SEQ ID NO.6); R: GAATCGAGACTTGAGT GTGC (SEQ IDNO.7)).
[0041] Amplification system (total 20 μL): template 2 μL, 2×Taq PCR Mix 10 μL, upstream and downstream primers 1 μL each, ddH2O 6 μL.
[0042] Amplification program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, a total of 35 cycles; extension at 72°C for another 5 min. After the amplification was completed, the amplified products were detected by 1% agarose gel electrophoresis. The fragment size was 359 bp, and it could be confirmed that the ermB resistance gene was present in the FLL4 and SP32 strains (the detection results of the ermB resistance gene in Enterococcus faecalis FLL4 and Staphylococcus pseudintermedius SP32 strains are shown in Figure 1 ).
[0043] 2. Expression and purification of Cas12a protein
[0044] 600 When it reaches 0.6, add 0.5 mM IPTG (isopropyl β-D-thiogalactopyranoside), induce expression at 21 °C for 16 h, and then harvest the bacteria.
[0045] After harvesting the bacteria, resuspend them in lysis buffer (50 mM Tris-HCl, pH 7.5, 500 mM NaCl, 5% (v / v) glycerol, 1 mM TCEP, 0.25 mg / mL lysozyme), disrupt the bacteria by sonication, filter the supernatant obtained after disruption through a 0.22 μm filter membrane, purify it with a HisTrap HP nickel column, elute with 500 mM imidazole, concentrate it to 500 μL with a 50 KDa ultrafiltration tube, purify it by dextran gel chromatography (Superdex Increase 200), and store the target protein in storage buffer (20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 5% (v / v) glycerol, 1 mM TCEP), and freeze it at -80 °C in the refrigerator for later use.
[0046] 3. Preparation of single-stranded DNA reporter sequences
[0047] The single-stranded DNA reporter sequence contains at least one of TTT, ATT, TAT, TTA, AAT, ATA, TAA, and AAA; the 5' end of the single-stranded DNA reporter sequence is modified with Atto 425, BODIPYFL, FAM, Oregon Green 488, TET, JOE, R6G, YakimaYellow, VIC, HEX, Quasar 570, Cy3, NED, TAMRA, ROX, AquaPhluor 593, Texas Red, Atto590, Cy5, Quasar 670, or Cy5.5; the 3' end of the single-stranded DNA reporter sequence is modified with BHQ1, BHQ2, BHQ3, BBQ650, MGB, or Dabcyl. In this example, "TTT", "FAM", and "BHQ1" are used as examples.
[0048] Cas12a has a preference for TT in non-specific cleavage of single-stranded DNA. The single-stranded DNA reporter sequence (5'-3'): TTTTTT, with the 5' end modified with FAM and the 3' end modified with BHQ1, i.e., FAM-TTTTTT-BHQ1.
[0049] The single-stranded DNA reporter sequence is synthesized, purified, and confirmed by a bioengineering synthesis-related company.
[0050] 4. Screening and preparation of RPA primers
[0051] (1) Determination of candidate target sequences
[0052] Based on the ermB gene reference sequence, combined with the ermB gene sequences already sequenced in the laboratory and the ermB gene sequences retrieved from the National Center for Biotechnology Information (NCBI) gene bank, and compared them to obtain the gene target sequence, as shown in SEQ ID NO.1.
[0053] ermB gene target sequence (SEQ ID NO.1):
[0054] ATGAACAAAAATATAAAATATTCTCAAAACTTTTTAACGAGTGAAAAAGTACTCAACCAAATAATAAAACAATTGAATTTAAAAGAAACCGATACCGTTTACGAAATTGGAACAGGTAAAGGGCATTTAACGACGAAACTGGCTAAAATAAGTAAACAGGTAACGTCTATTGAATTAGACAGTCATCTATTCAACTTATCGTCAGAAAAATTAAAACTGAATACTCGTGTCACTTTAATTCACCAAGATATTCTACAGTTTCAATTCCCTAACAAACAGAGGTATAAAATTGTTGGGAGTATTCCTTACCATTTAAGCACACAAATTATTAAAAAAGTGGTTTTTGAAAGCCATGCGTCTGACATCTATCTGATTGTTGAAGAAGGATTCTACAAGCGTACCTTGGATATTCACCGAACACTAGGGTTGCTCTTGCACACTCAAGTCTCGATTCAGCAATTGCTTAAGCTGCCAGCGGAATGCTTTCATCCTAAACCAAAAGTAAACAGTGTCTTAATAAAACTTACCCGCCATACCACAGATGTTCCAGATAAATATTGGAAGCTATATACGTACTTTGTTTCAAAATGGGTCAATCGAGAATATCGTCAACTGTTTACTAAAAATCAGTTTCATCAAGCAATGAAACACGCCAAAGTAAACAATTTAAGTACCGTTACTTATGAGCAAGTATTGTCTATTTTTAATAGTTATCTATTATTTAACGGGAGGAAATAA.
[0055] Select the conserved region of the above gene target sequence for subsequent research.
[0056] (2) Screening and preparation of candidate RPA primers
[0057] Based on the conserved region sequence, the primer length is defined as 25 - 36 bp, and the product length is 80 - 300 bp. Use primer design-related software or websites to search, and select 3 pairs of primers with higher scores. The RPA primers are synthesized, purified, and confirmed by a bioengineering synthesis-related company. Through the RPA amplification experiment, determine the optimal RPA primers based on the amplified band size and product content. The sequences of the optimal RPA primers are shown as SEQ ID NO.2 and SEQ ID NO.3.
[0058] Forward primer (SEQ ID NO.2): TGTCTTAATAAAACTTACCCGCCATACCAC;
[0059] Reverse primer (SEQ ID NO.3): AAATTGTTTACTTTGGCGTGTTTCATTGCT.
[0060] 5. Screening and preparation of crRNA probes
[0061] (1) Determination of candidate crRNA probe sequences
[0062] Since Cas12a specifically cleaves double-stranded DNA and needs to recognize the PAM sequence (TTTN or TTN), the 20 nucleotides downstream of the PAM sequence are the regions where the crRNA probe hybridizes and recognizes the target-site double-stranded DNA. Search for PAM sites (5'-TTN-3' or 5'-NAA-3') in the conserved region of the gene to determine the crRNA targeting sequence. Select crRNA probes with higher scores. The crRNA targeting sequence is shown as SEQ ID NO.4.
[0063] crRNA targeting sequence (SEQ ID NO.4):
[0064]
[0065] (The underlined part is the sequence matching the RPA primer, and the bold part is the sequence matching the crRNA probe).
[0066] (2) Preparation of candidate crRNA probes
[0067] Add the T7 promoter sequence in front of the DNA sequence corresponding to the crRNA probe, then anneal it with its complementary sequence to slowly form a double-stranded DNA sequence, and use this as the template for in vitro transcription. Add T7 RNA polymerase and incubate at 37°C for 4 h. Use DNaseⅠ to digest the DNA template, and then recover the crRNA probe with an RNA purification kit.
[0068] (3) Screening of Optimal crRNA Probes
[0069] Using 2 μL of double-stranded DNA of the target gene at the same concentration as the substrate, add 0.8 μL of crRNA probe, 40 nM of Cas12a, 1× concentration of buffer 2, and 1 μL of single-stranded DNA reporter sequence. Screen for crRNA probes with high specificity and sensitivity by comparing the fluorescence signal intensities. The sequence of the optimal crRNA probe selected is shown in SEQ ID NO.5.
[0070] crRNA Probe Sequence (SEQ ID NO.5):
[0071] UAAUUUCUACUAAGUGUAGAUAAAAUGGGUCAAUCGAGAAU.
[0072] The fluorescence reporting experimental results of the crRNA probe based on the amplification product of the optimal RPA primer are as Figure 2 shown.
[0073] Example 2
[0074] 1. Preparation of Kit for Detecting ermB Resistance Gene Based on CRISPR / Cas12
[0075] Freeze-dry 2.4 μL of each of the 10 μM RPA upstream and downstream primers, 5 μL of 10× concentration of recombinase polymerase, 5 μL of 1× concentration of dNTP, 0.8 μL of 10 nM crRNA probe, and 1 μL of 0.5 μM single-stranded DNA reporter sequence at the bottom of a PCR tube to obtain lyophilized reagent 1, and store it in a vacuum-sealed manner with a foil bag. When in use, add 40 μL of buffer 1 to the PCR tube for reconstitution. Freeze-dry 20 μL of 40 nM Cas12a protein prepared in "1. Expression and Purification of Cas12a Protein" in Example 1 in a vial, and add 20 μL of buffer 2 for reconstitution when in use. Package the above reagents and a blue light flashlight in a box to obtain the kit. The compositions of buffer 1 and buffer 2 are shown in Table 1.
[0076] Table 1 Compositions of Buffer 1 and Buffer 2
[0077]
[0078] 2. Detection of ermB Resistance Gene Using the Kit
[0079] Using the extracted FLL4 genomic DNA as a template, PCR amplification was performed using the optimal RPA primers (SEQ ID NO.2 and SEQ ID NO.3). The amplification system and reaction conditions were the same as those for ermB drug resistance gene identification described above. After the reaction, 1% agarose gel electrophoresis was performed for detection, and the target fragment was excised for recovery and purification. The purified DNA was ligated to the pGEM-T vector, and the ligation product was incubated overnight at 4°C. Then, the ligated product was transferred into competent Escherichia coli DH5α cells by heat shock method and incubated at 37°C for 1 h. The bacterial solution was spread on an LB agar plate containing ampicillin (100 μg / mL) using a spreader and incubated overnight in a 37°C incubator to obtain cloned bacteria. Single colonies were picked for PCR and sequencing, and positive cloned bacteria with correct sequencing results were selected for extraction of recombinant plasmids. After measuring the plasmid concentration and absorbance value (A260 / 280), the copy number of the recombinant plasmid was calculated and diluted to 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 1 copy / μL and 0.1 copy / μL for use at -20°C.
[0080] Using the ermB drug resistance gene recombinant plasmid as a sample, the sample concentrations were diluted to 10 7 copies / μL, 10 5 copies / μL and 10 3 copies / μL, and a kit was used for detection. The detection steps were as follows:
[0081] (1) Add 40 μL of Buffer 1 to the lyophilized centrifuge tube for reconstitution;
[0082] (2) Take 2 μL of the genomic DNA to be tested and add it to the reconstituted PCR tube, then pipette and mix well;
[0083] (3) Spot 2 μL of the Cas12a reconstitution solution on the lid of the PCR tube and slowly cover the PCR tube lid;
[0084] (4) Incubate at 37°C for 30 min;
[0085] (5) Centrifuge to allow the Cas12a protein to enter the reaction system and incubate at 37°C for 30 min;
[0086] (6) Irradiate the bottom of the PCR centrifuge tube with a blue light flashlight and observe the fluorescence color. The visualization results are shown in Figure 3 .
[0087] Example 3
[0088] 1. Specific detection
[0089] Using the genomic DNA of FLL4, SP32 (the genomic DNA was the genomic DNA extracted in the previous drug resistance gene detection), Campylobacter jejuni, Enterococcus faecalis, Escherichia coli, Staphylococcus aureus, Shigella flexneri, Salmonella, and Streptococcus pneumoniae as samples, the kit of Example 2 was used for detection to analyze the specificity of the detection method of the present invention. The detection steps are as follows:
[0090] (1) Add 40 μL of Buffer 1 to the lyophilized centrifuge tube for reconstitution;
[0091] (2) Take 2 μL of the genomic DNA to be tested and add it to the reconstituted PCR tube, then pipette and mix well;
[0092] (3) Spot 2 μL of the Cas12a reconstitution solution on the lid of the PCR tube and slowly cover the PCR tube lid;
[0093] (4) Place it at a constant temperature of 37 °C and react for 30 min;
[0094] (5) Centrifuge to make the Cas12a protein enter the reaction system and react at a constant temperature of 37 °C for 30 min;
[0095] (6) Irradiate the bottom of the PCR centrifuge tube with a blue light flashlight and observe the fluorescence color to interpret the result.
[0096] The specific detection results are as Figure 4 shown. It can be seen from Figure 4 that using the kit prepared in Example 2 of the present invention for detection, FLL4 and SP32 can be successfully detected, while Campylobacter jejuni (C. jejuni), Enterococcus faecalis (E. faecalis), Escherichia coli (E. coli), Staphylococcus aureus (S. aureus), Shigella flexneri (S. flexneri), Salmonella typhimurium (S. typhimurium), and Streptococcus pneumoniae (S. pneumoniae) have no fluorescence signal and cannot be detected, proving that the detection method of the present invention has good specificity.
[0097] 2. Sensitivity detection
[0098] Using 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 101 Using ermB drug-resistant gene recombinant plasmids at concentrations of 10 copies / μL, 1 copy / μL, and 0.1 copy / μL as samples, with water as the negative control, the kit of Example 2 was used for detection to analyze the sensitivity of the detection method of the present invention. The detection steps were the same as those in "1. Specificity Detection".
[0099] The sensitivity detection results are as Figure 5 shown. As can be seen from Figure 5 , when using the kit prepared in Example 2 of the present invention to detect the ermB recombinant plasmid, fluorescence signals can be observed within the concentration range of the detection samples from 10 6 to 10 1 copies / μL. The lowest detection limit can reach 10 copies / μL, indicating high sensitivity.
[0100] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. A primer-probe combination for detecting ermB resistance gene based on RPA-CRISPR / Cas12a, characterized in that, It consists of an upstream primer sequence shown in SEQ ID NO.2, a downstream primer sequence shown in SEQ ID NO.3, and a crRNA probe sequence shown in SEQ ID NO.
5.
2. Use of the primer-probe combination according to claim 1 in the preparation of a kit for detecting ermB resistance gene based on RPA-CRISPR / Cas12a.
3. A kit for detecting ermB drug resistance gene based on RPA-CRISPR / Cas12a, characterized in that, It includes the primer-probe combination according to claim 1.
4. The kit according to claim 3, wherein It further includes recombinase polymerase, dNTP, single-stranded DNA reporter sequence, buffer, and Cas12a protein.
5. The kit according to claim 4, characterized in that, The single-stranded DNA reporter sequence contains at least one of TTT, ATT, TAT, TTA, AAT, ATA, TAA, and AAA.
6. The kit according to claim 5, wherein The 5' end of the single-stranded DNA reporter sequence is modified with Atto425, BODIPY FL, FAM, Oregon Green 488, TET, JOE, R6G, Yakima Yellow, VIC, HEX, Quasar 570, Cy3, NED, TAMRA, ROX, AquaPhluor 593, Texas Red, Atto 590, Cy5, Quasar 670, or Cy5.5; the 3' end of the single-stranded DNA reporter sequence is modified with BHQ1, BHQ2, BHQ3, BBQ650, MGB, or Dabcyl.
7. A detection method for rapidly detecting the ermB drug-resistant gene for non-diagnostic purposes, characterized in that, It includes using the genomic DNA of the sample to be tested as a template, performing RPA-CRISPR / Cas12a reaction with the primer-probe combination according to claim 1, irradiating with blue light after the reaction is completed. If fluorescence is observed, the sample to be tested contains ermB resistance gene; if no fluorescence is observed, the sample to be tested does not contain ermB resistance gene.
8. The detection method according to claim 7, characterized in that, The reaction system of the RPA-CRISPR / Cas12a reaction includes: 2 μL of DNA template, 2.4 μL of each of 10 μM upstream and downstream primers, 5 μL of 10× concentration of recombinase polymerase, 5 μL of 1× concentration of dNTP, 0.8 μL of 10 nM crRNA probe, 1 μL of 0.5 μM single-stranded DNA reporter sequence, 140 μL of 1× concentration of buffer, 40 nM of Cas12a, and 220 μL of 1× concentration of buffer; The components of buffer 1 are 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 g / mL Bovine serum albumin, and 280 mM Magnesium acetate; the components of buffer 2 are 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 g / mL Bovine serum albumin.
9. The detection method according to claim 7, wherein The reaction conditions of the RPA-CRISPR / Cas12a reaction are to keep at a constant temperature of 37 °C for 60 min.
10. Use of the primer-probe combination according to claim 1, the kit according to any one of claims 3-6, or the detection method according to any one of claims 7-9 for detecting the ermB drug-resistant gene for non-diagnostic purposes.