Multifunctional cross-linked dual-network bionic hydrogel stent as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biological materials and biomedical engineering, and particularly relates to a multifunctional cross-linked dual-network bionic hydrogel stent as well as a preparation method and application thereof. The multifunctional cross-linked dual-network bionic hydrogel stent comprises carbon-loaded cerium dioxide and gadolinium ion cross-linked dual-network hydrogel, and the gadolinium ion cross-linked dual-network hydrogel stent with gradient mechanical strength is prepared through a 3D printing technology. The multifunctional cross-linked dual-network bionic hydrogel stent has the characteristics of anti-tumor, anti-inflammatory and bionic mechanical properties and the like, and shows good anti-inflammatory, osteogenesis promoting and cartilage regeneration promoting capacities in vitro and in vivo. The material has excellent photo-thermal performance under 808 nm near infrared (NIR) irradiation, after irradiation, the material can be used for anti-tumor treatment at a high temperature (higher than 45 DEG C), tumor recurrence is effectively inhibited, and regeneration of cartilage and bones can be promoted at a mild temperature. By adopting the 3D printing technology, the shape-specific and personalized hydrogel stent printing of the irregular defect area can be realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomaterials and biomedical engineering, and particularly relates to a multifunctional cross-linked double-network bionic hydrogel scaffold and its preparation method and application. Background Art

[0002] Giant cell tumor of bone (GCTB) is one of the most common primary bone tumors with high invasiveness, and its local invasiveness often leads to severe bone and articular cartilage damage. Local resection is usually regarded as the preferred treatment method for GCTB, but due to incomplete removal of the peritumoral tissue, the recurrence rate is relatively high. In addition, extensive tumor resection may lead to large-area osteochondral defects, exceeding the self-repair ability of the body. Clinically used allogeneic bone filling and artificial joint replacement face problems such as limited donor sources and many surgical complications, and cannot achieve combined osteochondral repair. Therefore, the use of tissue engineering to achieve osteochondral regeneration and repair has received attention. During the healing process of large-area osteochondral defects, the generation of inflammation and a large amount of reactive oxygen species (ROS) will inhibit cell proliferation and differentiation. Therefore, it is urgent to explore new treatment strategies to coordinate tumor elimination and osteochondral defect repair, so as to further improve the treatment effect of giant cell tumor of bone.

[0003] To address this challenge, the following three key conditions must be met: 1) Eliminate residual tumor cells after local resection to prevent recurrence before osteochondral defect reconstruction; 2) Remove ROS and inflammation during the osteochondral defect reconstruction stage to promote tissue regeneration; 3) Simulate the gradient mechanical structure of natural osteochondral from cartilage to subchondral bone to achieve precise osteochondral regeneration. Therefore, the development of a new type of multifunctional material with anti-tumor, anti-inflammatory and appropriate mechanical properties is crucial for promoting osteochondral regeneration and repair. Summary of the Invention

[0004] The present invention provides a multifunctional cross-linked double-network bionic hydrogel scaffold and its preparation method and application to solve the above technical problems.

[0005] The present invention is achieved through the following technical solutions.

[0006] A multifunctional cross-linked double-network bionic hydrogel scaffold (Gd-CeDN hydrogel scaffold), comprising a main active ingredient and a double-network bionic hydrogel scaffold. The main active ingredient is selected as carbon-supported cerium dioxide (C-CeO2) material, and the double-network bionic hydrogel scaffold material is selected as gadolinium ion-crosslinked double-network hydrogel MBAA / PAM / SA / Gd (Gd-DN) material.

[0007] As a preferred embodiment of the multifunctional crosslinked double-network bionic hydrogel scaffold, the main active ingredient C-CeO2 is prepared by dissolving ammonium cerium(IV) nitrate and sodium acetate in absolute ethanol, adding acetic acid, and then transferring the mixture to an autoclave. After heating and washing, the dispersion is freeze-dried.

[0008] In the above technical solution, in C-CeO2, ammonium cerium(IV) nitrate (5 mmol), sodium acetate (122 mmol), 56 mL of absolute ethanol, and 10 mL of acetic acid are used. After stirring the mixture at room temperature for 1 hour, the mixture is transferred to a 100 mL Teflon-lined autoclave. The autoclave is sealed in a metal shell and heated at 220 °C for 12 h. After the solvothermal reaction is completed, the suspension is centrifuged at 12,000 rpm and washed three times with deionized water.

[0009] As a preferred embodiment of the multifunctional crosslinked double-network bionic hydrogel scaffold, the gadolinium ion crosslinked double-network hydrogel contains polyacrylamide (PAM) crosslinked by N,N'-methylenebisacrylamide (MBAA) and 3+ sodium alginate (SA) crosslinked by Gd. The double-network bionic hydrogel scaffold material is prepared by 3D printing technology using MBAA / PAM / SA / Gd (Gd-DN) as bioink.

[0010] Preparation method 1: A multifunctional crosslinked double-network bionic hydrogel scaffold is prepared by 3D printing technology using a gadolinium ion crosslinked double-network hydrogel with a single configuration as bioink.

[0011] Preparation method 2: By adjusting the content of the crosslinking agent N,N'-methylenebisacrylamide, a multifunctional crosslinked double-network bionic hydrogel scaffold with gradient mechanical strength is prepared by 3D printing technology. Specifically: by adjusting the content of the crosslinking agent N,N'-methylenebisacrylamide, various configurations of inks are obtained, and a multifunctional crosslinked double-network bionic hydrogel scaffold with gradient mechanical strength is prepared by 3D printing technology using these inks as bioink.

[0012] In the above technical solution, N,N'-methylenebisacrylamide with two or more different contents is respectively dissolved in deionized water together with polyacrylamide, sodium alginate, and carbon-supported cerium dioxide to obtain two or more configurations of inks. These inks are used as bioinks for printing a multifunctional crosslinked double-network bionic hydrogel scaffold to prepare a 3D-printed multifunctional crosslinked double-network bionic hydrogel scaffold with a gradient change in mechanical strength. As an example: To prepare a 3D-printed Gd-CeDN hydrogel scaffold with a gradient change in mechanical strength, inks with two different MBAA contents (2.5‰ and 10‰) were respectively prepared. One ink configuration is: AM (0.71 g, 10 mmol), SA (500 mg), MBAA (12.5 mg), and C-CeO2 (2.5 mg) are dissolved in 5 mL of deionized water; the other ink configuration is: AM (0.71 g, 10 mmol), SA (500 mg), MBAA (50 mg), and C-CeO2 (2 mg) are dissolved in 5 mL of deionized water. 20 μL of 1173 photoinitiator is added respectively and stirred evenly. The prepared inks are centrifuged at 7500 rpm for 5 min to remove air bubbles. The printing nozzle diameter is selected to be 0.35 mm. The printing parameters are set as follows: air pressure 0.48 MPa, filament speed 15 mm / s, filling spacing 0.65 mm, layer height 0.35 mm, rotation angle 90°. The first 20 layers are printed with the hydrogel precursor containing 10‰ MBAA. After completion, the tube is manually replaced with a tube filled with the hydrogel precursor containing 2.5‰ MBAA, and then another 20 layers are printed. After irradiation with ultraviolet (UV) light, the preliminarily crosslinked scaffold is immersed in a 1 M Gd 3+ solution for further crosslinking for 1 hour. The taken-out scaffold is repeatedly rinsed with deionized water for subsequent operations.

[0013] Furthermore, to prepare the MBAA-crosslinked PAM hydrogel (MBAA / PAM), AM (0.71 g, 10 mmol) and 20 μL of 1173 photoinitiator are dissolved in 5 mL of deionized water, and the MBAA ethanol solution is added according to Table 1. Among them, the initial solution concentration of MBAA is 117.5 mg·mL -1 . After thorough mixing, the above mixture is stirred evenly, transferred to a 25 mm×3 mm mold, and crosslinked in a UV crosslinking agent for 1800 s to obtain the MBAA / PAM hydrogel.

[0014] Further, when preparing the Gd-DN hydrogel, AM (0.71 g, 10 mmol), SA (500 mg), and 20 μL of 1173 photoinitiator were dissolved in 5 mL of deionized water, and a certain amount of MBAA ethanol solution was added to prepare the Gd-DN hydrogel. After mixing evenly, the above mixture was transferred to a mold of 25 mm × 3 mm and crosslinked in a UV crosslinker for 1800 s. Then, the hydrogel was soaked in a 1 M GdCl3 solution for 1 h to obtain the Gd-DN hydrogel.

[0015] The second object of the present invention is to provide a preparation method of a multifunctional crosslinked double-network bionic hydrogel scaffold, comprising the following steps:

[0016] S1. Ammonium cerium(IV) nitrate and sodium acetate were dissolved in absolute ethanol, acetic acid was added, and then the mixture was transferred to an autoclave. After heating and washing, the dispersion was freeze-dried to prepare carbon-supported cerium dioxide C-CeO2.

[0017] S2. Inks with two or more configurations were prepared respectively; for example: inks with two different MBAA contents (2.5‰ and 10‰) were prepared respectively; one ink configuration was: AM (0.71 g, 10 mmol), SA (500 mg), MBAA (12.5 mg), and C-CeO2 (2.5 mg) were dissolved in 5 mL of deionized water; another ink configuration was: AM (0.71 g, 10 mmol), SA (500 mg), MBAA (50 mg), and C-CeO2 (2 mg) were dissolved in 5 mL of deionized water, and a photoinitiator was added and stirred evenly.

[0018] S3. Preparing a multifunctional crosslinked double-network bionic hydrogel scaffold: using the carbon-supported cerium dioxide prepared in step S1 as the main active ingredient, and using the mixture prepared in step S2 as the bioink to print the multifunctional crosslinked double-network bionic hydrogel scaffold. After ultraviolet light irradiation, the preliminarily crosslinked scaffold was immersed in a Gd 3+ solution for further crosslinking, and the taken-out scaffold was repeatedly rinsed with deionized water to obtain the multifunctional crosslinked double-network bionic hydrogel scaffold.

[0019] In the above technical solution, in step S1, ammonium cerium(IV) nitrate (5 mmol), sodium acetate (122 mmol), 56 mL of absolute ethanol, and 10 mL of acetic acid. After stirring the above mixture at room temperature for 1 hour, the mixture was transferred to a 100 mL Teflon-lined autoclave, the autoclave was sealed in a metal shell, heated at 220 °C for 12 h. After the solvothermal reaction ended, the suspension was centrifuged at 12,000 rpm and washed 3 times with deionized water.

[0020] In the above technical solution, in step S2, the photoinitiator is 20 μL of 1173 photoinitiator, and the lower 20 layers are printed using a hydrogel precursor containing 10‰ MBAA. After completion, the tube is manually replaced with a tube filled with a hydrogel precursor containing 2.5‰ MBAA, and then 20 more layers are printed.

[0021] By adopting the above technical solution, the present application uses 3D printing technology to design and prepare a multifunctional cross-linked double-network bionic hydrogel scaffold composed of 3D printed Gd-CeDN hydrogel scaffolds with gradient changes in the main active ingredient and mechanical strength.

[0022] The third object of the present invention is to provide an application of a multifunctional cross-linked double-network bionic hydrogel scaffold in the preparation of a product for treating osteochondral defects after bone tumor resection.

[0023] The fourth object of the present invention is to provide an application of a multifunctional cross-linked double-network bionic hydrogel scaffold in the preparation of a product for treating osteochondral defects.

[0024] The advantages and positive effects of the present invention are as follows:

[0025] 1. The Gd-CeDN hydrogel scaffold prepared by the present invention has the functions of anti-tumor, anti-inflammatory and promoting the repair of osteochondral defects. After the incorporation of C-CeO2, it not only exhibits anti-inflammatory effects but also has photothermal ability to promote osteochondral differentiation. The osteochondral repair ability of the present invention can be achieved through the photothermal properties of the Gd-CeDN hydrogel scaffold and the sustained release of Gd 3+ , which can effectively promote bone differentiation and cartilage differentiation, and meet the needs of osteochondral defects in different parts by adjusting the mechanical strength of the scaffold. The present invention has the anti-tumor effect of photothermal therapy. The photothermal properties of C-CeO2 endow the hydrogel scaffold with anti-tumor ability. Tumor photothermal therapy can be achieved by controlling the near-infrared radiation parameters, and it will not affect normal tissues, providing a new strategy for the treatment of osteochondral injuries and bone tumors.

[0026] 2. The multifunctional Gd-CeDN composite hydrogel scaffold of the present invention has shown good anti-inflammatory, osteogenic and chondrogenic regeneration abilities both in vitro and in vivo, and exhibits excellent photothermal performance under 808 nm near-infrared (NIR) irradiation. After irradiation, high temperature (above 45 °C) can be used for anti-tumor treatment to effectively inhibit tumor recurrence, while mild temperature can promote the regeneration of cartilage and bone.

[0027] 3. The present invention uses 3D printing technology, which can realize the printing of hydrogel scaffolds with specific shapes and personalization for irregular osteochondral defect areas. It is expected to combine clinical imaging digital data and use software to simulate the defect morphology to print the scaffold specifically, which conforms to the digital, refined and individualized clinical treatment mode.

[0028] In addition, as the auxiliary evidence of the creativity of the present invention, it is also reflected in the following important aspects:

[0029] 1. The technical solution of the present invention relates to the preparation and application of a multifunctional cross-linked double-network bionic hydrogel scaffold, which is expected to have broad commercial prospects after transformation. Its main application fields include tumor treatment, tissue repair, and bone and soft tissue regeneration. Since this hydrogel has multiple functions such as anti-tumor, anti-inflammatory, bone formation promotion, and cartilage regeneration promotion, the market demand for it in the biomedical field is huge. Combining with 3D printing technology, personalized scaffold shapes can be customized according to the specific needs of individuals, improving the accuracy and effectiveness of applications. With the continuous progress of medical technology and the increasing demand for personalized treatment, this invention is expected to generate significant commercial value in the biomedical engineering industry. Specifically, the present invention is expected to occupy a market share in the fields of tumor treatment, orthopedics and joint repair surgery, and regenerative medicine, bringing relatively high economic benefits, and at the same time promoting the industrialization process of related materials and equipment.

[0030] 2. At present, although multifunctional bionic hydrogel scaffolds on the market have been widely studied and applied, most of them have single functionality and cannot meet the requirements of anti-tumor, biological regeneration promotion, and mechanical property gradient. In addition, traditional hydrogel preparation methods often rely on single components and lack complex cross-linked structures and customization characteristics. Compared with the prior art, the present invention combines carbon-loaded cerium dioxide and gadolinium ion cross-linked double-network hydrogels, and realizes the customization of gradient mechanical strength through 3D printing technology, making up for the deficiencies in the prior art. In particular, this technical solution can simultaneously meet the biomechanical requirements and functional requirements, filling the demand gap for efficient, personalized, and multifunctional biomaterials in the domestic and foreign markets, and having originality and leading nature.

[0031] 3. The technical solution of the present invention solves technical problems that have not been successfully solved in multiple medical fields for a long time, especially in the fields of tumor treatment and tissue regeneration. Traditional tumor treatment methods have treatment limitations and cannot effectively inhibit tumor recurrence or promote the complete cure of tumors. However, the present invention realizes hyperthermia treatment by irradiating with 808nm near-infrared light, which can not only effectively inhibit tumor recurrence but also promote the regeneration of cartilage and bone tissues through mild temperature. In addition, this technology has successfully solved the problems of the lack of gradient mechanical properties and personalized customization of existing hydrogel scaffolds, making it have higher application value in complex tissue repair. Therefore, the present invention not only solves the technical bottleneck that has long troubled the medical field but also provides a new solution for clinical treatment, having practical social value and application significance.

[0032] 4. The present invention overcomes the technical biases of traditional biomaterials in terms of multifunctionality, mechanical properties, and personalized customization. For a long time, there has been a technical bias in the field of biogels that hydrogels with high mechanical strength tend to lack sufficient biocompatibility or are relatively single-functional. At the same time, 3D printing technology also faces challenges in material properties and printing accuracy in the application of complex biological scaffolds. However, by innovatively combining carbon-loaded cerium dioxide and gadolinium ion-crosslinked double-network hydrogels, the present invention not only retains excellent biocompatibility but also achieves adjustable strength gradients through 3D printing technology, overcoming the limitations of these traditional materials and technologies, and demonstrating that mechanical properties and personalized customization can also be achieved while meeting multiple biological functions. Therefore, the present invention has successfully broken through the biases of traditional technologies and promoted the new development of biomaterial technology. Brief Description of the Drawings

[0033] The technical solutions of the present invention will be further described in detail below in conjunction with the drawings and embodiments. However, it should be understood that these drawings are only designed for explanatory purposes and thus do not limit the scope of the present invention. In addition, unless otherwise specified, these drawings are only intended to conceptually illustrate the structural configurations described herein and are not necessarily drawn to scale.

[0034] Figure 1 are the basic characterizations of C-CeO2 and CeO2 of the present invention. Among them: A) Electron image; B) TEM image; C) HRTEM image; D) Element distribution map; E) XRD spectrum of C-CeO2; F) Raman spectra of C-CeO2 and CeO2; G) UV-Vis-NIR absorption spectra of C-CeO2 and CeO2; H) Ce 3D XPS spectrum of C-CeO2; I) O1s XPS spectrum of C-CeO2.

[0035] Figure 2 are the photothermal performance characterizations of C-CeO2 of the present invention. Among them: A) UV-Vis-NIR absorption spectra of C-CeO2 aqueous dispersions with different concentrations; B) Temperature change curves of C-CeO2 aqueous dispersion (0.1 mg·mL -1 ) under 808 nm near-infrared irradiation at different power densities for 300 seconds; C) Temperature change curves of C-CeO2 aqueous dispersion with different concentrations (1.0 W·cm -2 ) for 300 seconds under 808 nm near-infrared irradiation; D) C-CeO2 aqueous dispersion (0.8 mg·mL -1 ) under 808 nm near-infrared irradiation with a power density of 1.0 W·cm -2Heating-cooling cycles at this time; here, when the temperature of the dispersion no longer rises, near-infrared irradiation is stopped; E) The linear relationship between the time data obtained from the cooling process and -ln(θ), where θ is the dimensionless driving force temperature, details of which are described in the supporting information; F) MG-63 cells were co-incubated with different concentrations of C-CeO2 and the cell viability was detected after 300 seconds of 808 nm near-infrared irradiation (1.0 W·cm -2 )

[0036] Figure 3 is the result graph of the anti-inflammatory effect of the present invention. Among them: A) Using the gallic aldehyde method to characterize the O2 ·- scavenging ability of C-CeO2; B) Using salicylic acid to characterize the ·OH scavenging ability of C-CeO2: the absorption curve of the ·OH derivative product after reacting with different concentrations of C-CeO2 for 10 minutes; C) After reacting with salicylic acid, the absorption curve of the ·OH derivative product of C-CeO2 (500 μg·mL -1 ) at different reaction times; D) Using the titanium salt method to characterize the H2O2 scavenging effect of different concentrations of C-CeO2; E) The change in dissolved oxygen content after the CAT-like activity of C-CeO2 at different concentrations decomposes H2O2 into H2O and O2; F) Intracellular ROS and O2 staining images of RAW 264.7 cells after H2O2 treatment with or without C-CeO2 (500 μg·mL -1 ). The scale bar is 100 μm; G) Flow cytometry analysis of the polarization of RAW264.7 macrophages after different treatments; H) Inflammatory-related gene expression of RAW 264.7 macrophages after different treatments: H) IL-10, I) IL-1β, J) NOS2, K) TNF-α, L) IL-6, n = 4, *p < 0.05, **p < 0.01, ***p < 0.001.

[0037] Figure 4 is the characterization of the composite gel of the present invention. Among them: A) The swelling ratio of MBAA / PAM and Gd-DN hydrogels with different MBAA contents; B) The stress-strain curves of Gd-DN hydrogels with different MBAA contents; C) The Young's modulus of Gd-DN hydrogels with different MBAA contents. *p < 0.05. Photothermal properties of the 3D-printed Gd-CeDN hydrogel scaffold: D) Temperature change curve; E) Infrared image; F) SEM image and surface element distribution of the 3D-printed Gd-CeDN hydrogel scaffold after biomimetic mineralization treatment, the scale bar is 500 μm; G) Degradation of the Gd-CeDN hydrogel scaffold in simulated body fluid (SBF) with or without 808 nm near-infrared radiation, where the power density of NIR is 1 W·cm -2, the light illumination duration is 10 minutes per day; H) Cumulative release amount of Gd from the Gd-CeDN hydrogel scaffold in SBF under 808 nm near-infrared radiation and without it, where the power density of NIR is 1 W·cm 3+ , and the light illumination duration is 10 minutes per day; I) Live / dead staining images of ROB cells cultured on the 3D-printed Gd-CeDN hydrogel scaffold, with a scale bar of 200 μm; J) F-actin and nucleus staining images of ROB cells attached to the 3D-printed Gd-CeDN hydrogel scaffold, with a scale bar of 200 μm. -2 is the result graph of the mineralization ability of the composite gel of the present invention. Among them: A) Images of calcified nodules of ROB cells on the 21st day after different treatments; B) Alkaline phosphatase (ALP) staining images of ROB cells, with a scale bar of 200 μm. Among them: C) Alcian Blue staining images of BMSCs on the 7th day after different treatments, with a scale bar of 100 μm, and osteogenesis-related gene expressions under different conditions and treatments: D) ALP; E) BMP-2; F) OPN; G) Runx2; H) Col-I, and chondrogenesis-related gene expressions under different conditions and treatments: I) AGG; J) Col-I; K) Col-II; L) SOX9, *p < 0.05, **p < 0.01, ***p < 0.001.

[0038] Figure 5 is the in vivo anti-tumor characterization of the Gd-CeDN hydrogel of the present invention. Among them: A) Temperature change curve of the tumor site after 808 nm near-infrared radiation (1.5 W·cm

[0039] Figure 6 , 10 minutes); B) Tumor volume changes of mice in each group. n = 5, ***p < 0.001; C) Body weight changes of mice in each group; D) Images of tumors taken out from mice after the experiment; E) H&E staining, Ki67 staining and TUNEL staining images of tumor tissue sections of mice in each group, with a scale bar of 200 μm. -2 is the in vivo subchondral repair result graph of the Gd-CeDN hydrogel of the present invention. Among them: A) Gd-CeDN hydrogel was implanted and irradiated with 808 nm near-infrared light (2.0 W·cm

[0040] Figure 7 , and the light illumination duration is 10 minutes per day; I) Live / dead staining images of ROB cells cultured on the 3D-printed Gd-CeDN hydrogel scaffold, with a scale bar of 200 μm; J) F-actin and nucleus staining images of ROB cells attached to the 3D-printed Gd-CeDN hydrogel scaffold, with a scale bar of 200 μm. -2, Infrared images of the knee joint area after irradiation (10 minutes), quantitative Micro-CT data of newly formed subchondral bone mass in different groups: B) Bone volume ratio (BV / TV); C) Trabecular number (Tb.N); D) Trabecular thickness (Tb.Th); E) Trabecular separation (Tb.Sp), n = 4, **p < 0.01; ***p < 0.001; F) Reconstructed Micro-CT images of newly formed subchondral cartilage in different groups; G) H&E staining of newly formed subchondral cartilage at 12 weeks, scale bar is 500 μm; H) Col-I immunohistochemical staining of newly formed subchondral cartilage at 12 weeks, scale bar is 200 μm.

[0041] Figure 8 It is a diagram showing the cartilage repair results of the Gd-CeDN hydrogel of the present invention in vivo. Among them: A) Photographs of repaired cartilage in different groups at 12 weeks; B) 3D reconstruction images of repaired cartilage at 12 weeks; C) H&E staining of newly formed cartilage in different groups at 12 weeks; D) Safranin O / fast green staining, scale bar is 500 μm; E) Immunohistochemical staining images of Col-II of newly formed cartilage in different groups at 12 weeks; F) Immunohistochemical staining images of Col-X, scale bar is 200 μm.

[0042] Figure 9 It is a diagram showing the XPS spectrum results of C-CeO2 of the present invention.

[0043] Figure 10 It is a diagram showing the cell viability results of ROBs cells co-incubated with different concentrations of C-CeO2 of the present invention.

[0044] Figure 11 It is a diagram showing the live / dead staining results of MG-63 cells after being irradiated with 808 nm near-infrared (1.0 W·cm -2 ) for 300 s at different concentrations of C-CeO2 of the present invention, and the scale bar size is 200 μm.

[0045] Figure 12 It is a diagram showing the cell viability results of RAW 264.7 cells co-incubated with different concentrations of C-CeO2 of the present invention.

[0046] Figure 13 It is a diagram showing the ROS scavenging experiment results of RAW 264.7 treated with different concentrations of C-CeO2 of the present invention, and the scale bar size is 100 μm.

[0047] Figure 14 It is the O2 generation experiment of RAW 264.7 treated with different concentrations of C-CeO2 of the present invention, and the scale bar size is 100 μm.

[0048] Figure 15 It is a diagram of the PAM hydrogel and MBAA / PAM hydrogel of the present invention.

[0049] Figure 16 Images of MBAA / PAM hydrogels and Gd-DN hydrogels with different MBAA contents of the present invention.

[0050] Figure 17 Results diagram of the swelling capacity of MBAA / PAM hydrogels and Gd-DN hydrogels with different dosages of MBAA of the present invention.

[0051] Figure 18 Structural diagram of the influence of Gd-DN hydrogels with different contents on the cell viability of ROBs of the present invention.

[0052] Figure 19 Results diagram of the qualitative compressive capacity test of the 3D printed gradient hydrogel scaffold of the present invention.

[0053] Figure 20 SEM images and surface element distribution results diagram of the 3D printed Gd-CeDN hydrogel scaffold before biomimetic mineralization of the present invention, with a scale bar of 500 μm.

[0054] Figure 21 Osteogenic differentiation of ROBs under different temperature stimuli of the present invention: (a) ALP staining method; (b) calcium nodule staining method, with a scale bar of 200 μm.

[0055] Figure 22 Results diagram of observing the chondrogenic differentiation of bone marrow mesenchymal stem cells under different temperature stimuli by Alcian blue staining of the present invention, with a scale bar of 200 μm.

[0056] Figure 23 Results diagram of observing the osteogenic differentiation of ROBs after different treatments by calcium nodule staining of the present invention, with a scale bar of 200 μm.

[0057] Figure 24 ALP staining results diagram of the osteogenic differentiation of ROBs after different treatments of the present invention, with a scale bar of 200 μm.

[0058] Figure 25 Images of reconstructing the subchondral bone Micro-CT of rabbits in each group at 4 and 8 weeks of the present invention.

[0059] Figure 26 HE staining results diagram of the subchondral bone of rabbits in each group at 4 and 8 weeks of the present invention. The scale is 500 μm.

[0060] Figure 27 Col-I immunohistochemical staining results diagram of the newly formed subchondral bone of rabbits in each group at 4 and 8 weeks of the present invention. The scale bar is 200 μm.

[0061] Figure 28It is the morphological volume result diagram of the knee joints of each group at 4 and 8 weeks in the present invention.

[0062] Figure 29 It is the three-dimensional reconstruction image result diagram of the morphology of each group at 4 and 8 weeks in the present invention.

[0063] Figure 30 It is the HE staining diagram of the newly formed cartilage of rabbits in each group at 4 and 8 weeks in the present invention, and the scale size is 100μm.

[0064] Figure 31 It is the safranin-fast green staining diagram of the newly formed cartilage of rabbits in each group at 4 and 8 weeks in the present invention, and the scale size is 100μm.

[0065] Figure 32 It is the immunohistochemical staining result diagram of Col-II of the newly formed cartilage of rabbits in different groups at 4 and 8 weeks in the present invention, and the scale size is 200μm.

[0066] Figure 33 It is the immunohistochemical staining diagram of Col-X of the newly formed cartilage of rabbits in different groups at 4 and 8 weeks in the present invention, and the scale size is 200μm.

[0067] Figure 34 It is the HE staining image of the main organs of mice after different treatments in the present invention, and the scale size is 500μm.

[0068] Figure 35 It is the HE staining image of the main organs of New Zealand rabbits after different treatments in the present invention, and the scale size is 500μm.

[0069] Figure 36 It is the blood routine examination results of New Zealand rabbits in different treatment groups of the present invention: (A) Albumin (ALB); (B) Alkaline phosphatase (ALP); (C) Alanine aminotransferase (ALT); (D) Acetyltransferase (AST); (E) Creatine kinase (CK); (F) Creatinine (CREA); (G) Glucose (Glu); (H) Total bilirubin (T-Bil); (1) Total cholesterol (TC); (J) Triglyceride (TG); (K) Total protein; (Left) Urea; (M) Gamma-glutamyl transferase (γ-GT). Detailed implementation mode

[0070] The following further describes this patent application in conjunction with the drawings and embodiments.

[0071] I. Preparation and characterization of component materials

[0072] Sodium chloride (NaCl, 99.5%), sodium bicarbonate (NaHCO3, 99.5%), potassium chloride (KCl, 99.5%), dipotassium hydrogen phosphate trihydrate (K2HPO4·3H2O, 99%), hydrogen peroxide (H2O2, 30%), magnesium chloride hexahydrate (MgCl2·6H2O, 99%), calcium chloride (CaCl2, 96%), sodium sulfate (Na2SO4, 99%) were purchased from Damao Chemical Reagent Factory. Acrylamide (AM, C3H5NO, ≥99%), vitamin B2 (C 17 H 20 N4O6, 98%), tris(4,7-diphenyl-1,10-phenanthroline) ruthenium dichloride (C 72 H 48 Cl2N6Ru, 95%), methionine (C5H 11 O2NS, 96%), nitro blue tetrazolium chloride (NTB, C 40 H 30 Cl2N 10 O6, 98%), 3,3′,5,5′-tetramethylbenzidine (C 16 H 20 N2, 98%) were purchased from Heowns Biochemical Technology Co., Ltd. Sodium alginate (SA, (C6H7O6Na)n, medium viscosity), N,N'-methylenebisacrylamide ((CH2CHCONH)2CH2, MBAA, ≥99.5%), tris(hydroxymethyl)aminomethane (C4H 11 NO3, ≥99%), ITS liquid medium supplement (100-fold), L-proline (C5H9NO2, 99%) were purchased from Sigma-Aldrich Corporation. Dexamethasone (C 22 H 29 FO5, 98%), disodium β-glycerophosphate pentahydrate (C3H7Na2O6P·5H2O, 98%), acetic acid (CH3COOH, 99.5%), cerium(IV) diammonium nitrate (Ce(NH4)2(NO3)6, 99%), sodium pyruvate (C3H3NaO3, >99.0%), alcian blue (C 56 H 68 Cl4CuN 16 S4, >98%) were purchased from Shanghai Macklin Biochemical Co., Ltd. Sodium salicylate (C7H5O3Na, 99%), 2-hydroxy-2-methylpropiophenone (IRGACURE 1173, C 10 H 12Oxygen (O2) and ferrous sulfate (FeSO4, 99%) were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Titanium sulfate (Ti(SO4)2, 96%) was purchased from Shanghai Dibo Experimental Equipment Co., Ltd. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, C18H16BrN5S, ultrapure grade), Cell Counting Kit-8 (CCK-8), 4′,6-diamidino-2-phenylindole (C 16 H 15 N5, DAPI), BCIP / NBT Alkaline Phosphatase Color Development Kit, Alizarin Red S, Triton X-100 solution, 2′,7′-dichlorodihydrofluorescein (C 24 H 16 Cl2O7, DCFH-DA, 97%) were purchased from Beyotime Biotechnology. PE anti-mouse F4 / 80, FITC anti-mouse CD86, and APC anti-mouse CD206 were purchased from BioLegend. The cell RNA rapid extraction kit was purchased from Shandong Sparkjade Biotechnology Co., Ltd. Green Pro Tag HS Premix Kit and Evo M-MLV Reverse Transcription Premix Kit were purchased from Accurate Biology Co., Ltd. Dulbecco's Modified Eagle Medium (DMEM), Minimum Essential Medium (MEM), Phosphate Buffered Saline (PBS), Trypsin-EDTA (0.05%), Penicillin-Streptomycin solution (100x), and Fetal Bovine Serum (FBS) were purchased from Hyclone Laboratories, Inc. The Calcein-AM / PI double staining kit was purchased from Dojindo Molecular Technologies, Inc. Deionized water was obtained from a purification system (Pacific TII 7UV, Thermo Fisher, USA).

[0073] The microscopic morphology of black cerium dioxide (C-CeO2) nanoparticles was characterized by a 200 KV transmission electron microscope (TEM, JEM-2800, JEOL, Japan). The lattice of C-CeO2 nanoparticles was observed by high-resolution transmission electron microscopy (HRTEM, JEM-2800, JEOL, Japan), and the distribution characteristics of target elements were directly observed by energy-dispersive X-ray spectroscopy elemental imaging analysis (EDS-Mapping). Powder X-ray diffraction (MiniFlex600, Rigaku, Japan, 40 kV, 40 mA; Cu-Kα; λ1, )。The test range was 20° to 80°, and the step was 2°·min-1. The data was analyzed using Jade software. The Raman spectra of C-CeO2 nanoparticles were measured using a micro confocal Raman spectrometer (SR-500I-A, Titan Electro-Optics, China). The absorption spectra of C-CeO2 and cerium dioxide (CeO2) nanoparticles were measured using an ultraviolet-visible spectrophotometer (Shimadzu 2600, Shimadzu, Japan). The binding energies of elements in C-CeO2 nanoparticles were measured using X-ray photoelectron spectroscopy (XPS, ESCALAB250Xi, Thermo Fisher, USA). The data was processed using vantage software. The ultraviolet-visible absorption spectra were detected using a multi-functional microplate reader (Varioskan LUX, ThermoFisher, USA). The morphology of the 3D printed scaffold was measured using a field emission scanning electron microscope (FESEM, JSM-7800F, JEOL, Japan) at an acceleration voltage of 15 kV, and the element distribution was directly observed by EDS-Mapping.

[0074] 1. Preparation of black cerium dioxide (C-CeO2):

[0075] Ammonium cerium(IV) nitrate (5 mmol) and sodium acetate (122 mmol) were dissolved in 56 mL of absolute ethanol, and then 10 mL of acetic acid was added. After stirring at room temperature for 1 hour, the mixture was transferred to a 100 mL Teflon-lined autoclave. The autoclave was sealed in a metal shell and heated at 220 °C for 12 h. After the solvothermal reaction, the suspension was centrifuged at 12,000 rpm and washed three times with deionized water. The dispersion was freeze-dried to obtain C-CeO2.

[0076] 2. Photothermal properties of C-CeO2:

[0077] The photothermal properties of C-CeO2 were triggered by an 808 nm near-infrared laser. The temperature and infrared images were captured by a thermal imager (Testo 869, Testo SE&Co.KGaA, Germany). Different concentrations (0.2, 0.4, 0.6, 0.8, 1.0 mg·mL-1) of C-CeO2 aqueous dispersions were irradiated with an 808 nm near-infrared laser at different power densities (0.25, 0.5, 0.75, 1.0, 1.5, 2.0 W·cm -2 ) The temperature was recorded every 10 seconds. Deionized water under the same conditions was used as a blank control.

[0078] 3. Photothermal conversion efficiency of C-CeO2:

[0079] The photothermal conversion efficiency was calculated according to the total energy balance of the photothermal system:

[0080]

[0081] Where: m and C p are the mass and specific heat capacity of water respectively, T is the temperature of the solution, and is the energy inlet, and Q s is the heat related to the light absorption of the solvent, and Q loss is the heat conduction from the system surface to the surrounding air. The C-CeO2 dispersion is loaded into a test tube and irradiated with an 808 nm laser, The calculation results are as follows:

[0082]

[0083] Where: I is the output power of the 808 nm laser, A808 is the aqueous phase dispersion absorbance of C-CeO2 at 808 nm, and Q loss is the photothermal conversion efficiency.

[0084] Q loss = hsΔT (S3)

[0085] Where: h is the heat transfer coefficient, s is the surface area of the container, and ΔT is the temperature change, defined as T - T surr (T is the solution temperature, and T surr is the surrounding ambient temperature).

[0086] Once the laser power is determined, the heat input is determined As the irradiation time prolongs, more heat diffuses from the system surface to the surrounding air until the output heat equals the input heat, and at this time, the maximum steady-state temperature is reached. That is:

[0087]

[0088] Where: ΔT max is the temperature change at the maximum steady-state temperature. From Eq.S2 and Eq.S4, the photothermal conversion efficiency (η) of irradiating C-CeO2 with an 808 nm laser is:

[0089]

[0090] To obtain the η value, hs should be known. Here, the dimensionless driving force temperature θ is introduced, and its relationship with T is:

[0091]

[0092] The related time constant τ s :

[0093]

[0094] Substituting into Eq.S1 gives Eq.S8

[0095]

[0096] When the laser is turned off, Eq.S6 can be expressed as:

[0097]

[0098] Integrating the equation s9 gives:

[0099] t = -τ s lnθ(S10)

[0100] where: τ s is defined as the slope of the linear relationship vs–lnθ of the cooling period time date, and the hs value can be calculated from Eq.S7. Substituting hs into Eq.S5, the η of C-CeO2 can be calculated.

[0101] 4. Reactive oxygen species scavenging ability test:

[0102] The scavenging ability of C-CeO2 on H2O2 was determined by the titanium sulfate colorimetric method. C-CeO2 was prepared as an aqueous dispersion with PBS at pH 6.4 at certain concentrations (0, 100, 200, 300, 400, 500 μg·mL -1 ). H2O2 was added to the above dispersion to a final concentration of 2 mM, and the reaction was carried out at 37 °C. After the reaction, it was filtered through a needle-shaped water filter with a pore size of 0.22 μm to remove insoluble substances. 80 μL of the filtrate was mixed with 20 μL of titanium sulfate (20 mM) and added to an ELISA plate. The absorbance in the range of 340 - 600 nm was detected with a multifunctional microplate reader.

[0103] The dissolved oxygen content in the solution was measured with a dissolved oxygen meter to evaluate the ability of C-CeO2 to decompose H2O2 into H2O and O2. C-CeO2 was prepared as an aqueous dispersion with PBS at pH 6.4 at certain concentrations (0, 100, 200, 300, 400, 500 μg·mL -1 ). H2O2 was added to the above dispersion to a final concentration of 100 mM, and the reaction was carried out at 37 °C. The generation process of oxygen bubbles in the centrifuge tube was photographed and recorded with a digital camera.

[0104] The OH scavenging ability of C-CeO2 was detected by the salicylic acid colorimetric method. A solution containing ·OH was obtained by mixing ferrous sulfate solution (18 mM) with H2O2 (50 mM). Aqueous dispersions were prepared at certain concentrations (0, 100, 200, 300, 400, 500 μg·mL -1) C-CeO2 aqueous dispersion, freshly prepared ·OH solution was added respectively. The reaction was carried out at 37 °C. After the reaction, it was filtered through a needle-shaped water filter with a pore size of 0.22 μm to remove insoluble substances. 80 μL of the filtrate was mixed with 20 μL of salicylic acid solution (10 mM), and the absorbance was measured with a multifunctional microplate reader in the range of 400 - 700 nm.

[0105] The O2 -· radical scavenging ability was detected by the pyrogallol autoxidation method. First, a certain amount of pyrogallol was dissolved in 10 mM hydrochloric acid to prepare a 45 mM pyrogallol solution. Subsequently, 4.5 mL of 0.1 M Tris-HCl buffer (pH = 8.2), an appropriate volume of distilled water, and C-CeO2 dispersion (0, 100, 200, 300, 400, 500 μg·mL-1) were added successively to a test tube. 0.3 mL of pyrogallol solution was quickly added to start the reaction, and then immediately mixed at 25 °C to ensure uniformity. The absorbance at 325 nm was measured at regular intervals with a spectrophotometer, and the change in absorbance was recorded.

[0106] 5. Preparation of MBAA-crosslinked PAM hydrogel (MBAA / PAM):

[0107] To prepare MBAA-crosslinked PAM hydrogel (MBAA / PAM), AM (0.71 g, 10 mmol) and 20 μL of 1173 photoinitiator were dissolved in 5 mL of deionized water, and MBAA ethanol solution was added according to Table 1. Among them, the initial solution concentration of MBAA was 117.5 mg·mL -1 . After thorough mixing, the above mixture was stirred evenly, transferred to a 25 mm × 3 mm mold, and crosslinked in a UV crosslinker for 1800 s to obtain MBAA / PAM hydrogel. Pure PAM hydrogel without MBAA crosslinker was used as a control. According to the addition amount of MBAA, the hydrogels were named 2-MBAA / PAM, 5-MBAA / PAM, and 10-MBAA / PAM respectively.

[0108] Table 1 Quantities of raw materials required for preparing MBAA / PAM hydrogel

[0109]

[0110] 6. Preparation of MBAA / PAM / SA / Gd double-network hydrogel (Gd-DN):

[0111] When preparing the Gd-DN hydrogel, AM (0.71 g, 10 mmol), SA (500 mg), and 20 μL of photoinitiator 1173 were dissolved in 5 mL of deionized water, and a certain amount of MBAA ethanol solution was added to prepare the Gd-DN hydrogel, as shown in Table 2. After mixing evenly, the above mixture was transferred to a 25 mm × 3 mm mold and crosslinked in a UV crosslinker for 1800 s. Then, the hydrogel was soaked in a 1 M GdCl3 solution for 1 h to obtain the Gd-DN hydrogel. According to the addition amount of MBAA, the hydrogels were named Gd-DN-0, Gd-DN-2, Gd-DN-5, and Gd-DN-10, respectively.

[0112] Table 2 Quantities of raw materials required for preparing the Gd-DN hydrogel

[0113]

[0114]

[0115] 7. Swelling ability test of the hydrogel:

[0116] The MBAA / PAM hydrogel and Gd-DN hydrogel were soaked in deionized water. At 0, 1, 3, and 5 days, the surface moisture was gently dried with filter paper, the hydrogels were photographed and weighed, and the swelling behavior of the hydrogels was observed.

[0117] 8. Mechanical properties:

[0118] Gd-DN hydrogels with different MBAA contents were prepared according to Table 3 for mechanical tests, with a total volume of 5 mL. The prepared ink was loaded into a mold with an inner diameter of 55.6 mm and crosslinked with a UV crosslinker for 1800 s. Subsequently, the obtained primary hydrogel was carefully pushed out of the mold, immersed in a 1 M GdCl3 solution for 1 h, and then the hydrogel was immersed in deionized water for 48 h until the dissolution equilibrium was reached. The hydrogel was cut into 5-mm lengths for mechanical property testing. At room temperature, the compressive strength and Young's modulus were tested on an Instron 2344 Microtester. The compression rate was 10 mm min -1 , and the strain was 90%. The compressive strength was directly obtained from the curve, and the compressive modulus was calculated from the initial slope linear stage (10% - 20% strain) of the stress-strain curve.

[0119] Table 3 Quantities of raw materials required for mechanical tests of the Gd-DN hydrogel, where X is the solid content of MBAA (X‰)

[0120]

[0121] 9. Preparation and characterization of 3D-printed Gd-DN hydrogel scaffolds with gradient-varying mechanical properties:

[0122] To prepare a 3D-printed hydrogel scaffold with a gradient change in mechanical strength, two inks with different MBAA contents (2.5‰ and 10‰) were prepared respectively: AM (0.71 g, 10 mmol), SA (500 mg), and MBAA (12.5 mg) were dissolved in 5 mL of deionized water; in another formulation, AM (0.71 g, 10 mmol), SA (500 mg), and MBAA (50 mg) were dissolved in 5 mL of deionized water. 20 μL of photoinitiator 1173 was added respectively and stirred evenly. The prepared inks were centrifuged at 7500 rpm for 5 min to remove air bubbles. A printing nozzle diameter of 0.35 mm was selected. The printing parameters were set as follows: air pressure 0.48 MPa, filament speed 15 mm / s, filling spacing 0.65 mm, layer height 0.35 mm, rotation angle 90°. The first 20 layers were printed with the hydrogel precursor containing 10‰ MBAA. After completion, the tube was manually replaced with a tube filled with the hydrogel precursor containing 2.5‰ MBAA, and another 20 layers were printed. After ultraviolet (UV) light irradiation, the preliminarily crosslinked scaffold was immersed in 1 M Gd 3+ solution for further crosslinking for 1 hour. The taken-out scaffold was repeatedly rinsed with deionized water for subsequent operations.

[0123] 10. Preparation of 3D-printed Gd-CeO2-doped gradient variable mechanical property Gd-DN hydrogel scaffold:

[0124] To prepare a 3D-printed Gd-CeDN hydrogel scaffold with a gradient change in mechanical strength, two inks with different MBAA contents (2.5‰ and 10‰) were prepared respectively: AM (0.71 g, 10 mmol), SA (500 mg), MBAA (12.5 mg), and C-CeO ` (2.5 mg) were dissolved in 5 mL of deionized water; in another configuration, AM (0.71 g, 10 mmol), SA (500 mg), MBAA (50 mg), and C-CeO2 (2 mg) were dissolved in 5 mL of deionized water. The subsequent operations were carried out according to the above method.

[0125] 11. Photothermal properties of the hydrogel:

[0126] The photothermal properties of the Gd-CeDN hydrogel were characterized by 808 nm near-infrared spectroscopy. The temperature and infrared images were captured by a thermal imager (Testo 869, Testo SE & Co. KGaA, Germany). The power densities of the near-infrared laser were 0.25, 0.5, 0.75, 1.0, and 1.5 W·cm-2 respectively. The temperature was recorded every 10 seconds.

[0127] 12. Preparation of simulated body fluid:

[0128] Prepare the reagents separately according to Table 4 and add them one by one to 1 L of deionized water at room temperature. Before adding the next powder, let the previous powder dissolve completely. After all the reagents are completely dissolved, adjust the pH of the solution to 7.4 with Tris and 1 M hydrochloric acid. The prepared simulated body fluid is temporarily stored at 4 °C for later use.

[0129] Table 4 Reagents and dosages required to prepare 1 L of simulated body fluid

[0130]

[0131] 13. Bionic mineralization ability:

[0132] Immerse the 3D-printed Gd-CeDN hydrogel scaffold in the simulated body fluid at 37 °C. After 7 days of immersion, carefully take out the scaffold, slowly rinse it with deionized water, and freeze-dry it at -80 °C. Take pictures of the dried scaffold with a digital camera and observe the microstructure and element distribution of the scaffold by FESEM.

[0133] 14. In vitro degradability:

[0134] The amounts of materials required to prepare the hydrogel are shown in Table 5.

[0135] Table 5 Amounts of raw materials required to prepare the hydrogel (dissolved in 5 ml of H2O) for degradation test and Gd 3+ release test

[0136]

[0137] After swelling equilibrium, immerse the hydrogel (5.6 mm × 5 mm) in 10 mL of PBS containing type II collagenase (20 μg·mL -1 ) at 37 °C. The solution is renewed every 2 days. At the beginning, the weight of the dried hydrogel is defined as m0. Record the weight of the dried hydrogel at different time points as mt. Its weight loss rate is calculated by the following formula:

[0138]

[0139] 15. Gd 3+ release test:

[0140] The amounts of materials required to prepare the hydrogel are shown in Table 5. After crosslinking, the hydrogel is immersed in 20 mL of simulated body fluid at 37 °C. Remove the leachate (1 ml) from the degradation solution at each time point. Then dilute the leachate with 20% nitric acid and digest it at 150 °C. Determine the Gd 3+ concentration by inductively coupled plasma mass spectrometry (ICP-MS, Elan drc-e, PerkinElmer, US).

[0141] II. Cell experiments

[0142] The cell experiments used primary rat osteoblasts (ROBs), human osteosarcoma cells (MG-63), bone marrow mesenchymal stem cells (BMSCs), and mouse mononuclear macrophage leukemia cells (RAW 264.7). ROBs were isolated from the cranial bone chips of Sprague-Dawley rats (SD rats, within 3 days after birth). Bone marrow mesenchymal stem cells (3 - 4 weeks old) were isolated from the tibia and femur marrow of C57BL / 6J mice. MG-63 cells were purchased from Procell Life Science & Technology Co., Ltd. RAW 264.7 was derived from the State Key Laboratory of Medicinal Chemical Biology, Nankai University. ROBs, BMSCs, and MG-63 cells were cultured in MEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin solution (100×), which was called complete medium. RAW 264.7 was cultured in DMEM medium containing 10% fetal bovine serum. All these cells were cultured in a humid environment with 5% CO2 at 37°C.

[0143] 1. Cell viability:

[0144] When the ROBs entered the logarithmic growth phase and the confluence reached 80 - 90% in the culture dish, the medium was removed, and the cells were washed 3 times with 2 mL PBS. Subsequently, 1 mL of trypsin containing EDTA was added to the culture dish and incubated for 1 min. After incubation and centrifugation, complete culture medium was added, and the cells were gently blown to disperse them evenly. Then the cells were seeded into a 96-well plate, with 5000 cells per well. Different concentrations of C-CeO2 were added to the 96-well plate and co-cultured with the ROBs. After 48 h of culture, the cell viability was detected by the CCK-8 method. Briefly, after co-culturing the cells with the CCK-8 reagent for 4 h, the absorbance at 450 nm was used to represent the cell viability. The MTT method was used to detect the cell viability of the ROBs adhered to the hydrogel.

[0145] Similarly, we also tested the photothermal antitumor effect of 808 nm NIR irradiation of C-CeO2 on MG-63 cells. MG-63 cells were co-cultured with different concentrations of C-CeO2, irradiated with 808 nm NIR (1 W·cm -2 , 300 s), and then placed in an incubator for 12 h. The cell viability was detected by the CCK-8 method.

[0146] In addition, the cell viability of RAW 264.7 after co-incubation with different concentrations of C-CeO2 was also detected. RAW 264.7 was seeded into a 96-well plate, with 2000 cells per well, and incubated for 12 h to allow the cells to adhere completely. Different concentrations of C-CeO2 were added to the culture dish and co-cultured for 48 h. The MTT method was used to detect the cell viability.

[0147] 2、Live / Dead staining:

[0148] The Calcein-AM / PI double staining kit was used to further detect the viability of ROBs adhered to the Gd-CeDN hydrogel. The cell seeding and culture procedures were the same as those in the cell viability section. After co-incubation for 48 h, the cells were gently washed 3 times with PBS, and then a PBS staining solution containing 2 μM Calcein-AM and 4.5 μM PI was added. After incubation in the dark for 15 minutes, the stained cells were observed under a fluorescence inverted microscope (DMi8, Leica, Germany). The excitation filter was set at filter cube FITC (Ex: 480 / 40) to observe live cells (green) detected by Calcein-AM, and the excitation filter was set at RHOD LP (Ex: 540 / 45) to observe dead cells (red) detected by PI. Similarly, the photothermal antitumor effect of 808 nm NIR-irradiated C-CeO2 on MG-63 cells was detected by the live / dead method.

[0149] 3、F-actin and nucleus staining:

[0150] The rhodamine Phalloidin and DAPI double staining method was used to detect the spreading state of ROBs seeded on the surface of the Gd-CeDN hydrogel. The cell seeding and culture steps were the same as those in the cell viability section. After co-incubation for 48 h, the cells were fixed with 4% paraformaldehyde solution for 15 min, washed with PBS, then treated with 0.1% Triton for 5 min, and then 100 μL of rhodamine Phalloidin solution (100 nM) was added and incubated in the dark at room temperature for 30 min. The staining solution was removed and the cells were washed with PBS. Then 100 μL of DAPI staining solution (100 nM) was added and incubated for 30 s. Finally, the cells were washed with PBS and observed under a fluorescence inverted microscope (DMi8, Leica, Germany). The excitation filter was set at filter cube RHOD LP (Ex: 540 / 45) to observe F-actin stained with rhodamine Phalloidin. The excitation filter was set at filter cube DAPI LP (Ex: 340 / 40) to observe the DAPI-labeled nucleus.

[0151] 4、In vitro ROS scavenging assay:

[0152] ROS in RAW 264.7 was detected by the DCFH-DA method. A RAW 264.7 suspension was obtained and seeded into 48-well plates at 5000 cells per well. After the cells adhered, C-CeO2 (final concentrations: 0, 100, 200, 300, 400, 500 μg·mL -1) Incubate for 4 h, change the medium, and add LPS (10 ng·mL -1 ) Incubate for 2 h, add DCFH-DA (10 μM) and incubate for 30 min. Gently remove the medium and wash the cells gently with PBS. Observe intracellular ROS with a fluorescence inverted microscope, and set the excitation filter to filtercube FITC (Ex:480 / 40).

[0153] Verify the generation of O2 by quenching the red fluorescence generated by Ru(dpp)3Cl2. Similar to the previous example, add DMEM medium without penicillin-streptomycin and FBS to LPS-treated cells. Add Ru(dpp)3Cl2 (10 μg·mL -1 ) to the culture medium, incubate in the dark for 30 min, gently remove the culture medium, and wash the cells gently with PBS. Set the excitation filter to Filtercube RHOD LP (Ex:540 / 45) for observing the quenching of red fluorescence.

[0154] 5. Macrophage polarization:

[0155] Seed RAW 264.7 cells in a 6-well plate at 5×10 4 cells and incubate for 12 h to allow the cells to attach completely. Add C-CeO2 dispersion (final concentration 500 μg·mL -1 ) and culture for 16 h. Change the medium, add LPS (final concentration: 10 ng·mL -1 ) to each well, and incubate for another 8 h. Add 1 mL of PBS to each well and gently pipette the cells out. Collect the cells in a centrifuge tube, centrifuge at 1200 rpm for 2 min, mix the cells with PE anti-mouse F4 / 80, incubate at 4 °C for 30 min, wash the cells, and stain with FITC anti-mouse CD86. After staining, add 500 μL of 4% paraformaldehyde and incubate in the dark at room temperature for 30 min. After incubation, centrifuge, add 500 μL of 0.1% Triton, and incubate in the dark at room temperature for 5 min. Then centrifuge the cells and treat them with APC-labeled CD206 antibody in the dark for 30 min. After washing the cells, resuspend them for flow cytometry analysis. Analyze the experimental data using Flowjo software.

[0156] 6. Effect of heat on osteogenic differentiation:

[0157] The effect of temperature on the differentiation of ROBs was verified. The ROBs were seeded in 48-well plates. After culturing for 12 h, the cells were heat-treated at different temperatures for 10 min, the old medium was removed, and 300 μL of fresh osteogenic induction medium was added. Here, the osteogenic induction medium was defined as complete MEM medium containing dexamethasone (100 nM), β-glycerophosphate (10 mM), and ascorbic acid (283.6 μM). Heat treatment was performed every 3 days, and the osteogenic medium was replaced. The cells without heat treatment were used as the control group. The osteogenic differentiation of ROBs was observed on days 7, 14, and 21. Specifically, the medium was removed, and the cells were washed three times with PBS. Then the cells were fixed with 4% paraformaldehyde for 15 min, 200 μL of alizarin red S staining solution (1 wt%, pH = 4.2) was added to each well, and the cells were cultured at 37 °C for 3 h. Images of biomineralized nodules could be captured under a fluorescence inverted microscope. Qualitative analysis was performed by ALP staining, and quantitative analysis was performed using a BCIP / NBT alkaline phosphatase chromogenic kit.

[0158] 7. Osteogenic differentiation under different treatments:

[0159] Based on the above results of the thermal effect on the osteogenic differentiation of ROBs. Under C-CeO2 (500 μg·mL -1 ), Gd 3+ (4 μg·L -1 ) and mild temperature stimulation (37 °C and 42 °C), the osteogenic differentiation ability of ROBs was detected. The procedure was the same as that in the section "Effect of heat on osteogenic differentiation".

[0160] 8. Effect of heat on chondrogenic differentiation:

[0161] Bone marrow mesenchymal stem cells were seeded in 48-well plates at a density of 1×10 5 cells per well and incubated for 12 h. After heat treatment at different temperatures for 10 min, 300 μL of fresh chondrogenic induction medium was replaced. Here, the chondrogenic induction medium was defined as complete medium supplemented with TGF-β3 (10 ng·mL -1 ), ITS + Premix (1%), dexamethasone (100 nM), ascorbic acid (50 μg·mL -1 ), sodium pyruvate (1 mM), and proline (4 mM). Heat treatment was performed every 3 days, and the chondrogenic induction medium was replaced. The cells without heat treatment were used as the control. On day 7, the medium was removed, and the cells were washed 3 times with PBS. Then the cells were fixed with 4% paraformaldehyde for 15 min, 200 μL of alcian blue 8GX staining solution (1 wt%, pH = 2.0) was added, and the cells were incubated at 37 °C for 30 min. Then, the cells were washed three times with PBS. In the figure, the chondroitin sulfate produced by bone marrow mesenchymal stem cells after chondrogenic differentiation was stained blue. The images were captured by a fluorescence inverted microscope.

[0162] 9. Chondrogenic differentiation under different stimuli:

[0163] Based on the results of the thermal effect on the chondrogenic differentiation of bone marrow mesenchymal stem cells, the chondrogenic differentiation ability of bone marrow mesenchymal stem cells under the stimulation of C-CeO2 (500 μg·mL-1), Gd 3+ (4 μg·L -1 ) and mild temperatures (37 °C and 42 °C) was measured. The procedure was the same as that in the section "Effect of heat on chondrogenic differentiation".

[0164] 10. Detection of target gene expression:

[0165] The mRNA expression level was detected by RT-qPCR. RAW 264.7 cells were seeded in a 6-well plate at a density of 5×10 4 cells per well, with 3 mL of medium per well. After incubation for 12 h, the C-CeO2 dispersion (final concentration 500 μg·mL -1 ) was added. After culturing for 4 h, LPS was added and incubated for 4 h (final concentration: 20 ng·mL -1 ). Total RNA was extracted using a cell RNA rapid extraction kit according to the supplier's instructions. The concentration and purity of RNA (Abs 260 / 280) were measured using a NanoDrop 2000 ultra-micro ultraviolet spectrophotometer (Thermo Fisher, USA). Total RNA was reverse transcribed into DNA using an Evo M-MLV reverse transcription premix kit in a T100 TM thermal cycler (T100, Bio-rad, USA) for RT-qPCR detection. Samples were prepared in a 96-well PCR plate using a Green Pro Tag HS premix kit and amplified in a real-time fluorescence quantitative PCR system (7500 real-time PCR, Thermo Fisher, USA). The primers used in this procedure are shown in Table 6, with GAPDH (forward primer: AGTTCAACGGCACAGTCAAGGC (SEQ ID NO.1), reverse primer: CGACATACTCAGCACCAGCATCAC (SEQ ID NO.2)) as the reference gene. The expression of osteogenic and chondrogenic related genes was detected by a similar method. The primers used in this process are shown in Tables 7 and 8.

[0166] Table 6 shows the primers for real-time quantitative PCR analysis of inflammatory genes in the present invention.

[0167] Table 6 is the primer for real-time quantitative PCR analysis of inflammatory genes in the present invention.

[0168]

[0169] Table 7 shows the primers for real-time quantitative PCR analysis of osteogenic genes in the present invention.

[0170]

[0171] Table 8 shows the primers for real-time quantitative PCR analysis of chondrogenic genes in the present invention

[0172]

[0173] 11. Anti-tumor in vivo and histological analysis:

[0174] The Balb / c mice (female, 6 weeks old) used were purchased from Beijing Weitehe Laboratory Animal Technology Co., Ltd. (SCXK(Beijing)2021-0006). The Balb / c mice were divided into 4 groups, namely the control group (Ctrl.), Gd-DN group, Gd-CeDN group, and Gd-CeDN+NIR group. MG-63 cell suspension (5×10 6 cells per site) was subcutaneously injected into the hind legs of the mice to establish an infectious osteosarcoma model in mice. When the solid tumor grew to approximately 100 mm 3 , Gd-DN hydrogel and Gd-CeDN hydrogel (1.5×1.5×5 mm 3 ) were subcutaneously implanted around the tumor respectively. On the 1st, 3rd, and 5th days, the hydrogels were irradiated with 808 nm NIR (1 W·cm -2 , 10 min). A thermal imager was used to capture the temperature changes during the photothermal process. The tumor volume (V) and weight (W) were collected every 2 days. On the 14th day, all the mice were euthanized, the solid tumors were removed, and immersed in 4% paraformaldehyde. According to the instructions of the supplier, the tumors were sectioned and stained with H&E, TUNEL, and Ki67. The volume calculation formula is:

[0175] V = Tumor length (mm)×Tumorwidth 2 (mm 2 ) / 2 - 37.5 mm 3 (S12)

[0176] Here, 37.5 mm 3 is the volume of the implanted hydrogel.

[0177] III. Repair of osteochondral defects in vivo and histological analysis

[0178] New Zealand white rabbits (male, 2.5 - 2.75 kg, 4 - 5 months old) were purchased from Beijing Longyan Laboratory Animal Breeding Center (License number: SCXK(Beijing)2019-0006). All the rabbits were divided into 4 groups, namely the control group (Ctrl), Gd-DN group, Gd-CeDN group, and Gd-CeDN+NIR group. After weighing, 0.2 mL·kg-1 Intramuscular anesthesia with dextran. A 2-cm longitudinal incision was made on the medial side of the knee joint. Subsequently, the surface tissue was dissected, the patella was flipped outward to expose the knee joint. A cartilage defect with a depth of 4 mm was formed on the joint surface using a circular hollow drill with a diameter of 5 mm. The pre-prepared hydrogel of 5 mm×4 mm was inserted into the defect site. The tissue was sutured layer by layer, and the skin was dressed with a sterile dressing. In the first 3 days after surgery, penicillin sodium (4.0×10 5 units) was intramuscularly injected into the gluteus maximus muscle every day. In the Gd-CeDN+NIR group, the hydrogel implantation site was irradiated with 808 nm NIR (2 W·cm -2 , 10 min) every 7 days after surgery. The distal femur specimens were surgically removed and immersed in 4% paraformaldehyde. According to the supplier's instructions, the decalcified tissues were sectioned and stained with H&E, Safranin O-Fast green, type I, type II, and type X collagen.

[0179] IV. Statistical Analysis

[0180] All quantitative data were expressed as mean and standard deviation (n≥3). Student's t-test was used for comparison between the two groups. *p<0.05 was considered statistically significant, **p<0.01 was considered highly statistically significant, and **p<0.001 was considered extremely significant.

[0181] Results and Discussion: In this study, C-CeO2 was synthesized by a one-step solvothermal method (see Scheme 1 and Figure 1 A). Transmission electron microscopy (TEM) images showed that C-CeO2 was composed of parts with different mass thickness contrasts. The high-contrast part was formed by the aggregation of a large number of unspecified particles with a size of 510 nm, and the low-contrast part was irregular in shape with a size exceeding 100 nm (see Figure 1 B). Figure 1 C shows the high-resolution transmission electron microscopy (HRTEM) image of the high-contrast part. The lattice spacings of 0.314 nm, 0.195 nm, and 0.270 nm could be observed, corresponding to the (111), (220), and (200) crystal planes of CeO2, respectively. Figure 1 D shows the elemental distribution of the prepared C-CeO2. The low-contrast part was mainly composed of oxygen (O) and cerium (Ce) elements, while the high-contrast part was composed of carbon (C) and oxygen (O) elements with irregular morphology and a small amount of cerium element. Figure 1Diffraction signals of C-CeO2 are shown in E, which appear at 28.5°, 33.1°, 47.5°, 56.3°, 59.1°, 69.4°, 76.7° and 79.1° respectively. These signals correspond to the (111), (200), (220), (311), (222), (400), (331) and (420) crystal planes of the CeO2 standard card (JCPDS: 34-3094). No other diffraction signals appear, proving that there is only one cubic-phase CeO2 crystal in C-CeO2, and the crystal has high-quality integrity and orderliness. From the Raman spectrum ( Figure 1 F), it can be seen that the peak at 455 cm -1 is the vibration signal of the Ce-O bond, which is in line with the characteristics of CeO2. In addition, the broad peak between 1150 and 1700 cm -1 is attributed to the stretching vibration signal of the C-C single bond of amorphous carbon. Different from CeO2 which only has strong absorption in the ultraviolet (UV) region, the C-CeO2 powder maintains strong absorption in the UV, visible (Vis) and near-infrared (NIR) regions (see Figure 1 G), and this characteristic enables it to better utilize a wider spectral range. Figure 1 H, 1I and Figure 9 show the X-ray photoelectron spectroscopy (XPS) spectra of the prepared C-CeO2. Through the peak fitting of the Ce 3D spectrum (see Figure 1 H), the results show that Ce 3+ accounts for 33.4% of all cerium elements, while Ce 4+ accounts for 66.6%. Figure 1 In the O1s spectrum shown in I, the oxygen vacancy (OV) accounts for 21.49% of the oxygen element in the C-CeO2 powder.

[0182] In view of the black color of the C-CeO2 powder and its wide absorption characteristics from ultraviolet to near-infrared regions, its photothermal properties were first evaluated. Similar to the powder, the aqueous dispersion of C-CeO2 has wide light absorption in the range of 300-900 nm, and the absorption gradually increases with the increase of concentration (see Figure 2 A). In this experiment, 808 nm near-infrared light (NIR) was selected because of its good tissue penetration, high radiation energy and almost no thermal damage to tissues. Figure 2 B and 2C show the temperature rise of the C-CeO2 aqueous dispersion under near-infrared radiation. When the concentration of the dispersion is fixed, the temperature increases with the increase of the power density; when the power density is constant, the temperature increases with the prolongation of the irradiation time. When the concentration of the dispersion reaches 0.8 mg·mL -1When the concentration further increases, the temperature change tends to be limited. This indicates that the temperature of the C-CeO2 aqueous dispersion is related to the power density, irradiation time, and the concentration of C-CeO2. However, when the concentration reaches a certain value, the increase in temperature is no longer significant. Figure 2 D shows the complete heating-cooling cycle of the C-CeO2 aqueous dispersion after irradiation. Based on the total energy balance during the cooling process (see Figure 2 E), the photothermal conversion efficiency of C-CeO2 can be calculated to be 52.15%. The specific calculation process is shown in the supplementary information (Equation S1).

[0183] Based on the excellent photothermal properties of C-CeO2, its photothermal anti-tumor ability was further verified. Prior to this, the cytocompatibility of C-CeO2 was tested using primary rat osteoblasts (ROBs) as a representative. Even when the concentration of C-CeO2 was as high as 300 μg·mL -1 , the cell viability of ROBs remained almost at 100%, indicating the excellent cytocompatibility of C-CeO2 (see Figure 10 ). Subsequently, human osteosarcoma cells MG-63 were co-incubated with different concentrations of C-CeO2 and irradiated with 808 nm near-infrared light (NIR) at a power density of 1.0 W·cm -2 for 300 seconds. As Figure 2 F shows, when the concentration of C-CeO2 was below 40 μg·mL -1 , the cell viability was not significantly affected. As the concentration increased, the number of surviving MG-63 cells gradually decreased. When the concentration of C-CeO2 reached 120 μg·mL -1 , the viability of MG-63 cells was only 50%, indicating the excellent photothermal anti-tumor ability of C-CeO2. The live / dead cell staining images of the corresponding experiments are shown in Figure 11 .

[0184] Based on the antioxidant properties of CeO2, the ROS scavenging ability of pristine C-CeO2 was evaluated. The ability of the prepared C-CeO2 to scavenge O2 ·- was tested using the pyrophosphate method. Under alkaline conditions, pyrophosphate undergoes an oxidation reaction to generate O2 ·- and quinone substances, which are initially green and have an absorption peak at 325 nm. The presence of C-CeO2 can inhibit the generation of O2 ·- , thereby further inhibiting the formation of the intermediate product quinone. As Figure 3 A shows, as the concentration of C-CeO2 increases, the O2 ·- in the reaction systemGradually decrease. Subsequently, the scavenging abilities of C-CeO2 towards ·OH and H2O2 were investigated by salicylic acid and titanium sulfate colorimetric methods respectively. ·OH generated by the Fenton reaction can react with salicylic acid to form 2,3-dihydroxybenzoic acid which has absorption at 510 nm. The ·OH scavenging ability of C-CeO2 can effectively scavenge the formed ·OH, thereby inhibiting the formation of 2,3-dihydroxybenzoic acid. Figure 3 B and 3C show that C-CeO2 can effectively scavenge ·OH. Figure 3 B shows that with the increase of C-CeO2 concentration, its scavenging ability is enhanced. Initially, C-CeO2 exhibits a high ·OH scavenging rate. As time goes by, the reaction rate slows down, mainly due to the significant decrease in the content of ·OH (see Figure 3 C). Similar to the ·OH scavenging ability, the decomposition ability of C-CeO2 towards H2O2 also shows a concentration-dependent characteristic. With the increase of C-CeO2 concentration, the formation of peroxide-titanium complex generated by the reaction of H2O2 with titanium sulfate decreases (see Figure 3 D). Decomposing H2O2 into H2O and O2 is a way for C-CeO2 to scavenge H2O2. By detecting the dissolved oxygen content, the antioxidant scavenging effect of C-CeO2 towards H2O2 can be further confirmed. At the same H2O2 concentration, with the increase of C-CeO2 concentration and reaction time, the formation amount of O2 increases. As the reaction progresses, due to the decrease in the content of H2O2 in the reaction system, the generation rate of O2 gradually decreases. To sum up, C-CeO2 shows excellent antioxidant performance by scavenging O2 ·- and ·OH, and catalyzing the decomposition of H2O2, providing strong support for its application in scavenging ROS intracellularly.

[0185] Before evaluating the intracellular properties, the cell viability of RAW 264.7 cells after co-incubation with C-CeO2 was first detected. Within the tested concentration range, the survival rate of RAW 264.7 cells is close to 100%, indicating that C-CeO2 has good cell compatibility (see Figure 12 ). The intracellular ROS was labeled with the fluorescent indicator DCFH-DA. After lipopolysaccharide (LPS) stimulation, the intracellular ROS increased significantly, and strong green fluorescence was observed (see Figure 3 F and Figure 13 ). However, with the increase of C-CeO2 concentration, the green fluorescence gradually weakened until it disappeared, indicating that C-CeO2 can effectively scavenge the intracellular ROS. Further, the change of intracellular oxygen was detected using the fluorescent indicator [Ru(dpp)3]Cl2. The results show that without co-incubation with C-CeO2, LPS-stimulated RAW 264.7 cells exhibit obvious red fluorescence, indicating a low intracellular oxygen level (see Figure 3F and Figure 14 ). As the concentration of C-CeO2 increased, the red fluorescence gradually weakened, demonstrating that C-CeO2 could react with ROS to generate oxygen. In summary, C-CeO2 could not only remove intracellular ROS, but also catalyze the generation of oxygen from ROS, thus maintaining the oxygen balance within cells. Next, flow cytometry was used to detect the regulatory effect of C-CeO2 on the polarization of the inflammatory phenotype of LPS-induced macrophages. As Figure 3 shown in Fig. G, RAW 264.7 cells treated only with C-CeO2 did not show obvious polarization of the M1 or M2 phenotype and remained in the M0 state. However, after LPS stimulation, a large number of RAW 264.7 cells polarized into the M1 pro-inflammatory phenotype. In contrast, in the co-action of C-CeO2 and LPS, the number of M1 phenotype cells decreased and the number of M2 anti-inflammatory phenotype cells increased, indicating that C-CeO2 could effectively promote the transformation of RAW264.7 cells from a pro-inflammatory state to an anti-inflammatory state. Further, the expression of inflammation-related genes was detected by RT-qPCR. First, the expression of IL-10 (an anti-inflammatory gene) was tested, as Figure 3 shown in Fig. H. After LPS stimulation, the expression of the IL-10 gene was almost the same as that of the control group. However, after C-CeO2 stimulation or simultaneous stimulation with C-CeO2 and LPS, the expression of IL-10 increased significantly, preliminarily verifying the anti-inflammatory ability of C-CeO2 at the cellular level. Next, the expression of pro-inflammatory genes was analyzed, as Figure 3 shown in Figs. I to 3L. Compared with the control group, the expression of all pro-inflammatory genes was up-regulated under LPS stimulation. However, C-CeO2 stimulation had no significant effect on the expression of these genes. After adding C-CeO2 to the LPS-stimulated environment, the expression of all up-regulated pro-inflammatory genes decreased, especially the genes of IL-1β, NOS2, and TNF-α. These results indicated that C-CeO2 could effectively regulate the expression of inflammation-related genes, that is, inhibit the expression of pro-inflammatory genes while promoting the expression of anti-inflammatory genes, thereby exerting an anti-inflammatory effect.

[0186] In terms of repairing osteochondral defects, traditional hydrogels have become potential candidate materials due to their good biocompatibility and degradability. However, their mechanical properties are poor and it is difficult to meet the load-bearing requirements of joint parts. Therefore, a double-network crosslinked hydrogel was used, and the mechanical properties of the system were significantly enhanced by constructing an intertwined network structure. This strategy not only improved the stability of the hydrogel in a load-bearing environment, but also effectively promoted cell adhesion and proliferation, providing a better option for osteochondral defect repair. Compared with the PAM (MBAA / PAM) hydrogel crosslinked with (N,N'-methylenebisacrylamide, MBAA), PAM itself could not form a hydrogel (see Figure 15), and the addition of a small molecule crosslinker (MBAA) can enhance the gel performance of pure PAM hydrogels. At the same time, based on the weak mechanical properties of the MBAA / PAM hydrogel, Gd with good biocompatibility and the ability to promote bone regeneration was introduced 3+ crosslinked SA to obtain a double-network hydrogel (Gd-DN) with excellent mechanical properties. Figure 16 The appearances of the MBAA / PAM hydrogel and Gd-DN hydrogel at different MBAA amounts are shown, and it is preliminarily confirmed that with the increase in the amount of MBAA, the mechanical properties of both the MBAA / PAM and Gd-DN hydrogels are improved. Then, the swelling characteristics of the MBAA / PAM hydrogel and Gd-DN hydrogel at different MBAA amounts were tested. For the MBAA / PAM hydrogel, the addition amount of MBAA significantly affected the swelling ratio, while for the Gd-DN hydrogel, regardless of whether MBAA was added or not, the morphology of the hydrogel was maintained very well, even after soaking in water for 5 days (see Figure 4 A and 17), further confirming the influence of the double-network structure. However, for the MBAA / PAM hydrogel, the quantitative analysis of the swelling performance was different from the photos, especially when the MBAA dosage was 0‰ and 2‰. The reason is that when the MBAA dosage is less than 2‰, the MBAA / PAM hydrogel collapses or degrades rapidly in water, resulting in weighing errors. These results indicate that the addition of MBAA can ensure the stability of the system in vivo. At the same time, in order to find the optimal MBAA dosage, the compression properties of the Gd-DN hydrogel at different MBAA contents were tested. Figure 4 Figure B shows that the Gd-DN hydrogel without using MBAA as a crosslinker has slightly weaker compression properties and breaks when the compression rate is only 55%. With the increase in the amount of MBAA added, the compression properties of the Gd-DN hydrogel are enhanced. When the mass ratio of MBAA is 10‰, the Gd-DN hydrogel exhibits the best compression ability, and its Young's modulus is 1.06 MPa (see Figure 4 Figure C). The reason is that after adding MBAA, the crosslinking degree of the hydrogel increases, and the mechanical properties of the Gd-DN hydrogel are enhanced; while when the content of MBAA further increases, the Gd-DN hydrogel becomes fragile, affecting its compression properties. In order to further confirm the dosage of MBAA in the Gd-DN system, the survival rate of ROBs cultured on the Gd-DN hydrogel was detected. When MBAA was not used as a crosslinker in the system, the survival rate of ROBs was only 66%, which was mainly due to the lower mechanical properties not being suitable for the survival of ROBs. After introducing MBAA into the system, the survival rate of ROBs increased, and the content of MBAA had little effect on the survival rate of ROBs. When the content of MBAA was between 2.5‰ and 15‰, the survival rate of ROBs always remained at 100% (see Figure 18)。Considering mechanical properties and cell compatibility comprehensively, the Gd-DN hydrogel with 10‰ MBAA as the crosslinking agent was selected as the lower layer of the gradient scaffold to match the properties of subchondral bone (named Gd-DN-10), while the Gd-DN hydrogel with 2.5‰ MBAA as the crosslinking agent was selected as the upper layer to match the properties of cartilage (named Gd-DN-2.5). The obtained Gd-DN hydrogel with gradient mechanical strength can effectively meet the actual needs of natural tissues and promote the repair of osteochondral defects.

[0187] Based on the basic characterization results of C-CeO2 and Gd-DN hydrogel, a Gd-DN hydrogel scaffold doped with C-CeO2 (Gd-CeDN) with gradient mechanical strength was prepared by 3D printing technology. Visual observation showed that the obtained 3D printed Gd-CeDN hydrogel scaffold could not only support the weight of an adult female of about 55 kg, but also withstand the weight of an adult male of about 85 kg without collapse ( Figure 19 ), demonstrating that Gd-CeDN has good compressive properties. At the same time, the photothermal properties of the Gd-CeDN hydrogel under 808 nm near-infrared (NIR) irradiation were tested. C-CeO2 endows the Gd-CeDN hydrogel scaffold with excellent photothermal properties, which are related to the irradiation time and power density ( Figure 4 D and 4E). Due to the coexistence of C-CeO2 and Gd 3+ in the Gd-CeDN hydrogel, the biomimetic mineralization ability of the hydrogel was preliminarily tested by immersing the hydrogel in simulated body fluid (SBF). After one week of immersion, significant changes occurred in the surface morphology and chemical composition of the 3D printed Gd-CeDN hydrogel scaffold ( Figure 20 and 4 F), and important elements of bone such as phosphorus (P) and calcium (Ca) were deposited on the scaffold surface. This result indicates that the Gd-CeDN scaffold can effectively utilize the minerals in SBF to achieve biomimetic mineralization, which is crucial for cartilage and bone regeneration.

[0188] For degradable materials, they will ultimately be replaced by the patient's own tissues. The degradability of Gd-CeDN-2.5 and Gd-CeDN-10 and the Gd 3+ release ability were tested, which are beneficial for osteochondral regeneration. Figure 4G showed that the introduction of C-CeO2 disrupted the regularity of the double network, and the degradation rate of Gd-CeDN hydrogels was slightly faster than that of Gd-DN hydrogels, whether it was Gd-CeDN-2.5 or Gd-CeDN-10. Since the crosslinking degree of Gd-CeDN-10 was higher than that of Gd-CeDN-2.5, the degradation rate of Gd-CeDN-2.5 hydrogel was faster than that of Gd-CeDN-10 hydrogel. Since the photothermal ability of Gd-CeDN hydrogels will be applied in vitro and in vivo, the effect of temperature on the degradation rate of Gd-CeDN hydrogels was further tested. The results showed that higher temperature would accelerate the degradation of Gd-CeDN hydrogels, and the degradation rates of Gd-CeDN-2.5 and Gd-CeDN-10 under 808 nm NIR irradiation were faster than those without irradiation. Therefore, Gd-CeDN-2.5 + NIR showed the fastest degradation rate under all conditions. As the Gd-CeDN (hydrogel) degraded, Gd 3+ gradually released from the hydrogel system. Similar to the degradation rates of different hydrogels, the release rate of Gd from Gd-DN-2.5 hydrogel was the fastest after 808 nm NIR irradiation 3+ ( Figure 4 H). Of course, there was no significant difference in the release rates of Gd in different hydrogels, which was beneficial to the regeneration of new bone and cartilage. According to its excellent biocompatibility, attractive mechanical properties, and appropriate degradation rate, the attachment and growth abilities of ROB cells on Gd-CeDN hydrogel scaffolds with gradient mechanical strength were first tested. By live / dead cell staining and F-actin staining( 3+ I and 4J), the results showed that ROB cells not only could attach to the Gd-CeDN hydrogel scaffolds, but also could spread well and there were almost no dead cells, indicating that the Gd-CeDN hydrogel scaffolds were initially suitable for bone regeneration. Since mild thermal stimulation has been proven to promote cell proliferation, whether the photothermal properties of Gd-CeDN hydrogel scaffolds could stimulate chondrogenic and osteogenic differentiation was also explored. According to previous studies, the differentiation abilities of ROB cells and BMSCs at 40 °C and 42 °C were tested (temperatures higher than 42 °C would cause cell death), and compared with the differentiation ability at 37 °C. The results showed that compared with the control group (37 °C), both 40 °C and 42 °C could effectively promote the secretion of alkaline phosphatase (ALP) and calcium nodule deposition of ROB cells, and higher temperatures could promote ALP secretion and calcium nodule deposition, and the change in ALP secretion was the most obvious( Figure 4 I and 4J). In addition, the effect of temperature on the differentiation of BMSCs into chondrocytes was also verified Figure 21 . Figure 22It was shown that BMSCs cultured at 40 °C and 42 °C exhibited larger and darker blue Alcian Blue staining areas, and the stimulation effect was best at 42 °C. This indicates that mild heat stimulation can promote the secretion of important glycosaminoglycans by BMSCs, which contributes to the regeneration of cartilage tissue. Based on all these results, 42 °C was selected as the actual temperature for subsequent experiments.

[0189] Based on the above results, the effects of C-CeO2 and Gd 3+ combined with heat on the cell differentiation ability were first evaluated. ALP staining and alizarin red staining showed that ROB cells co-cultured with C-CeO2 and Gd 3+ exhibited the highest ALP secretion and calcium nodule deposition, which was consistent with our previous report, indicating that C-CeO2 and Gd 3+ could effectively promote the differentiation of ROB cells. Over time, the differentiation ability of ROB cells gradually increased. When the culture temperature was increased from 37 °C to 42 °C, the effect was particularly significant ( Figure 5 A, 5B, Figure 23 and Figure 24 ). This indicates that the synergistic effect of C-CeO2, Gd 3+ and mild heat stimulation promoted osteogenic differentiation. Since the 3D-printed Gd-CeDN hydrogel scaffold had a gradient mechanical strength, the potential of C-CeO2 and Gd 3+ combined with temperature effects to promote chondrogenic differentiation was tested. The results of Alcian Blue staining showed that the synergistic effect of C-CeO2 and Gd 3+ promoted the secretion of glycosaminoglycans by BMSCs, and when the temperature was increased from 37 °C to 42 °C, the glycosaminoglycans secreted by BMSCs further increased ( Figure 5 C). This result was similar to that of the osteogenic differentiation part. BMSCs co-cultured with C-CeO2 and Gd 3+ and subjected to mild temperature stimulation showed the best chondrogenic differentiation ability. This finding provides a new treatment strategy for the field of osteochondral repair.

[0190] From the above differentiation results, the Gd-CeDN hydrogel scaffold containing C-CeO2 and Gd 3+ affected osteogenic and chondrogenic differentiation through thermal effects. To explore its mechanism, RT-qPCR was used to detect changes in gene expression. Figure 5 D~5H showed that in ROB cells co-cultured with C-CeO2 and Gd 3+ , the expression of osteogenesis-related genes such as ALP, bone morphogenetic protein-2 (BMP-2), osteopontin (OPN), the transcription factor Runx2, and type I collagen (Col-I) was significantly higher than that in cells cultured with only C-CeO2 or only Gd 3+ROB cells, and was significantly higher than that of untreated ROB cells. Although mild temperature (42 °C) had a greater impact on the expression of ALP, BMP-2, and OPN, and a smaller impact on Runx2 and Col-I, C-CeO2, Gd 3+ The synergistic effect with mild temperature had the most significant impact on osteogenic differentiation. In terms of chondrogenic differentiation, Figure 5 showed that under the synergistic action of C-CeO2 and Gd 3+ the glycosaminoglycan secretion of BMSCs increased significantly, which provided strong support for cartilage repair.

[0191] Therefore, based on the photothermal activity of the Gd-CeDN hydrogel scaffold, the antitumor ability of the Gd-CeDN hydrogel was first evaluated in vivo. Figure 6 Figure A shows that the temperature at the tumor site implanted with the Gd-CeDN hydrogel scaffold increased rapidly. By adjusting the distance between the 808 nm near-infrared light source and the tumor, the temperature was controlled between 42 and 45 °C, indicating its excellent photothermal performance in vivo. Compared with the control group, the Gd-DN and Gd-CeDN hydrogels had no effect on tumor growth, but when the Gd-CeDN hydrogel was irradiated with 808 nm near-infrared light for a certain time, tumor growth was inhibited, showing the effect of photothermal therapy (PTT) ( Figure 6 Figure B). At the same time, the body weights of the tumor-bearing mice in all groups increased steadily, indicating that the implanted scaffolds and photothermal treatment did not cause obvious side effects ( Figure 6 Figure C). After 14 days of the experiment, the photos of the isolated tumor tissues further confirmed the photothermal therapy effect of the Gd-CeDN hydrogel scaffold after 808 nm near-infrared irradiation, and Gd 3+ and C-CeO2 had no effect on tumor growth ( Figure 6 Figure D). In addition to simple observation, further histological analysis ( Figure 6 Figure E) also confirmed the photothermal antitumor ability of the Gd-CeDN hydrogel. Hematoxylin-eosin (H&E) staining and Ki67 immunohistochemical staining showed that in the control group, Gd-DN group, and Gd-CeDN group without 808 nm near-infrared irradiation, the nuclei of tumor cells were dense and proliferated actively. However, in the Gd-CeDN group combined with 808 nm near-infrared irradiation, the number of tumor cell nuclei decreased, and the positive expression rate of Ki67 decreased, indicating that the proliferation of tumor cells was significantly inhibited. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay showed that in the Gd-CeDN+NIR group, a large number of apoptotic cells labeled with green fluorescence appeared, indicating that a large number of tumor cells underwent apoptosis. In summary, C-CeO2 endows the Gd-CeDN hydrogel scaffold to effectively act on tumor cells through photothermal therapy without causing drug resistance and side effects.

[0192] To verify the ability of the Gd-CeDN hydrogel scaffold to promote osteochondral repair in vivo, we constructed an osteochondral defect model in the knee joints of New Zealand white rabbits. After implantation, the Gd-CeDN+NIR group achieved slightly temperature-promoted osteochondral regeneration through 808 nm near-infrared irradiation. By controlling the power density, irradiation time, and the distance between the laser source and the defect site, the temperature was controlled at approximately 42 °C ( Figure 7 A). After 3 months of operation, micro-CT analysis showed that both the Gd-DN group and the Gd-CeDN group could promote subchondral bone regeneration, while after combining 808 nm near-infrared irradiation, the Gd-CeDN+NIR group showed significantly higher bone volume fraction (BV / TV, Figure 7 B), trabecular number (Tb.N, Figure 7 C), trabecular thickness (Tb.Th, Figure 7 D), and the lowest trabecular separation (Tb.Sp, Figure 7 E), confirming the ability of C-CeO2, Gd 3+ and mild temperature to synergistically promote bone regeneration. The reconstructed micro-CT images also verified the trend of new bone formation ( Figure 7 F and Figure 25 ). Four weeks after implantation, almost no new bone formation was observed in the defect area of the control group (without implanting any materials), while significant new bone growth was observed in the Gd-DN, Gd-CeDN, and Gd-CeDN+NIR groups and filled into the scaffold. After 8 weeks and 12 weeks of implantation, the Gd-CeDN+NIR group showed the highest new bone regeneration rate, and the newly formed bone almost completely filled the scaffold pores. Further, the subchondral bone regeneration in the knee joints of New Zealand white rabbits was analyzed by H&E staining ( Figure 7 G and Figure 26 ). Even after 12 weeks of operation, the defect area of the control group remained hollow. In contrast, the Gd-DN, Gd-CeDN, and Gd-CeDN+NIR groups showed a trend of new bone tissue growth over time. Especially in the Gd-CeDN+NIR group, after 12 weeks of implantation, the large area of new bone tissue at the defect site was significantly thickened, showing the best bone tissue regeneration effect. In addition, immunohistochemical (IHC) staining analysis showed that although the Gd-DN hydrogel scaffold already had the ability to promote subchondral bone regeneration, its bone regeneration ability was further enhanced by introducing C-CeO2 and mild temperature stimulation ( Figure 27 ). In summary, the Gd-CeDN hydrogel scaffold combined with mild temperature stimulation can effectively promote subchondral bone regeneration by promoting trabecular formation and the expression of Col-I.

[0193] Since bone and cartilage are an integral part in the knee joint, the promoting ability of the hydrogel scaffolds on cartilage regeneration was also detected. It was observed that the defects in the control group always existed and the repair was very slow. In contrast, the defects implanted with Gd-DN, Gd-CeDN and Gd-CeDN+NIR hydrogels had varying degrees of cartilage repair at each time point after surgery. Especially at 8 weeks after surgery, new cartilage tissue was found in all groups, and the repair formation rate of the Gd-CeDN+NIR group was the highest. At 12 weeks, the defect surface of the Gd-CeDN+NIR group was almost completely covered by new cartilage tissue, which could be clearly observed from the photos of the separated tissues ( Figure 8 A and Figure 28 ). Micro-CT reconstruction further supported these observations ( Figure 8 B and Figure 29 ). In the early stage, new cartilage tissue could only be found in the Gd-CeDN and Gd-CeDN+NIR groups. As time went by, new cartilage was formed in all groups. For the Gd-DN, Gd-CeDN and Gd-CeDN+NIR groups, the new cartilage tissue gradually filled the pores of the scaffolds, and the filling rate of the Gd-CeDN+NIR group was the best. Compared with the Gd-CeDN+NIR group, there was an obvious depression on the defect surface of the control group 12 weeks later. Through H&E staining ( Figure 8 C and Figure 30 ) and Safranin O / fast green staining ( Figure 8 D and Figure 31)Deep analysis was conducted on cartilage regeneration. Except for the control group, the defect sites in all Gd-DN, Gd-CeDN, and Gd-CeDN+NIR groups were covered by cartilaginous tissue only four weeks after surgery. As time went by, the control group remained filled with fibrous tissue, while in other groups, cartilaginous tissue highly similar to the original cartilage could be observed, and the amount of newly formed cartilaginous tissue was the largest in the Gd-CeDN+NIR group. Safranin O / fast green staining further revealed the secretion of proteoglycans. In the early postoperative period, except for the control group, all groups showed a red proteoglycan layer. After 12 weeks of implantation, not only was the proteoglycan area the thickest in the Gd-CeDN+NIR group, but also fusion occurred between the newly formed cartilage and bone tissue, indicating the best cartilage repair effect. Except for the control group, the defects in the Gd-DN group, Gd-CeDN group, and Gd-CeDN+NIR group were covered by cartilaginous tissue only 4 weeks after surgery. As time went by, the control group still remained filled with fibrous tissue, while cartilaginous tissue highly similar to the original cartilage could be observed in other groups, and the number of newly formed cartilaginous tissue was the largest in the Gd-CeDN+NIR group. Erythrosin O / fast green staining further showed the secretion of proteoglycans. In the early postoperative period, except for the control group, a red proteoglycan layer appeared in the remaining groups. After 12 weeks of implantation, not only was the proteoglycan area the thickest in the Gd-CeDN+NIR group, but also the newly formed cartilage and bone tissue were well fused, and the cartilage repair effect was the best. Through immunohistochemical staining analysis, the mechanism by which the Gd-CeDN+NIR group had the best ability to promote cartilage repair was found. As time went by, the expression of Col-II increased in each group( Figure 8 E and Figure 32 ). Among them, the Gd-CeDN+NIR group was the most prominent at each time point, indicating that the Gd-CeDN hydrogel scaffold combined with 808nm NIR accelerated the secretion of Col-II, thus affecting the cartilage regeneration process. Similar to Col-II, during the cartilage regeneration process, the expression of Col-X, a marker protein for the quality of regeneration, showed the same trend in all groups( Figure 8 F and Figure 33 ). In summary, the synergistic effect of C-CeO2, Gd 3+ and mild temperature stimulation had the best effect on promoting cartilage regeneration, providing a new strategy for the treatment of cartilage defects and having significant advantages.

[0194] In addition, the biosecurity of the hydrogel scaffold is also very important for its future applications. Whether it is anti-tumor treatment or osteochondral regeneration, H&E staining of the heart, liver, spleen, lungs, and kidneys in different groups did not show obvious adverse reactions such as inflammation, lesions, necrosis, etc., confirming that the hydrogel scaffold and 808nm NIR irradiation had no potential toxicity and induced side effects( Figure 34 and 35)。Meanwhile, the blood routine indexes of the experimental rabbits with osteochondral defects were detected. The results showed that all 13 indexes were within the normal range, and no abnormalities such as infection, inflammation, anemia, and bleeding were found, further indicating the biosafety of our hydrogel system( Figure 36 )。

[0195] The embodiments of this specific implementation manner are all preferred embodiments of the present invention, and do not limit the protection scope of the present invention accordingly. Therefore, all equivalent changes made according to the structure, shape, and principle of the present invention should be covered within the protection scope of the present invention.

Claims

1. A multifunctional crosslinked double-network bionic hydrogel scaffold, characterized in that: It includes a main active ingredient and a double-network bionic hydrogel scaffold. The main active ingredient is carbon-supported cerium dioxide, and the double-network bionic hydrogel scaffold is a gadolinium ion-crosslinked double-network hydrogel.

2. The multifunctional crosslinked double-network bionic hydrogel scaffold according to claim 1, characterized in that: The gadolinium ion-crosslinked double-network hydrogel contains polyacrylamide crosslinked by N,N'-methylenebisacrylamide and sodium alginate crosslinked by gadolinium ions. Using it as a bioink, a multifunctional crosslinked double-network bionic hydrogel scaffold is prepared by 3D printing technology.

3. The multifunctional cross-linked double-network bionic hydrogel scaffold according to claim 1, characterized in that: The gadolinium ion-crosslinked double-network hydrogel contains polyacrylamide crosslinked by N,N'-methylenebisacrylamide and sodium alginate crosslinked by gadolinium ions. By adjusting the content of the crosslinking agent N,N'-methylenebisacrylamide, inks with various configurations are obtained. Using it as a bioink, a multifunctional crosslinked double-network bionic hydrogel scaffold with gradient mechanical strength is prepared by 3D printing technology.

4. A multifunctional crosslinked double-network bionic hydrogel scaffold according to claim 3, characterized in that: Two or more different contents of N,N'-methylenebisacrylamide are respectively dissolved in deionized water with polyacrylamide, sodium alginate, and carbon-supported cerium dioxide to obtain inks with two or more configurations. Using them as bioinks, a multifunctional crosslinked double-network bionic hydrogel scaffold is printed to prepare a 3D-printed multifunctional crosslinked double-network bionic hydrogel scaffold with a gradient change in mechanical strength.

5. A method for preparing the multifunctional cross-linked double-network bionic hydrogel scaffold according to any one of claims 1-4, characterized in that: It includes the following steps: S1. Dissolve ammonium cerium(IV) nitrate and sodium acetate in absolute ethanol, then add acetic acid. After that, transfer the mixture to an autoclave, heat and wash it, and freeze-dry the dispersion to prepare carbon-supported cerium dioxide. S2. Prepare two or more configurations of inks respectively. S3. Using the carbon-supported cerium dioxide prepared in step S1 as the main active ingredient, and using the mixture prepared in step S2 as the bioink to print a multifunctional crosslinked double-network bionic hydrogel scaffold. After ultraviolet light irradiation, immerse the preliminarily crosslinked scaffold in a gadolinium ion solution for further crosslinking, and repeatedly rinse the taken-out scaffold with deionized water to obtain a multifunctional crosslinked double-network bionic hydrogel scaffold.

6. The preparation method of a multifunctional crosslinked double-network bionic hydrogel scaffold according to claim 5, characterized in that: In step S1, ammonium cerium(IV) nitrate is 5 mmol, sodium acetate is 122 mmol, absolute ethanol is 56 mL, and acetic acid is 10 mL.

7. The preparation method of a multifunctional crosslinked double-network bionic hydrogel scaffold according to claim 6, characterized in that: In step S1, after stirring the above mixture at room temperature for 1 hour, transfer the mixture to a 100 mL Teflon-lined autoclave, seal the autoclave in a metal shell, heat it at 220 °C for 12 h. After the solvothermal reaction is completed, centrifuge the suspension at 12,000 rpm and wash it 3 times with deionized water.

8. The preparation method of a multifunctional crosslinked double-network bionic hydrogel scaffold according to claim 5, characterized in that: In step S2, inks with two different contents of N,N'-methylenebisacrylamide were prepared respectively. Among them: in one configuration, 0.71 g (10 mmol) of acrylamide, 500 mg of sodium alginate, 12.5 mg of N,N'-methylenebisacrylamide and 2.5 mg of cerium dioxide loaded on carbon were dissolved in 5 mL of deionized water, and a photoinitiator was added and stirred evenly; in another configuration, 0.71 g (10 mmol) of acrylamide, 500 mg of sodium alginate, 50 mg of N,N'-methylenebisacrylamide and 2 mg of cerium dioxide loaded on carbon were dissolved in 5 mL of deionized water, and a photoinitiator was added and stirred evenly.

9. Use of the multifunctional crosslinked double-network bionic hydrogel scaffold according to any one of claims 1-4 in the preparation of a product for treating osteochondral defects after bone tumor resection.

10. Use of the multifunctional crosslinked double-network bionic hydrogel scaffold according to any one of claims 1-4 in the preparation of a product for treating osteochondral defects.

Images