Bio-organic fertilizer containing burkholderia glumae and application thereof
By using natural gladiolus Burkholderia combined with other natural ingredients to create a bio-organic fertilizer, the problem of the difficulty of establishing existing microbial fertilizers in the soil has been solved. This has enabled effective prevention and control of various plant diseases and improved plant resistance, which is in line with sustainable agricultural development.
Patent Information
- Application Number
- CN202510792206.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-13
- Publication Date
- 2025-10-21
- Estimated Expiration
- 2045-06-13
AI Technical Summary
Existing microbial fertilizers typically use mutant or targeted modified strains, which are difficult to colonize, grow, and play their due role in soil or plants, resulting in poor disease control and the environmental harm caused by chemical control agents.
Using natural Gladiolus Burkholderia as the main component of bio-organic fertilizer, combined with fungal polysaccharides, peat moss, seaweed extract and oil cake, the strain's ability to colonize the soil and plant rhizosphere is improved, enhancing the disease prevention effect.
It effectively prevents and controls sclerotinia stem rot in celery, root rot in okra, root rot in lettuce, and stem base rot in ginger, improves the activity of defensive enzymes and systemic resistance in plants, reduces the use of chemical pesticides, and is in line with sustainable agricultural development.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The invention relates to the field of biotechnology, in particular to a bio-organic fertilizer containing gladiolus Burkholderia and application thereof. Background Art
[0002] Fungal diseases are common in plants, causing severe growth disruptions such as cell rot, leaf drop, inflorescence deformation, and even death. Current control methods for these diseases primarily include chemical agents, biopesticides, and environmental manipulation. Chemical pesticides, while effective and rapid, are limited in their widespread use due to significant environmental and human hazards. Biopesticides, which utilize microbial and botanical agents to inhibit pathogen growth, are becoming a hot research area. Microbial agents can enhance soil microbial diversity, improve soil fertility and crop quality, and enhance plant immunity and resistance. Botanicals utilize plant secondary metabolites to control pathogen growth. Environmental manipulation can mitigate the spread of pathogens and reduce disease occurrence by improving planting techniques, cultivation environments, and irrigation water sources. For example, during plant cultivation, weeding, careful pruning of branches and leaves, enhanced ventilation, and maintaining appropriate humidity and temperature levels can be effective in controlling pathogen growth.
[0003] Microbial fertilizers contain living microorganisms that can promote crop growth. However, currently used microbial fertilizers typically utilize mutated or engineered strains. These strains are often limited by environmental factors in practical applications, making it difficult for them to establish, grow, and function effectively in soil or plants. Consequently, research on microbial fertilizers based on naturally occurring strains has become a hot topic in the field, but few microbial preparations based on naturally occurring microorganisms are currently available for applications such as plant disease prevention.
[0004] In summary, the prevention and control of fungal diseases of plants requires the comprehensive use of chemical control, biological pesticide control and environmental regulation. As an emerging type of fertilizer, microbial fertilizers need further research and application based on natural strains to improve their preparation technology and application effects. Summary of the Invention
[0005] The present invention aims to address the deficiencies of the prior art by providing a bio-organic fertilizer containing Burkholderia gladioli and its use in treating celery sclerotinia rot, okra root rot, lettuce root rot, and ginger stem base rot. The Burkholderia gladioli provided by the present invention is a natural plant rhizosphere fungus that has a better ability to colonize soil and plant rhizospheres than genetically engineered bacteria. Bio-organic fertilizers containing this fungus, after application, have advantageous effects such as preventing and treating celery sclerotinia rot, okra root rot, lettuce root rot, and ginger stem base rot, and increasing the activity of defensive enzymes in plants.
[0006] The present invention provides a bio-organic fertilizer containing gladiolus Burkholderia, comprising fungal polysaccharide, peat, seaweed extract, oil cake, and gladiolus Burkholderia inoculum in a weight ratio of (7-13): (21-36): (3.4-17): (93-207): (1.5-2), wherein the effective viable bacteria count in the gladiolus Burkholderia inoculum is not less than 2×10 10 cfu / g, and the preservation number of the gladiolus Burkholderia is CCTCC NO: M 20242288.
[0007] The second aspect of the present invention provides the use of the biological organic fertilizer of the first aspect in preventing and controlling celery sclerotinia, okra root rot, lettuce root rot, ginger stem base rot, increasing plant phosphorus absorption, rhizosphere soil enzyme activity or increasing plant root defense enzyme activity.
[0008] Through the above technical solution, the present invention can achieve at least the following beneficial effects:
[0009] (1) The Burkholderia gladiolus provided by the present invention ( Burkholderia gladioli ) is a natural strain with better colonization ability. Compared with genetically engineered strains or induced mutant strains, it is more conducive to exerting the biocontrol characteristics of the strain, thereby achieving excellent disease control effects.
[0010] (2) The bio-organic fertilizer provided by the present invention can effectively regulate the metabolism of plants and increase the content of defensive enzymes in plants, thereby effectively solving problems such as serious diseases during plant growth or decreased plant resistance. In addition, when the gladiolus Burkholderia provided by the present invention is added to the bio-organic fertilizer, the systemic resistance of the plant can be further improved. The present invention provides a new technical solution for the prevention and treatment of celery sclerotinia, okra root rot, lettuce root rot, and ginger stem base rot by combining gladiolus Burkholderia and auxiliary materials. This solution is highly practical and conforms to the current direction of sustainable development of agricultural production.
[0011] (3) The bio-organic fertilizer provided by the present invention has the characteristics of a wide range of raw material sources, low cost, and environmental friendliness. Furthermore, the preparation method of the fertilizer is simple and the storage stability is high. By carefully selecting the type and amount of raw materials in the fertilizer, the viable bacterial count when adding gladiolus Burkholderia is high.
[0012] (4) The method for preventing and controlling celery sclerotinia rot, okra root rot, lettuce root rot, and ginger stem base rot provided by the present invention is simple and easy to implement, will not have an adverse impact on environmental safety, and can promote the sustainable development of agricultural production.
[0013] Biological Deposits
[0014] On October 21, 2024, Burkholderia gladioli YNK-FB0053 ( Burkholderia gladioli ) is deposited with the China Center for Type Culture Collection, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, China, and Wuhan University, with the deposit number CCTCC NO: M 20242288. This strain has been disclosed in invention patent application number CN2024118276363. DETAILED DESCRIPTION
[0015] The endpoints of the ranges and any values disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.
[0016] In the present invention, Burkholderia gladioli YNK-FB0053 and Burkholderia gladioli CCTCCNO: M 20242288 are the same strain, have the same meaning, and their names (numbers) can be used interchangeably.
[0017] The inventors of the present invention isolated and obtained a gladiolus Burkholderia ( Burkholderia gladioli ), named YNK-FB0053, and deposited in the China Center for Type Culture Collection on October 21, 2024, with the deposit number CCTCC NO: M 20242288.
[0018] The invention provides a bio-organic fertilizer containing gladiolus Burkholderia, which comprises fungal polysaccharide, peat, seaweed extract, oil cake, and gladiolus Burkholderia CCTCC NO: M 20242288 (or a bacterial agent prepared based on the strain).
[0019] The inventors of the present invention have found through research that when the biological organic fertilizer containing gladiolus Burkholderia provided by the present invention is applied to the soil, it can effectively prevent and control celery sclerotinia, okra root rot, lettuce root rot, and ginger stem base rot, increase the phosphorus absorption of plants, and the activity of rhizosphere soil enzymes or defensive enzymes, thereby promoting plant growth and improving the systemic resistance of plants, and reducing the use of chemical pesticides.
[0020] The bio-organic fertilizer comprises fungal polysaccharides, peat, seaweed extract, oil cake, and gladiolus Burkholderia inoculum in a weight ratio of (7-13): (21-36): (3.4-17): (93-207): (1.5-2), wherein the number of effective live bacteria in the gladiolus Burkholderia inoculum is not less than 2×10 10 cfu / g, the preservation number of the gladiolus Burkholderia is CCTCCNO: M 20242288.
[0021] According to a preferred embodiment of the present invention, the fungal polysaccharide has a water content of 30-35% by weight, a sugar content of 30-50% by weight, a soluble colloid content of 15-25% by weight, a mineral content of 5-15% by weight, and a crude protein content of 2-8% by weight, calculated on a dry matter basis;
[0022] The oil cake has a water content of 20-30% by weight, a sugar content of 40-50% by weight, a crude protein content of 5-10% by weight, and a mineral content of 10-15% by weight, calculated on a dry matter basis;
[0023] The peat has a water content of 10-15% by weight, an organic matter content of 50-60% by weight, a humic acid content of 35-40% by weight, a nitrogen content of 2-3% by weight, a phosphorus content of 0.1-1% by weight, and a potassium content of 0.1-1% by weight, calculated on a dry matter basis.
[0024] The present invention has no particular restrictions on the specific composition and source of the auxiliary materials, which can be directly obtained from commercial sources or can be related products prepared independently according to existing technologies.
[0025] The inventors of the present invention have discovered that using seaweed extract as a fertilizer synergist in the bio-organic fertilizer provided by the present invention not only further enhances its pest control efficacy but also increases the activity of defense proteins in crops, particularly plants, and enzyme activity in the rhizosphere soil. Furthermore, using fungal polysaccharides as a synergist in bio-organic fertilizers containing Burkholderia gladioli can further increase the number of viable bacteria in the fertilizer.
[0026] According to a preferred embodiment of the present invention, the Burkholderia gladioli is the Burkholderia gladioli with a deposit number of CCTCC NO: M 20242288.
[0027] In the present invention, preventing and controlling diseases refers to reducing the incidence of diseases and increasing the activity of defensive enzymes in plants (for example, increasing the activity of superoxide dismutase, polyphenol oxidase and catalase in crops).
[0028] In the present invention, soil nutrient improvement refers to improving soil biological indicators (such as increasing enzyme activity in the soil).
[0029] A fifth aspect of the present invention provides a method for preventing and controlling celery sclerotinia, okra root rot, lettuce root rot, and ginger stem base rot, the method comprising applying a bio-organic fertilizer containing Burkholderia gladiolus to the soil around the plant roots.
[0030] In the present invention, there is no particular limitation on the specific application method of the microbial agent or the bio-organic fertilizer, and any commonly used method for applying fertilizer in the soil in the art can be applied to the present invention. For example, the soil around the plant can be furrowed and then the bio-organic fertilizer of the present invention can be used to irrigate the roots and then cover the soil, or the bio-organic fertilizer of the present invention can be directly poured onto the rhizosphere of the plant.
[0031] In the present invention, there is no particular limitation on the specific amount of the bio-organic fertilizer, as long as it can reduce the incidence of diseases and increase the activity of defensive enzymes in plants.
[0032] According to a preferred embodiment of the present invention, the application amount of the bio-organic fertilizer is not less than 1×10 9 cfu / strain / time is the standard. Preferably 1×10 9 -1×10 13 cfu / strain / time. More preferably 3×10 9 -3×10 11 cfu / strain / time. For example, it can be 3×10 9 cfu / plant / time, 4×10 9 cfu / plant / time, 5×10 9 cfu / plant / time, 6×10 9 cfu / plant / time, 8×10 9 cfu / plant / time, 1×10 10 cfu / plant / time, 5×10 10 cfu / plant / time, 8×10 10 cfu / plant / time, 1×10 11 cfu / plant / time, 2×10 11 cfu / plant / time, 3×1011 cfu / strain / time, or any intermediate value between any two of the above values.
[0033] The fungal polysaccharide, peat, seaweed extract, oil cake and gladiolus Burkholderia provided by the present invention have a synergistic effect when used together. In order to obtain a better effect, the dosage of gladiolus Burkholderia can be appropriately increased.
[0034] According to a preferred embodiment of the present invention, the amount of the bio-organic fertilizer applied to the soil can be 50-80 kg / mu / time; preferably 50-60 kg / mu / time.
[0035] Preferably, the bio-organic fertilizer is applied once per crop of plants.
[0036] The present invention will be described in detail below through examples. It should be understood that the following examples are only used to further explain and illustrate the present invention, and are not intended to limit the present invention.
[0037] Example 1 Preparation of biological organic fertilizer
[0038] This embodiment is used to illustrate the preparation process of the bio-organic fertilizer provided by the present invention.
[0039] The steps include:
[0040] (1) solid culturing the aforementioned Burkholderia gladioli in a solid culture medium to obtain a test tube strain;
[0041] (2) preparing a liquid seed culture medium, and inoculating the test tube seeds therein for liquid culture to obtain liquid seeds;
[0042] (3) Prepare liquid fermentation medium and inoculate liquid seeds into it for fermentation.
[0043] In step (1), the gladiolus Burkholderia is inoculated by slant inoculation, and the solid culture is cultured at a temperature of 25-30°C for 40-50 hours; the solid culture medium comprises: 10-12 g / L glucose, 15-20 g / L agar, 3-5 g / L beef extract, 1-3 g / L yeast extract, 10-15 g / L peptone, and pH = 6.5-7.5.
[0044] In step (2), the test tube seeds are inoculated into a liquid seed culture medium, and the liquid culture is treated for 45-50 hours at a temperature of 25-30°C and a rotation speed of 200-250 r / min; the liquid seed culture medium comprises: 10-15 g / L peptone, 3-5 g / L beef extract, 10-12 g / L sodium chloride, and a pH of 6.5-7.5.
[0045] In this step, the liquid seed culture medium is preferably sterilized at 120-125°C for 20-30 min, and after cooling, 0.5-1.5 cm 2 The liquid seeds were obtained by culturing the mixture in a test tube at 28-30°C on a shaker with a rotation speed of 220-250 r / min for 45-50 hours.
[0046] In step (3), the liquid seeds are inoculated in a liquid fermentation medium at a volume ratio of 0.05-0.1:1 and treated for 45-50 hours at a temperature of 25-30°C and a rotation speed of 200-250 r / min; the liquid fermentation medium comprises: 20-23 g / L sucrose, 10-15 g / L peptone, 5-8 g / L yeast extract, 3-5 g / L potassium dihydrogen phosphate, 5-8 g / L ammonium sulfate, 2-4 g / L calcium carbonate, and a pH of 6.5-7.5.
[0047] In this step, the liquid fermentation medium is preferably sterilized at 120-125° C. for 20-30 min, inoculated with liquid seeds after cooling, and cultured on a shaker at 28-30° C. and 220-250 r / min for 45-50 h to obtain the fermentation liquid.
[0048] The above-mentioned preparation steps further include:
[0049] After the culture was completed, the culture solution was diluted with an appropriate amount of fresh NB medium to obtain a viable bacterial count of approximately 2 × 10 10 cfu / ml of liquid inoculum of Burkholderia gladioli. The liquid inoculum was dried to obtain a dry powder preparation with a viable count of approximately 2×10 10 cfu / g.
[0050] The formula of biological organic fertilizer is shown in Table 2, and the material composition test results of fungal polysaccharide, oil cake and peat are shown in Table 1 (wherein water content is calculated based on the total weight of the material, and the remaining components are calculated based on the dry matter in the material). The sugar content in fungal polysaccharide is determined by sulfuric acid phenol method, the soluble colloid content is determined by 3,5-dimethylphenol colorimetry, the mineral content is determined by atomic absorption spectrophotometry, and the crude protein content is determined by Kjeldahl nitrogen determination. Organic matter content is determined by ultraviolet spectrophotometry, humic acid content is determined by sodium pyrophosphate alkali extraction method, nitrogen content (in terms of N) is determined by Kjeldahl nitrogen determination, phosphorus content (in terms of P2O5) is determined by molybdenum antimony colorimetry, and potassium content (in terms of K2O) is determined by flame photometry. In the test results, water content is calculated based on the total weight of the material, and the remaining components are calculated based on the dry matter in the material.
[0051] Fungal polysaccharides were purchased from Xi'an Wanfang Biotechnology Co., Ltd., peat was purchased from Guangzhou Guangyu Biotechnology Co., Ltd., seaweed extract was purchased from Shanghai Fushida Biotechnology Co., Ltd., and oil cake was purchased from Liuzhou Jinqianwan Molasses Co., Ltd.
[0052] Table 1 Material composition of biological organic fertilizer
[0053]
[0054] Table 2 Bio-organic fertilizer formula
[0055]
[0056] Example 2 Preparation of bio-organic fertilizer containing Burkholderia gladiolus
[0057] This example is used to illustrate the application effect of the bio-organic fertilizer containing Burkholderia gladiolus YNK-FB0053 provided by the present invention on plants.
[0058] (1) Take fungal polysaccharides, peat, seaweed extract, and oil cake according to the formula in Table 2, then mix and compost them. After the compost is completed, seal it tightly with mud. During the composting process, control the moisture content of the compost to 30±5% by weight and the temperature to 50±5°C. Turn the compost once on the 15th and 30th days respectively to obtain basic organic fertilizer.
[0059] (2) After the composting is completed, the basic organic fertilizer obtained in (1) is evenly mixed with the gladiolus Burkholderia inoculum to obtain the bio-organic fertilizer containing gladiolus Burkholderia.
[0060] Example 3 Effect of applying the bio-organic fertilizer containing Burkholderia gladiolus on plants
[0061] The bio-organic fertilizer prepared in Example 2 was applied to the soil around the roots of the plants, and then cultured simultaneously while keeping other conditions consistent. Specific fertilization method: Apply as a base fertilizer 15-20 days before planting the crop. The dosage was such that the dosage of Burkholderia gladioli was not less than 1×10 9 The frequency of application of Burkholderia bio-organic fertilizer to gladiolus is once as base fertilizer 15-20 days before planting.
[0062] The control group received no treatment, and the chemical fertilizer group received conventional fertilizer, in which urea, superphosphate and potassium sulfate were prepared by themselves, and the weight ratio of N, P and K was 14.8:9.6:23.5.
[0063] Investigate the disease situation during the harvest period and calculate the prevention and control effects.
[0064] Root rot survey and grading standards:
[0065] Level 0, healthy roots, no disease symptoms;
[0066] Level 1: slight root damage, with a small amount of lesions visible (0-10%);
[0067] Level 2: There are certain lesions on the roots (11% to 25%);
[0068] Level 3, moderate damage, root lesions spread (26% to 50%);
[0069] Level 4, severe damage, most of the root is infected, with only a small amount of uninfected tissue (51% to 75%);
[0070] Level 5: Very serious, the roots are completely infected and the plant may even die (76% to 100%).
[0071] Sclerotinia disease survey grading standards:
[0072] Level 0: healthy roots, no disease symptoms.
[0073] Level 1: The lesions on the main stem do not exceed 3 cm.
[0074] Level 2: The main stem lesions are more than 3 cm in diameter.
[0075] Level 3: The number of diseased branches is less than 2 / 3, and the lesions in the middle and lower part of the main stem are more than 3 cm.
[0076] The control effect is calculated using the following two formulas:
[0077] Disease index = [(∑(number of diseased plants × representative level)) / (total number of plants × highest representative level)] × 100
[0078] The control effect (%) = [(disease index of the control group - disease index of the treatment group) / disease index of the control group] × 100%.
[0079] Disease identification: Collect the Sclerotinia sclerotiorum ), Fusarium ( Fusarium oxysporum ), Phytophthora ( Phytophthora ) and Pythium glomerulosa ( Pythium myriotylum ) were infected with typical root and tuber disease samples. The pathogen was isolated and purified using tissue separation to obtain a pure culture. This pure culture was then inoculated into live tissues to verify pathogenicity according to Koch's postulates. The pathogen was then re-isolated from the diseased tissues to obtain a pure culture identical to the original inoculum. This validation confirmed the isolate's pathogenicity to crops. Based on morphological characterization of the isolate, molecular identification using the ITS gene was performed to ultimately determine the taxonomic status of the pure culture.
[0080] Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum ) ITS gene sequence (SEQ ID NO.1):
[0081] GAAGTAGGGGGATTGCTGGTTCATAGGCGCAAAATTGAGGATGAAATTCACGATCTCGAACACCAACAATGTCATCTGGCTGTGGAGGAATAACACAACACGACGGATTACATAGATGCTAATTCGATGCTTTCCTGCAGTCCCAAAAGTCATTCCGCACCAAGCAGAAGCTTGCGAGAGCCCAAAAGCAAAACAGACCCATTCCACAATGGATCCGTTTGAGGACTGGTAACACCATCCGGTATGTTCACGATTTTACGATACCCCAATCAGTAGCACATATATCAAGTTCCTACCTCTTCGATTTCACCTTCGATCCTTGAAGTCGAAACGAGTCGTCTCGCAAATAGTATCAATTTCGATCGAGTTTTAACTAATAACATTAA
[0082] Fusarium ( Fusarium oxysporum ) ITS gene sequence (SEQ ID NO.2):
[0083] TTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTGACCTC
[0084] Phytophthora( Phytophthora ) ITS gene sequence (SEQ ID NO.3):
[0085] TCAATACTGATTATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCGGTTTGTCCTTCGGGTCGTCTGCGAGTCCTTTTAAATGTACTGAACTGTACTTCTCTTTGCTCGAAAAGCGTGGTGTTGCTGGTTGTGGAGGCTGCCTGCGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGCGTTTAATGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCGCTTATTGTATGCTTTTCCTGCTGTGGCGTGATGGGCTGGTGAACCGTAGC
[0086] Pythium gregarium ( Pythium myriotylum ) ITS gene sequence (SEQ ID NO.4):
[0087] CTGCCTGTTATGGCGGACTGCCGATGTATTTTTCAAACCCATTTACTTAATACTGAACTATACTCCGAGAACGAAAGTTTTTGGTTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATC GATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGTTATGCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAAC TTGCCTTTCTTTTCTTGTGTAGTCAAGATTAGAGATGGCAGAATGTGAGGTGTCTCCGCTGGCTCCCTCTTCGGAGGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTAAGATGAAG TGTGACTTTCGAACGCAGTGATCTGTTTGGATCGCTCTGCGCGAGTGGGCGACTTCGGTTAGGACATTAAAGGAAGCAACCTCTATTGGCGGTATGTTAGGCTTCGGCCCGACTTTGCAGCTGACGGGGTGT
[0088] At the harvest time, rhizosphere soil and plant leaves were collected. Cellulase (S-CL), catalase (CAT), urease (S-UE), and sucrase (S-SC) activities were measured in the rhizosphere soil of each group of plants, and superoxide dismutase (SOD), polyphenol oxidase (PPO), and catalase (CAT) were measured in the leaves of the plants.
[0089] Method for determining enzyme activity in the rhizosphere soil of plants:
[0090] Cellulase (S-CL) activity: Soil cellulase (S-CL) activity was determined using a soil cellulase (S-CL) kit purchased from Suzhou Gress Biotechnology Co., Ltd. The method of use was described in the instructions. The results were expressed as 1 mg of glucose produced per 10 g of soil sample per 72 h (unit: mg·10 g) -1 72 hours -1 ;
[0091] Catalase (CAT) activity was determined using a soil catalase (CAT) kit purchased from Suzhou Gress Biotechnology Co., Ltd. The method of use was described in the instructions. The results were expressed as 1 mg of hydrogen peroxide produced per 1 g of soil sample per 20 min (unit: mg g).-1 20 minutes -1 ;
[0092] Urease (S-UE) activity: Soil urease (S-UE) activity was determined using a soil urease (S-UE) kit purchased from Suzhou Grace Biotechnology Co., Ltd. The method of use was referred to the instructions. The results were expressed as 1 mg NH3-N produced per 1 g of soil sample per day (unit: mg g) -1 ·d -1 ;
[0093] Sucrase (S-SC) activity: Sucrase (S-SC) activity was determined using a sucrase (S-SC) kit purchased from Suzhou Grace Biotechnology Co., Ltd. The method of use was referred to the instructions. The results were expressed as 1 mg of reducing sugar produced per gram of soil sample per day (unit: mg·g) -1 ·d -1 .
[0094] Method for determining the activity of plant root defense enzymes: superoxide dismutase (SOD) (U·g -1 ), polyphenol oxidase (PPO) (U·g -1 ), and catalase (CAT) (nmol·min -1 ·g -1 ) were determined using kits purchased from Suzhou Gres Biotechnology Co., Ltd. The instructions for use were as per the instructions.
[0095] Phosphorus absorption by plants (kg / hm2) -2 ) determination method: molybdenum blue determination method.
[0096] From the data in Tables 3, 4, 5, and 6, it can be seen that when the bio-organic fertilizer provided by the present invention is applied, the control effect on celery sclerotinia, okra root rot, lettuce root rot, and ginger stem base rot, as well as the improvement effect on plant phosphorus absorption, rhizosphere soil enzyme activity, and Huahuizhizhu defense enzyme activity are stronger than the control. When the applied bio-organic fertilizer adopts the preferred components of the present invention and the content ratio of each component is within the preferred range of the present invention, the effect is further improved.
[0097] Table 3 Test conditions and results of Burkholderia gladiolus and bio-organic fertilizer for the prevention and control of plant fungal diseases
[0098]
[0099] Table 4 Effects of Burkholderia gladioli and bio-organic fertilizer on rhizospheric soil enzyme activities of okra and lettuce
[0100]
[0101] Table 5 Effects of Burkholderia gladioli and bio-organic fertilizer application on the activities of defense enzymes in the roots of celery and ginger
[0102]
[0103] Table 6 Effects of Burkholderia gladiolus and bio-organic fertilizer application on phosphorus absorption by plants
[0104]
[0105] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, various simple variations of the technical solution of the present invention may be made, including combining the various technical features in any other appropriate manner. These simple variations and combinations should also be regarded as disclosed in the present invention and fall within the scope of protection of the present invention.
Claims
1. A bio-organic fertilizer containing Burkholderia gladiolus for preventing and treating celery sclerotinia, lettuce root rot, ginger stem base rot, and improving rhizosphere soil enzyme activity and plant root defense enzyme activity, characterized in that: The bio-organic fertilizer includes fungal polysaccharide, peat, seaweed essence, oil cake, gladiolus Burkholderia ( Burkholderia gladioli ) fungal agent, wherein the number of effective viable bacteria in the gladiolus Burkholderia fungal agent is not less than 2×10 10 cfu / g, and the preservation number of the gladiolus Burkholderia is CCTCC NO: M2024228.
2. The use according to claim 1, characterized in that The pathogen causing the celery sclerotinia disease is Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum ), the pathogen causing the lettuce root rot is Phytophthora ( Phytophthora ), the pathogen causing the ginger stem base rot is Pythium glomerulosa ( Pythium myriotylum ); The improving the activity of root defense enzymes refers to improving the activity of PPO and CAT.
3. The use according to claim 1, characterized in that The fungal polysaccharide has a water content of 30-35% by weight, a sugar content of 30-50% by weight, a soluble colloid content of 15-25% by weight, a mineral content of 5-15% by weight, and a crude protein content of 2-8% by weight, based on dry matter; and / or, the oil cake has a water content of 20-30% by weight, a sugar content of 40-50% by weight, a crude protein content of 5-10% by weight, and a mineral content of 10-15% by weight, based on dry matter; and / or, the peat has a water content of 10-15% by weight, an organic matter content of 50-60% by weight, a humic acid content of 35-40% by weight, a nitrogen content of 2-3% by weight, a phosphorus content of 0.1-1% by weight, and a potassium content of 0.1-1% by weight.
4. A method for increasing the activity of plant rhizosphere soil enzymes or the activity of plant root defense enzymes PPO and CAT, characterized by: The method comprises applying the bio-organic fertilizer according to claim 1 or 2 to the soil at a dosage of 50-60 kg / mu / time, and the application frequency is once per crop.
Citation Information
Patent Citations
Burkholderia gladioli for antagonizing cucumber fusarium wilt and application of burkholderia gladioli
CN115029280A
Composition containing burkholderia and application thereof in plant diseases
CN116573970A
Burkholderia gladioli as well as fungicide and application thereof
CN119286739A