Pinellia ternata nac class transcription factor ptnac61, and coding gene and application thereof

Abstract

The application discloses a pinellia ternate NAC class transcription factor PtNAC61, an encoding gene thereof and application, belongs to the technical field of genetic engineering, and provides the pinellia ternate NAC class transcription factor PtNAC61.The pinellia ternate NAC class transcription factor PtNAC61 is any one of the following proteins: (1) a protein consisting of the amino acid residue sequence in SEQ ID NO.1; (2) a protein derived from (1) by substitution and / or deletion and / or addition of one to ten amino acid residues in the amino acid residue sequence in SEQ ID NO.1 and having the function of the pinellia ternate NAC class transcription factor; and the application further provides a PtNAC61 gene encoding the pinellia ternate NAC class transcription factor PtNAC61.The application separates and clones the PtNAC61 gene from pinellia ternate, introduces the gene into pinellia ternate by means of agrobacterium-mediated transformation, obtains a transgenic plant, and verifies that the transgenic pinellia ternate has improved drought stress tolerance and improved leaf anti-aging ability, thereby providing an important gene resource for plant stress resistance genetic engineering and having important significance for improving medicinal plant yield.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, and particularly relates to a pinellia ternate NAC transcription factor PtNAC61, a coding gene thereof and application. BACKGROUND

[0002] Plants often suffer from abiotic factors such as drought, high temperature and high salt during growth and development, among which, drought is one of the important environmental limiting factors affecting plant growth and development and yield. Drought can cause wilting and reduced growth rate of plants, damage plants, and make plants age prematurely, thereby reducing crop yield. Higher plants have evolved various mechanisms based on morphology, development, physiology and biochemistry to adapt to changes in the external environment during long-term evolution. The response of plants to various stress is often a multi-level, multi-pathway and multi-gene joint action, which regulates the response to stress through different mechanisms at different levels. With the continuous development of biotechnology, it has been found that the improvement of plant stress tolerance is closely related to the regulation of functional gene expression by transcription factors. Therefore, the research on transcription factors has become one of the focuses of plant gene function research.

[0003] Transcription factors, also known as trans-acting factors, are a class of regulatory proteins that resist biological and abiotic stress, can specifically bind to the cis-acting elements of the eukaryotic gene promoter, and thus activate or inhibit the transcription and expression of downstream genes, playing an important role in plant growth and development. From the analysis of protein structure, transcription factors generally contain four functional regions, namely DNA binding domain, transcription regulation domain (including activation and inhibition domain), oligomerization site and nuclear localization signal. With the continuous development of experimental techniques and the widening of research direction, more and more results prove that transcription factors are widely involved in a series of physiological activities such as plant biological and abiotic stress response, plant growth and development, and morphological development.

[0004] NAC is a plant-specific transcriptional regulator discovered in recent years, which widely exists in various plants. NAC is named after the petunia (Petunia hybrida) gene SHEATHY1, the Arabidopsis (Arabidopsis thaliana) gene OVEREXPRESSION OF CUCUMBER (OC) 2, and the first letter of the gene ABILl (ABSCISIC ACID-Insensitive 1). Petunia hybrida NAM no apical meristem Arabidopsis thaliana ATAF1 / 2 CUC2 cup-shaped cotyledon The NAC transcription factor family has a highly conserved NAC domain composed of 150-160 highly conserved amino acid residues, a highly conserved DNA domain at the N-terminal, which is divided into five sub-domains A-E, and a highly variable transcription regulation domain at the C-terminal. NAC transcription factor can specifically bind to the sequence (CATGTG) in the promoter, i.e. NACRS, thereby initiating the transcription of the gene.​​​​​​

[0005] NAC transcription factors are induced by various environmental factors such as drought, high temperature, wounding, and other abiotic stresses and biotic stresses, and different growth and development stages of plants, and directly or indirectly participate in the regulation network, thereby improving the tolerance of plants to adversity. At present, most of the research on NAC transcription factor family comes from model plants such as Arabidopsis, rice, and tobacco, and there are few reports on other species. For example, in tomato (Transcriptome analysis of tomato cold-tolerant germplasm under low temperature stress and identification of related gene functions-DOI: 10.7666 / d.D01404343), it was found that overexpression of ShNAC The transgenic plants were more sensitive to drought than the wild-type plants, and the gene was a negative regulator of drought resistance in tomato plants. In Arabidopsis, ATAF1 was induced by drought stress and ABA, and positively regulated leaf senescence, ataf1 The drought tolerance of the mutant was enhanced, and the marker genes COR47 / RD17 , ERD10 , KIN1 , etc. were up-regulated. ANAC016 By inhibiting AREB1 expression to positively regulate drought stress tolerance, and ANAC017 may regulate the expression of target genes ANAC016 , accelerate the aging-related processes such as autophagy, promote leaf senescence and cell death. In rice, overexpression of OsNAC2 can enhance the drought resistance of rice, and it can also induce the expression of ABA biosynthesis or signal genes, thereby enhancing SAGs expression, promoting leaf senescence. In tobacco, NtNAC028 induced by drought, high salt, and ABA, overexpression of the gene in tobacco reduces the tolerance to drought and high salt stress, and further studies have found that NtNAC028 can positively regulate tobacco leaf senescence. These research results show that NAC transcription factors positively regulate leaf senescence when plants respond to drought stress.

[0006] Pinellia ternata (Thunb.) Breit. of Araceae Pinellia ternata (Thunb.) Briet.It is a traditional Chinese medicine material, tuber, has cough, reverse, anti-tumor and other effects. In recent years, with the change of climate and environment and the intensification of overexploitation, the wild resources of pinellia ternate gradually decrease, and artificial cultivation has become the main way to obtain pinellia ternate medicinal materials. However, with the development of internationalization of traditional Chinese medicine, pinellia ternate medicinal materials are in short supply, and the yield of wild and artificial cultivation can only meet one third of the market demand. The low yield of pinellia ternate is mainly because of its special habit, drought and flood, shade and sun, especially during the summer solstice, the strong sunlight and high temperature, the soil water shortage, the aboveground part of pinellia ternate collapses, withers and dies, which is commonly known as 'downy seedling', which greatly shortens the growth time of pinellia ternate and leads to low yield. According to statistics, the annual agricultural loss caused by drought is equivalent to 60% of the total of all kinds of meteorological disasters, and drought is also one of the important environmental limiting factors causing pinellia ternate downy seedling. Therefore, in the production of pinellia ternate, preventing downy seedling is a very important technology to increase yield. At present, the molecular mechanism of pinellia ternate response to drought stress is not clear, and the artificial regulation technology develops slowly, which seriously restricts the development of pinellia ternate industry. Studies have shown that the essence of pinellia ternate drought downy seedling is programmed cell death caused by cell senescence, so the molecular mechanism of pinellia ternate response to drought stress can be analyzed to prevent or delay pinellia ternate downy seedling, to delay leaf senescence and produce green traits, and finally to improve the yield of pinellia ternate. As an important regulatory protein in plants, NAC transcription factor plays an important role in the response of abiotic stress such as drought and high temperature and the process of leaf senescence. Compared with other model crops, the biological function of NAC gene in pinellia ternate and its mechanism are still less reported, which seriously restricts the discovery and utilization of this type of gene. SUMMARY

[0007] In view of the shortcomings of the prior art, the purpose of the present application is to provide a pinellia ternate NAC transcription factor PtNAC61, an encoding gene and an application thereof.

[0008] The present application realizes the above-mentioned purpose by the following technical solutions:

[0009] The present application provides a pinellia ternate NAC transcription factor PtNAC61, which is a protein as described in (1) or (2) below:

[0010] (1) a protein consisting of the amino acid residue sequence in SEQ ID NO. 1;

[0011] (2) a protein derived from (1) by substitution, deletion and / or addition of one to ten amino acid residues in the amino acid residue sequence in SEQ ID NO. 1 and having the function of pinellia ternate NAC transcription factor;

[0012] As a further optimization solution of the present invention, the amino acid sequence of the Pinellia ternata NAC-type transcription factor PtNAC61 is shown in SEQ ID NO.1, and consists of 297 amino acid residues.

[0013] The present invention also provides a gene encoding the Pinellia NAC transcription factor PtNAC61. PtNAC61 gene, the PtNAC61 The nucleotide sequence of the gene is any one of the following (1) to (4):

[0014] (1) the DNA sequence shown in SEQ ID NO. 2;

[0015] (2) a polynucleotide encoding the amino acid sequence shown in SEQ ID NO.1;

[0016] (3) A DNA sequence that has more than 90% homology with the DNA sequence in SEQ ID NO. 2 and encodes a protein with the same function; for example, a cloned PtNAC61 The gene is used as a probe to screen the gene of the present invention or a homologous gene from cDNA and genomic libraries, or the gene of the present invention or any homologous DNA sequence thereof is amplified from the Pinellia genome, mRNA and cDNA using PCR.

[0017] (4) A nucleotide sequence that can hybridize with the DNA sequence defined in SEQ ID NO. 2 under highly stringent conditions, wherein the highly stringent conditions are hybridization and membrane washing at 65°C using a solution of 0.1× SSPE or 0.1× SSC, 0.1% SDS.

[0018] As a further optimization solution of the present invention, the PtNAC61 The nucleotide sequence of the gene is shown in SEQ ID NO. 2, which consists of 894 bases and can encode a complete open reading frame.

[0019] The present invention also provides a PtNAC61 Application of genes in the simultaneous regulation of plant senescence and plant stress resistance.

[0020] As a further optimization scheme of the present invention, overexpression of PtNAC61 Genes that can delay plant leaf aging and improve plant drought resistance.

[0021] As a further optimized solution of the present invention, the plant is a monocotyledonous plant or a dicotyledonous plant.

[0022] As a further optimization solution of the present invention, the monocotyledonous plant is Pinellia ternata ( Pinellia ternata ).

[0023] The application also provides a method for obtaining a drought-resistant evergreen plant. PtNAC61 The drought-resistant evergreen plant obtained after the gene is introduced into the target plant has higher drought-resistant performance and evergreen property than the target plant.

[0024] As a further optimization of the application, the plant is Pinellia ternata, the plant expression vector is pCAMBIA1301, the plant expression vector carrying the gene of the application is pCAMBIA1301-PtNAC61, and the plant is Pinellia ternata. PtNAC61 The expression vector of the gene can be introduced into the plant cell by a Ti plasmid, a plant virus vector, direct DNA transformation, or a biological technology method such as electroporation. PtNAC61 When the plant expression vector is constructed, any one of an enhanced promoter or an inducible promoter can be added before the transcription initiation nucleotide.

[0025] The application has the following beneficial effects:

[0026] 1) The gene is isolated and cloned from Pinellia ternata, introduced into Pinellia ternata by an Agrobacterium-mediated transformation method to obtain a transgenic plant, and then it is verified that the transgenic Pinellia ternata has improved drought stress tolerance and improved leaf anti-aging ability, which provides an important gene resource for plant stress resistance genetic engineering, has important significance for improving the yield of medicinal plants, and provides a theoretical basis and utilization value for the application of the gene in other medicinal plants to improve stress resistance and evergreen property. PtNAC61 2) The identification of the Pinellia ternata NAC family gene and the functional analysis of the drought stress resistance and leaf senescence delay of the gene are helpful to analyze the drought seedling mechanism of Pinellia ternata, improve the yield and cultivation adaptability, and provide an important gene resource for plant stress resistance genetic engineering, which has important significance for improving the yield of medicinal plants.

[0027] BRIEF DESCRIPTION OF DRAWINGS

[0028] FIG. 1 is a homology alignment diagram of the Pinellia ternata NAC transcription factor PtNAC61 protein and other species NAC family transcription factor conserved regions according to the application; Figure 1

[0029] FIG. 3 is an evolutionary tree of the Pinellia ternata NAC transcription factor PtNAC61 protein and other NAC transcription factors according to the application after amino acid sequence alignment; Figure 2

[0030] FIG. 5 is a subcellular localization diagram of the Pinellia ternata NAC transcription factor PtNAC61 protein according to the application; Figure 3

[0031] FIG. 7 is a transgenic Pinellia ternata plant obtained by the method according to the application; and Figure 4 PtNAC61 ​Figure of PCR detection of hygromycin in transgenic Pinellia ternata plants; M: DL2000 Marker; OE1; OE2; OE3; OE4; +: using pCAMBIA1301 plasmid as template; -: using water as template.

[0032] Figure 5 For trans PtNAC61 Figure of PCR detection results of transgenic plants;

[0033] Figure 6 For trans PtNAC61 Figure of semi-quantitative detection results of transgenic plants;

[0034] Figure 7 For trans PtNAC61 Figure of experimental results of transgenic Pinellia ternata plants improving drought tolerance;

[0035] Figure 8 For trans PtNAC61 Figure of experimental results of transgenic Pinellia ternata plants delaying leaf senescence. DETAILED DESCRIPTION

[0036] Hereinafter, the present application will be described in further detail with reference to the accompanying drawings. It is necessary to point out that the following detailed description is only used to further illustrate the present application, and cannot be understood as limiting the scope of protection of the present application, and the skilled in the art can make some non-essential improvements and adjustments to the present application according to the above application content.

[0037] 1. Materials

[0038] (1) Restriction enzymes XbaI and BamHI , ligase, pEASY-Blunt Simple, DNA Marker, Taq DNA polymerase, dNTPs, etc. were purchased from Takara Company;

[0039] (2) Reverse transcription kit was purchased from Promega Company;

[0040] (3) Plasmid extraction kit, gel recovery kit and genome extraction kit were purchased from Quanshengjin Biotechnology Co., Ltd.;

[0041] (4) The primers used were synthesized by Shanghai Shengong Biological Co., Ltd.; sequencing was performed by Tongyong Biological Company;

[0042] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are commercially available products unless otherwise specified.

[0043] 2. Methods

[0044] 2.1 Pinellia ternata NAC family genesPtNAC61 Acquisition

[0045] 2.1.1. Drought stress treatment: Select uniformly sized and plump P. ternata tubers and sow them in pots filled with nutrient soil. Spray distilled water at appropriate times to keep the soil moist. When the seedlings reach the three-leaf stage, use the normally irrigated plants as a control and subject them to natural drought stress treatment for 3, 5, 7, 10, 12, and 14 days. At different treatment time periods, use scissors to cut leaves from the same parts of the P. ternata seedlings in the experimental and control groups, respectively. Three samples were collected for each treatment stage. After sampling, the samples were immediately frozen with liquid nitrogen and stored in a -80°C refrigerator for future use.

[0046] 2.1.2 RNA extraction: The Pinellia ternata material obtained in step 2.1.1 above was ground with liquid nitrogen and quickly transferred to a 1.5 mL centrifuge tube (pre-cooled with liquid nitrogen); the ground Pinellia ternata material was uniformly added to the 0.5 mL scale, 1 mL of Trizol was added, and the tube was allowed to stand at room temperature for 10 min to fully lyse it; the tube was centrifuged at 4°C, 12,000 rpm, for 5 min, and the precipitate was discarded; chloroform was added at a rate of 200 mL chloroform / mL Trizol, the tube was tightly capped, and the tube was vigorously shaken by hand for 15 s. After it was fully emulsified, it was allowed to stand at room temperature for 15 min; centrifuged at 4°C, 12,000 rpm for 15 min; the tube was carefully removed from the centrifuge, and the upper aqueous phase was aspirated and transferred to another centrifuge tube; 0.5 mL of isopropanol / mL Trizol was added to isopropanol, mixed, and allowed to stand at room temperature for 10 min; centrifuged at 4°C, 12,000 rpm for 15 min; the supernatant was discarded, and the RNA precipitated at the bottom of the tube; the supernatant was carefully discarded, and 1 mL of 75% ethanol / mL was added to the tube. Add 75% ethanol to Trizol and gently shake the centrifuge tube to suspend the precipitate. Centrifuge at 12,000 rpm at 4°C for 5 min. Discard the ethanol, place the tube upside down on paper, and let it dry at room temperature. Add an appropriate amount of RNase-free water to dissolve the precipitate. If necessary, use a pipette to blow up the precipitate. After the RNA is fully dissolved, take an appropriate amount to test its concentration and purity. Store the rest at -80°C for later use.

[0047] 2.1.3, Reverse transcription: according to the steps provided by the promega reverse transcription kit, the reverse transcription system is as follows: total RNA 1 μg, 25 mM MgCl2 4 μL, Reverse Transcription 10x Buffer 2 μL, 10 mM dNTP Mixture 2 μL, RNase inhibitor (40 U / μL) 0.5 μL, Oligo(dT)15 Primer (500 μg / μL) 1 μL, AMV Reverse Transcriptase (25 U / μL) 0.6 μL, add Nuclease-Free Water to 20 μL. Mix carefully, incubate at 42°C for 40 min, then heat at 95°C for 5 min, and place at 4°C for 15 min to terminate the reaction, and the corresponding reverse transcription product cDNA is obtained.

[0048] 2.1.4, amplification: search the genome and transcriptome database of pinellia ternate, obtain the putative coding sequence of PtNAC61 , and design specific primers using Primer Premier 5.0 software. The primer sequences are as follows:

[0049] SEQ ID NO. 3: PtNAC61 -F: ATGGCGACGGGGATGGC;

[0050] SEQ ID NO. 4: PtNAC61 -R: TCAGAGGCTTCCGTGCCTCT.

[0051] The pinellia ternate cDNA obtained in step 2.1.3 above is used as a template to obtain a coding region containing a complete open reading frame by RT-PCR, with a length of 894 bp, which is recovered and connected to the pEASY-Blunt Simple vector for sequencing. The sequencing results show that PtNAC61 the nucleotide sequence of the gene is consistent with the nucleotide sequence shown in SEQ ID NO. 2, and encodes a protein having an amino acid residue sequence as shown in SEQ ID NO. 1.

[0052] 2.2 Pinellia ternate PtNAC61 Sequence homology and homology analysis

[0053] According to the sequence of the results of sequencing, sequence alignment was performed in the Pinellia ternate database, and it was found that the cloned gene sequence was most homologous to the NAC family transcription factor. The protein sequence of the transcription factor PtNAC61 and other reported NAC transcription factor family members was aligned, and the N-terminal highly conserved domain sequence was analyzed. In order to further analyze the phylogenetic relationship of PtNAC61 and other known functional NAC transcription factors, the NAC proteins of different plants were analyzed for phylogenetic relationship with PtNAC61, and the results are shown in Figure 1 、 2

[0054] 2.3 Subcellular localization of PtNAC61

[0055] 2.3.1 Construction of PtNAC61 subcellular localization vector

[0056] In order to understand the expression of PtNAC61 protein, a subcellular localization fusion expression vector was constructed. pCAMBIA1305 (p1305) was used as the backbone, GFP green fluorescent protein as the reporter gene, and mCherry red fluorescent protein as the nuclear localization signal gene to construct p1305-35S-PtNAC61-GFP fusion expression vector. It should be noted that when designing the gene primers this time, the stop codon of the gene should be removed. XbaI and BamHI as the upstream and downstream primers. The primer sequences are as follows:

[0057] SEQ ID NO. 5: RH-F: GTCCGGAGCTAGCTCTAGAATGGCGACGGGGATGGC;

[0058] SEQ ID NO. 6: RH-R: CCTTGCTCACCATGGATCCGAGGCTTCCGTGCCTCTTCC.

[0059] 2.3.2 Tobacco transient expression

[0060] 1) Select healthy tobacco plants that have grown for 3-4 weeks. The growth status of tobacco is very important, and it must be healthy and vigorous. Generally, long-day growth is required. If the plants are grown in an incubator, they need to be taken out several days in advance to adapt to the external environment before infection.

[0061] ​2) Selecting the only land organisms GV3101 (pSoup-p19) Chemically Competent Cell, the competent cells from -80℃ freezer to room temperature or ice, to the frozen each tube 100 μL of competent cell suspension respectively added 1 μg pCAMBIA1305, p1305-35S-PtNAC61-GFP, mCherry plasmid gently mixed, ice for 5 min, liquid nitrogen frozen 5 min, 37℃ water bath 5 min, ice bath 5 min; Under sterile conditions, 700 μL of YEP liquid medium without antibiotics, 28℃ shaking culture 2~3 h, 5000 rpm centrifugal 1 min after bacterial liquid, take 100 μL or so supernatant gently blow resuspended bacteria, add to the YEP solid medium containing kanamycin, rifampicin plate, using a sterile spreader evenly spread the cells, after the liquid in the plate is completely absorbed, inverted plate, 28℃ culture 2~3 days;

[0062] 3) pick a few single colony spots respectively in 2 mL centrifuge tube, 1 mL of YEP liquid medium containing kanamycin, rifampicin, 28℃ shaking culture 3 h or so, take the bacterial liquid for PCR detection, PCR products were detected by 1.0% agarose gel electrophoresis, select the correct bacteria in 50 mL centrifuge tube, 10 mL of YEP liquid medium containing kanamycin, rifampicin, 28℃ shaking culture 12-16 h;

[0063] 4) measure OD600, Agrobacterium OD600>1.6 can be injected, the volume of each Agrobacterium liquid added to calculate, the formula is: V=3 / OD600;

[0064] 5) the calculated Agrobacterium liquid mixed, room temperature 4000 rpm / min centrifugal 15 min;

[0065] 6) discard the supernatant, 2ml tobacco treatment liquid (200 μL 0.5 M MES, 100 μL 1 M MgCl2, 10 μL 100mM AS, 9.69 mL sterile water) suspended bacteria;

[0066] 7) room temperature, avoid light for 1-1.5 h;

[0067] 8) with no needle 5 mL needle tube, injection of tobacco leaf back different regions;

[0068] 9) room temperature, weak light culture 36-48 h, observed by laser confocal microscope.

[0069] Results as Figure 3As shown: subcellular localization experiment shows that PtNAC61 protein is located in the nucleus.

[0070] 2.4 PtNAC61 Detection of transgenic pinellia

[0071] Construction of plant expression vector pCAMBIA1301- PtNAC61 The plant expression vector was introduced into the petiole of pinellia by Agrobacterium-mediated genetic transformation method of pinellia, and through pre-culture, immersion, co-culture, screening of hygromycin-resistant callus, differentiation, rooting, hydroponics, and transplantation, transgenic plants were obtained. Then the genomic DNA of the leaves of the transgenic plants was extracted, and the specific method was as follows:

[0072] 1) Take 100 mg of fresh pinellia plant young leaves and put them into a mortar, add liquid nitrogen and grind thoroughly;

[0073] 2) Add 250 μL of RB1 solution and mix quickly;

[0074] 3) Add 30 μL of 10% SDS and 15 μL of RNase A to the lysis solution and mix;

[0075] 4) Place in a 60°C water bath for 15 min;

[0076] 5) Centrifuge at 13000 rpm for 5 min, and transfer the supernatant to a clean centrifuge tube;

[0077] 6) Add 100 μL of PB1 solution and mix, place on ice for 5 min, and centrifuge at 13000 rpm for 5 min;

[0078] 7) Transfer the supernatant to a clean centrifuge tube and add 375 μL of BB1 solution and mix;

[0079] 8) Pour all the mixed solution into the adsorption column, centrifuge at 13000 rpm for 1 min, and discard the filtrate;

[0080] 9) Add 500 μL of CB1 solution, centrifuge at 13000 rpm for 1 min, and discard the filtrate;

[0081] 10) Add 500 μL of WB1 solution, centrifuge at 13000 rpm for 1 min, discard the filtrate, and repeat once;

[0082] 11) Centrifuge at 13000 rpm for 2 min to completely remove WB1;

[0083] 12) Transfer the adsorption column to a clean centrifuge tube, add 70 μL of preheated deionized water to the center of the column, stand at room temperature for 2 min, centrifuge at 13000 rpm for 2 min, and elute the DNA;

[0084] 13) Take 5 μL of sample and spot it on 1% agarose gel to check the quality of the extracted DNA.

[0085] Using this as a template, the target fragment was amplified with hygromycin gene primers. The primer sequences are as follows:

[0086] SEQ ID NO.7: HygR-F: ACTCACCGCGACGTCTGT;

[0087] SEQ ID NO. 8: HygR-R:TTTCTTTGCCCTCGGACG.

[0088] The PCR reaction conditions were as follows: pre-denaturation: 94°C, 5 min; denaturation: 94°C, 30 s; annealing: 55°C, 30 s; extension: 72°C, 1 min 30 s, 30 cycles; and 72°C, 10 min. After the reaction, the PCR products were detected by 1.0% agarose gel electrophoresis. The results were as follows: Figure 4 As shown, M: DL2000 Marker; 1: OE1; 2: OE2; 3: OE3; 4: OE4; 5: OE5; +: positive control using pCAMBIA1301 plasmid as template; -: negative control using water as template. Figure 4 It can be seen that both the transgenic plants and the positive control can amplify the target band, while the negative control does not amplify the band, indicating that the transgenic plants carry PtNAC61 The gene expression vector has been successfully introduced into the Pinellia genome.

[0089] 2.5 PtNAC61 PCR detection and semi-quantitative detection of transgenic plants

[0090] 2.5.1 PCR testing

[0091] Take the genomic DNA from the leaves of the transgenic plants in step 2.4 above and PtNAC61 The gene was detected by PCR, and the amplification program was as follows: pre-denaturation: 94℃, 5 min; denaturation: 94℃, 30 s, annealing: 60℃, 30 s, extension: 72℃, 1 min 30 s, 30 cycles; 72℃, 10 min. Figure 5 As shown, the transgenic plants were able to amplify the target band ( PtNAC61 The amplified band was 894 bp), while the negative control did not amplify the band, indicating that PtNAC61 The gene has been successfully introduced into the Pinellia genome.

[0092] 2.5.2 Semi-quantitative detection

[0093] RNA was extracted from part of leaves of the transgenic plants of step 2.4 above and cDNA was reverse transcribed, with Pinellia ternate 18s rRNA as the internal reference gene, according to the method of PtNAC61 The nucleotide sequence of the gene was used to design semi-quantitative primers:

[0094] SEQ ID NO. 9: Pt18s F: CGCATATAAATAAACGGAGGAA;

[0095] SEQ ID NO. 10: Pt18s R: GACGCTTCTACAGACTACA;

[0096] SEQ ID NO. 11: PtNAC61 RT-F: GCACGGATAACGACATCAACG;

[0097] SEQ ID NO. 12: PtNAC61 RT-R: ATCACTGCCTCACCCGACCC.

[0098] The semi-quantitative detection was performed on the PtNAC61 gene, with the amplification procedure being: pre-denaturation at 94℃ for 5 min, denaturation at 94℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 1 min, 20 cycles, and 72℃ for 10 min. The results are shown in Figure 6 , the negative control could not amplify a band, while the transgenic plants could all amplify the target band.

[0099] 2.6 PtNAC61 Drought tolerance identification of transgenic plants

[0100] PCR positive sterile seedlings (overexpression PtNAC61 gene strain OE3, OE4) of transgenic Pinellia ternate with the same growth as wild type (WT) Pinellia ternate were selected and transplanted in flowerpots filled with sterilized nutrient soil, irrigated with appropriate amount of water every day, and cultured in a greenhouse with an environmental temperature of 22℃, 16h light, and 8h darkness. Room temperature culture was used as a control, while the seedlings of the drought treatment group were stopped from being irrigated and naturally dried when they reached the three-leaf stage, with 3 repeats. After 7d of natural drought treatment, the apparent characteristics of the plants were observed and recorded every day and the survival rate was counted, with the results being shown in Figure 7 , after drought treatment, the leaves of wild type Pinellia ternate turned yellow obviously, and the survival rate of the transgenic Pinellia ternate was significantly higher than that of the wild type Pinellia ternate, and overexpression PtNAC61 of the gene significantly improved the drought tolerance of Pinellia ternate.

[0101] 2.7 PtNAC61 Identification of anti-aging ability of transgenic plants

[0102] 2.7.1, senescence phenotype observation

[0103] The transgenic pinellia PCR positive aseptic seedlings (OE3, OE4) with the same growth as wild type (WT) pinellia were selected and placed on MS+Kan+Carb culture plates for culture, and after callus grew into seedlings, they were moved to conical bottles, photographed and recorded (control). Then they were placed in a greenhouse for culture for 2 months, and the leaf surface appearance of the plants (senescence) was observed and recorded, and the results are shown in Figure 8 As shown in A, the wild type pinellia has yellow leaves, and the degree of senescence is more obvious than the transgenic pinellia.

[0104] 2.7.2, chlorophyll content detection

[0105] 100 mg of the transgenic plants (OE3, OE4) and wild type plants (WT) were cut and placed in 5 mL of 95 % pre-cooled ethanol, and placed at 4 °C in the dark until the leaves were completely decolorized, centrifuged at 4 °C at 9000 rpm for 2 min, and the supernatant was taken, the absorbance values at 649 nm and 665 nm were measured by spectrophotometer, and the total chlorophyll content was calculated by the formula: (6.10A665+20.04A649)*V / (1000*W), V is the volume of the extraction solution (mL), and W is the fresh weight of the plant (g), and the results are shown in Figure 8 As shown in B, the chlorophyll content in the wild type pinellia is much lower than that in the transgenic pinellia.

[0106] In summary, through the results of phenotype observation and chlorophyll content detection, it is proved that overexpression of PtNAC61 gene can delay the senescence of pinellia leaves.

[0107] The above-described embodiments only express several embodiments of the present application, and the description is more specific and detailed, but it cannot be understood as limiting the scope of the patent of the present application. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are all within the protection scope of the present application.

Claims

1. A Pinellia NAC class transcription factor PtNAC61, characterized in that, The amino acid sequence of the Pinellia ternate NAC class transcription factor PtNAC61 is shown as SEQ ID NO.

1.

2. A gene encoding the Pinellia NAC-like transcription factor of claim 1. PtNAC61 characterized in that, The PtNAC61 The nucleotide sequence of the gene is shown as SEQ ID NO.

2.

3. A method as claimed in claim 2 PtNAC61 The use of the gene in the simultaneous regulation of plant senescence and plant stress resistance is characterized in that: Overexpression of the PtNAC61 gene can delay leaf senescence and improve drought resistance in Pinellia ternata.

4. A method for obtaining a drought-resistant evergreen plant ， characterized in that the gene of claim 2 is introduced into a plant of interest using a plant expression vector PtNAC61 a drought-resistant evergreen plant is obtained after the gene is introduced into the plant of interest, the drought-resistant evergreen plant has higher drought resistance and evergreen properties than the plant of interest, and the plant is Pinellia ternata.

5. The method for obtaining a drought-tolerant evergreen plant according to claim 4 ， characterized in that, The plant expression vector is pCAMBIA1301.

Images