Preparation method and application of multi-segment fused antibacterial peptide fusion protein
By introducing OST signal peptide and collagen into the antimicrobial peptide fusion protein and optimizing the ligation sequence, the problem of low yield of three stages of bovine lactoferrin active peptide fusion peptide was solved, and the expression of antimicrobial peptide fusion protein with high yield and high efficiency antimicrobial activity was achieved.
Patent Information
- Application Number
- CN202510657267.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-21
- Publication Date
- 2025-07-11
AI Technical Summary
In the prior art, the artificial synthesis yield of fusion polypeptide containing three-stage LFcinB, LFcin and Lf bovine lactoferrin active peptides is relatively low, which limits its development in antibacterial applications.
By introducing OST signal peptide and collagen and optimizing the ligation sequence, the OST signal peptide, collagen, bovine lactoferrin peptide LFcinB, bovine lactoferrin N-leaf small peptide LFcin and bovine lactoferrin N-leaf derived peptide Lf were successively linked to form a multi-stage fusion antimicrobial peptide fusion protein and expressed in Pichia cerevisiae.
The yield of antibacterial peptide fusion protein was maximized, and the fermentation yield reached 600mg/L, which improved antibacterial activity and functional synergy.
Smart Images

Figure CN120289658A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of antimicrobial peptides, and particularly to a preparation method and application of a multi-segment fused antimicrobial peptide fusion protein. Background Art
[0002] Antimicrobial peptides (AMPs) are a class of small polypeptides naturally produced by organisms, generally composed of 12 - 50 amino acids and with a molecular weight less than 10 kDa, having broad-spectrum anti-pathogenic microorganism activities. They widely exist in microorganisms, plants, insects, amphibians, mammals and humans, and are the core components of the innate immune system of organisms.
[0003] In recent years, antibiotics have been widely used in human production and life, leading to the emergence of super drug-resistant bacteria and bringing many potential safety hazards. It is urgent to find substitutes for traditional antibiotics. Antimicrobial peptides are positively charged small polypeptides involved in the immune response of organisms, widely existing in animals and plants, having broad-spectrum antibacterial activities and being not easy to produce drug resistance. Antimicrobial peptides have great application potential in aspects such as feed additives and food antibacterial agents. Compared with antibiotics, antimicrobial peptides have stronger bactericidal activities, different bactericidal mechanisms, and also solve the problem of drug resistance caused by the abuse of antibiotics, so they have become a research hotspot.
[0004] Bovine lactoferrin active peptides have gradually come into the public view due to their good antibacterial activities, and have been proven to have obvious inhibitory effects on super drug-resistant bacteria. The reported bovine lactoferrin active peptides mainly include lactoferricin B (LFcinB, amino acids at positions 17 - 41 in the N-terminal lobe of bovine lactoferrin), small peptide in the N-terminal lobe of bovine lactoferrin (LFcin, amino acids at positions 265 - 284 in the N-terminal lobe of bovine lactoferrin), and derivative peptide in the N-terminal lobe of bovine lactoferrin (Lf, amino acids at positions 1 - 11 in the N-terminal lobe of bovine lactoferrin). Among them, LFcinB has various biological activities such as broad-spectrum antibacterial, antiviral, antitumor, immunomodulatory and antioxidant activities, can effectively inhibit the growth of bacteria and viruses, enhance the body's immunity and scavenge free radicals. LFcin exhibits antibacterial, immunomodulatory and antiviral functions, plays a role by disrupting the bacterial cell membrane and inhibiting virus replication, and simultaneously regulates the immune system. Lf is involved in the binding and transport of iron and has a certain effect on immunomodulation. The above three segments of bovine lactoferrin active peptides each have unique contributions in maintaining the health of the body and defending against pathogens.
[0005] However, at present, the artificial synthesis yield of the fusion polypeptide containing the above three segments of bovine lactoferrin active peptides is relatively low, making the antibacterial application of protein products simultaneously possessing the above three segments of bovine lactoferrin active peptides limited. Summary of the Invention
[0006] The yield of the fusion peptide containing three segments of bovine lactoferrin active peptides, namely LFcinB, LFcin, and Lf, is low. To solve this problem, the present invention provides a method for preparing a multi-segment fused antibacterial peptide fusion protein and its application.
[0007] The specific technical solution of the present invention is as follows: In the first aspect, the present invention provides a multi-segment fused antibacterial peptide fusion protein, which from the N-terminus to the C-terminus includes: an OST signal peptide, collagen, a first acid cleavage site, bovine lactoferrin peptide LFcinB, a second acid cleavage site, bovine lactoferrin N-lobe small peptide LFcin, a third acid cleavage site, and bovine lactoferrin N-lobe-derived peptide Lf, which are connected in sequence.
[0008] Bovine lactoferrin peptide LFcinB, bovine lactoferrin N-lobe small peptide LFcin, and bovine lactoferrin N-lobe-derived peptide Lf have been studied due to their good antibacterial activities. However, in the prior art, the artificial synthesis yield of the fusion polypeptide containing the above three segments of bovine lactoferrin active peptides is relatively low.
[0009] The present invention introduces an OST signal peptide and collagen, and optimizes the connection order of the OST signal peptide, collagen, bovine lactoferrin peptide LFcinB, bovine lactoferrin N-lobe small peptide LFcin, and bovine lactoferrin N-lobe-derived peptide Lf to obtain an antibacterial peptide fusion protein, which achieves the best biological activity and functional synergy and maximizes the yield.
[0010] Preferably, the amino acid sequence of the OST signal peptide is as shown in SEQ ID No.8; the amino acid sequence of the collagen is as shown in SEQ ID No.9; the amino acid sequence of the bovine lactoferrin peptide LFcinB is as shown in SEQ ID No.10; the amino acid sequence of the bovine lactoferrin N-lobe small peptide LFcin is as shown in SEQ ID No.11; the amino acid sequence of the bovine lactoferrin N-lobe-derived peptide Lf is as shown in SEQ ID No.12.
[0011] In the antibacterial peptide fusion protein of the present invention, acid cleavage sites are also introduced respectively before the bovine lactoferrin N-lobe small peptide LFcin and the bovine lactoferrin N-lobe-derived peptide Lf, which are used to release the antibacterial peptide in the form of small molecules to exert antibacterial activity in the bacterial infection environment, so that the antibacterial activity of the antibacterial peptide fusion protein is higher.
[0012] Therefore, preferably, the antibacterial peptide fusion protein from the N-terminus to the C-terminus includes: an OST signal peptide, collagen, a first acid cleavage site, bovine lactoferrin peptide LFcinB, a second acid cleavage site, bovine lactoferrin N-lobe small peptide LFcin, a third acid cleavage site, and bovine lactoferrin N-lobe-derived peptide Lf, which are connected in sequence.
[0013] More preferably, the amino acid sequences of the first acid cleavage site, the second acid cleavage site, and the third acid cleavage site are as shown in SEQ ID No. 13.
[0014] Preferably, the amino acid sequence of the multi-segment fused antimicrobial peptide fusion protein is as shown in SEQ ID No. 14.
[0015] Based on the above antimicrobial peptide fusion protein, the present invention also provides a coding gene for the antimicrobial peptide fusion protein.
[0016] Based on the above coding gene, the present invention also provides a recombinant vector for expressing the antimicrobial peptide fusion protein.
[0017] Based on the above recombinant vector, the present invention also provides a cell for expressing the antimicrobial peptide fusion protein.
[0018] Preferably, the cell is Pichia pastoris.
[0019] In a second aspect, the present invention also provides a method for preparing a multi-segment fused antimicrobial peptide fusion protein, comprising the following steps: connecting the OST signal peptide, collagen, the first acid cleavage site, bovine lactoferrin peptide LFcinB, the second acid cleavage site, bovine lactoferrin N-lobe peptide LFcin, the third acid cleavage site, and bovine lactoferrin N-lobe-derived peptide Lf to the pPIC9K plasmid in sequence to obtain the recombinant plasmid pPIC9K-OST-Col-As-LfcinB-As-Lfcin-As-Lf, and then electrotransforming the recombinant plasmid pPIC9K-OST-Col-As-LfcinB-As-Lfcin-As-Lf into Pichia pastoris GS115 for fermentation expression, thereby expressing the antimicrobial peptide fusion protein.
[0020] Among them, the nucleotide sequence of the OST signal peptide is as shown in SEQ ID No. 1; the nucleotide of the collagen is as shown in SEQ ID No. 2; the nucleotide of the bovine lactoferrin peptide LFcinB is as shown in SEQ ID No. 3; the nucleotide of the bovine lactoferrin N-lobe peptide LFcin is as shown in SEQ ID No. 4; the nucleotide sequence of the bovine lactoferrin N-lobe-derived peptide Lf is as shown in SEQ ID No. 5; the nucleotide sequences of the first acid cleavage site, the second acid cleavage site, and the third acid cleavage site are as shown in SEQ ID No. 6.
[0021] Preferably, after sequentially linking the OST signal peptide, collagen, the first acid cleavage site, bovine lactoferrin peptide LFcinB, the second acid cleavage site, bovine lactoferrin N-terminal peptide LFcin, the third acid cleavage site and bovine lactoferrin N-terminal-derived peptide Lf to the pPIC9K plasmid, the resulting recombinant plasmid contains the nucleotide sequence shown in SEQ ID No. 7. The nucleotide sequence shown in SEQ ID No. 7 is the coding gene of the above-mentioned multi-segment fusion antibacterial peptide fusion protein.
[0022] In a third aspect, the present invention also provides the application of the above-mentioned antibacterial peptide fusion protein in the preparation of antibacterial agents.
[0023] In the prior art, bovine lactoferrin peptide LFcinB, bovine lactoferrin N-terminal peptide LFcin and bovine lactoferrin N-terminal-derived peptide Lf have been studied due to their good antibacterial activities. The present invention integrates their respective unique contributions in defending against pathogens by fusing these 3 antibacterial polypeptides. Therefore, the antibacterial peptide containing these 3 antibacterial polypeptides obtained in the present invention has an application prospect in the preparation of antibacterial agents.
[0024] In a fourth aspect, the present invention also provides the application of the above-mentioned antibacterial peptide fusion protein in the preparation of food bacteriostatic agents.
[0025] Compared with the prior art, the present invention has the following technical effects: By introducing the OST signal peptide and collagen and optimizing the linking order of the OST signal peptide, collagen, bovine lactoferrin peptide LFcinB, bovine lactoferrin N-terminal peptide LFcin and bovine lactoferrin N-terminal-derived peptide Lf, the present invention obtains an antibacterial peptide fusion protein, which can maximize the yield of the fusion peptide containing the three bovine lactoferrin active peptides LFcinB, LFcin and Lf at the same time. It has been experimentally verified that the fermentation yield of the fusion protein including the OST signal peptide, collagen, bovine lactoferrin peptide LFcinB, bovine lactoferrin N-terminal peptide LFcin and bovine lactoferrin N-terminal-derived peptide Lf sequentially linked from the N-terminus to the C-terminus can reach 600 mg / L. Description of the Drawings
[0026] Figure 1 SDS-PAGE analysis chart of the expression of the antibacterial peptide fusion protein according to the present invention, where lane 1 refers to the shake flask sample of the fusion protein, and lane 2 is the control Pichia pastoris GS115 strain containing the empty plasmid. Detailed Embodiments
[0027] The present invention will be further described below in conjunction with embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only a part of the embodiments of the present invention, rather than all of the embodiments. Therefore, all other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.
[0028] In the prior art, the yield of the fusion peptide simultaneously containing the three bovine lactoferrin active peptides of LFcinB, LFcin, and Lf is low. To solve this problem, the embodiments of the present invention provide a preparation method and application of a multi-segment fusion antibacterial peptide fusion protein.
[0029] A multi-segment fusion antibacterial peptide fusion protein provided by the present invention includes, from the N-terminus to the C-terminus: an OST signal peptide, collagen, a first acid cleavage site, bovine lactoferrin peptide LFcinB, a second acid cleavage site, bovine lactoferrin N-lobe peptide LFcin, a third acid cleavage site, and bovine lactoferrin N-lobe-derived peptide Lf, which are connected in sequence.
[0030] Specifically, the amino acid sequence of the multi-segment fusion antibacterial peptide fusion protein is as shown in SEQ ID No.14. Among them, the amino acid sequence of the OST signal peptide is as shown in SEQ ID No.8; the amino acid sequence of collagen is as shown in SEQ ID No.9; the amino acid sequence of bovine lactoferrin peptide LFcinB is as shown in SEQ ID No.10; the amino acid sequence of bovine lactoferrin N-lobe peptide LFcin is as shown in SEQ ID No.11; the amino acid sequence of bovine lactoferrin N-lobe-derived peptide Lf is as shown in SEQ ID No.12; the amino acid sequences of the first, second, and third acid cleavage sites are as shown in SEQ ID No.13.
[0031] In one embodiment, the coding gene of the above multi-segment fusion antibacterial peptide fusion protein is as shown in SEQ ID No.7. Among them, the nucleotide sequence of the OST signal peptide is as shown in SEQ ID No.1; the nucleotide of the collagen is as shown in SEQ ID No.2; the nucleotide of the bovine lactoferrin peptide LFcinB is as shown in SEQ ID No.3; the nucleotide of the bovine lactoferrin N-lobe peptide LFcin is as shown in SEQ ID No.4; the nucleotide sequence of the bovine lactoferrin N-lobe-derived peptide Lf is as shown in SEQ ID No.5; the nucleotide sequences of the first, second, and third acid cleavage sites are as shown in SEQ ID No.6.
[0032] In the embodiments of the present invention, the Pichia pastoris GS115 strain and the expression vector pPIC9K used were both purchased from Invitrogen Corporation, USA; the formulations of the media used are as follows: 1. LB medium Tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L (solid medium contains 2% agar) 2. YPD medium: Yeast extract 10 g / L, glucose 20 g / L, tryptone 20 g / L (solid medium contains 2% agar) 3. MD medium Glucose 20 g / L, ammonium sulfate 10 g / L, yeast nitrogen base without amino acids 3.4 g / L (solid medium contains 2% agar).
[0033] 4. BMG medium Dipotassium hydrogen phosphate 3 g / L, potassium dihydrogen phosphate 11.8 g / L, yeast nitrogen base without amino acids 3.4 g / L, ammonium sulfate 10 g / L, glycerol 10 g / L, autoclaved at 115 °C for 30 min. After cooling, add 2 ml of biotin in a laminar flow hood.
[0034] 5. BMM medium Dipotassium hydrogen phosphate 3 g / L, potassium dihydrogen phosphate 11.8 g / L, yeast nitrogen base without amino acids 3.4 g / L, ammonium sulfate 10 g / L, glycerol 10 g / L, autoclaved at 115 °C for 30 min. After cooling, add 2 mL of biotin and 1% methanol in a laminar flow hood.
[0035] In the embodiments of the present invention, the primer information involved is shown in Table 1.
[0036] Table 1 Primer Name Primer Sequence LfcinB-F CACCATCATCACCACCATTAATACGT LfcinB-R AAACGCGCGGCGCAC Lfcin-F GACCCTGAGTGGGATCTGATTTGGAAACTGCT Lfcin-R GCGGCTTTTGTTTTTGCCA LF-F CACCATCATCACCACCATTAATACGT LF-R GCGGCTTTTGTTTTTGCCA Lf-F GACCCTGAGTGGGCGCCGCGCAAAAAC Lf-R AATGGTGCACCAGCGCA pLf-F TTTAAATGCCGCCGCTGGCA pLf-R AAATGGTGCACCAGCGC Col-F GGAGCTGCTGGTGAGAGAG Col-R CCACTCAGGGTCGCCTGGACCACCTCTTTCACCGTT Example 1 Provide a multi-segment fused antimicrobial peptide fusion protein, the amino acid sequence of which is shown in SEQ ID No. 14. The preparation method is as follows: The nucleotide sequence of the OST signal peptide synthesized by total gene synthesis is shown in SEQ ID No.1. A plasmid fragment without the α-Factor signal peptide was obtained from the pPIC9K plasmid by inverse PCR, and this plasmid fragment was ligated with the OST signal peptide by one-step cloning to obtain the pPIC9K-OST plasmid in which the original α-Factor signal peptide in the pPIC9K plasmid was replaced by the OST signal peptide. The collagen sequence (Col), bovine lactoferricin peptide LFcinB, bovine lactoferrin N-terminal peptide LFcin, and bovine lactoferrin N-terminal derivative peptide Lf were synthesized by total gene synthesis. Among them, the nucleotide of the collagen sequence is shown in SEQ ID No.2, the nucleotide of bovine lactoferricin peptide LFcinB is shown in SEQ ID No.3, the nucleotide of bovine lactoferrin N-terminal peptide LFcin is shown in SEQ ID No.4, and the nucleotide sequence of bovine lactoferrin N-terminal derivative peptide Lf is shown in SEQ ID No.5. By double digestion with EcoR I and Not I, Col, LFcinB, LFcin, and Lf were respectively ligated to the multiple cloning sites of the pPIC9K-OST plasmid to obtain the pPIC9K-OST-Col plasmid, pPIC9K-OST-LfcinB plasmid, pPIC9K-OST-Lfcin plasmid, and pPIC9K-OST-Lf plasmid. The acid cleavage site with the nucleotide sequence shown in SEQ ID No.13 was subsequently introduced into the pPIC9K vector by primer design. The total gene synthesis was completed by Nanjing Genscript Biotechnology Co., Ltd.
[0037] Using the pPIC9K-OST-LfcinB plasmid prepared in step (1) as a template, with primers LfcinB-F and LfcinB-R, the pPIC9K-OST-LfcinB vector fragment was amplified by PCR; using the pPIC9K-OST-Lfcin plasmid prepared in step (1) as a template, with Lfcin-F and Lfcin-R, the Lfcin fragment was amplified by PCR primers. Among them, the nucleotide sequence of the acid cleavage site (As): GACCCTGAGTGG was included in the Lfcin-F sequence. The obtained pPIC9K-LfcinB vector fragment and Lfcin fragment were seamlessly ligated by one-step cloning. The recombinant product was transferred into Escherichia coli DH5α competent cells, spread on an LB plate containing ampicillin and kanamycin, cultured overnight for 12 hours, and positive transformants were picked for sequencing verification to obtain a strain containing the pPIC9K-LfcinB-Lfcin recombinant plasmid, and the plasmid was extracted to obtain the pPIC9K-OST-LfcinB-As-Lfcin recombinant plasmid.
[0038] (3) Using the pPIC9K-OST-LfcinB-As-Lfcin recombinant plasmid prepared in step (2) as a template, and using LF-F and LF-R primers, the pPIC9K-OST-LfcinB-As-Lfcin vector fragment was amplified by PCR; using the pPIC9K-OST-Lf plasmid prepared in step (1) as a template, and using Lf-F and Lf-R primers, the Lf fragment was amplified. Among them, the nucleotide sequence containing the acid cleavage site (As) in the Lf-F sequence is: GACCCTGAGTGG. The obtained pPIC9K-OST-LfcinB-As-Lfcin vector fragment and Lf fragment were seamlessly ligated using a one-step cloning kit. After the obtained product was transferred into Escherichia coli DH5α competent cells, it was spread on an LB plate containing ampicillin and kanamycin and cultured overnight. Positive transformants were picked for sequencing verification to obtain a strain containing the recombinant plasmid with the coding gene of the fusion protein, and the plasmid was extracted to obtain pPIC9K-OST-LfcinB-As-Lfcin-As-Lf.
[0039] (4) Using the pPIC9K-OST-LfcinB-As-Lfcin-As-Lf recombinant plasmid prepared in step (3) as a template, and using pLf-F and pLf-R primers, the pPIC9K-OST-LfcinB-As-Lfcin-As-Lf vector fragment was amplified by PCR; using the pPIC9K-OST-Col plasmid prepared in step (1) as a template, and using Col-F and Col-R primers, the Col fragment was amplified. The nucleotide sequence containing the acid cleavage site (As) in the Col-R sequence is: CCACTCAGGGTC. The obtained pPIC9K-OST-LfcinB-As-Lfcin-As-Lf vector fragment and Col fragment were seamlessly ligated using a one-step cloning kit. After the obtained product was transferred into Escherichia coli DH5α competent cells, it was spread on an LB plate containing ampicillin and kanamycin and cultured overnight. Positive transformants were picked for sequencing verification to obtain a strain containing the recombinant plasmid with the coding gene of the target fusion protein, and the plasmid was extracted to obtain pPIC9K-OST-Col-As-LfcinB-As-Lfcin-As-Lf.
[0040] In steps (1) to (4), the PCR amplification system is shown in Table 2.
[0041] Table 2 Reagent Usage Amount Primer F 1 μL Primer R 1 μL Template DNA 1 μL High-Fidelity Enzyme 25 μL <![CDATA[dd H2O]]> Make up to 50 μL In steps (1) to (4), the PCR product digestion system is as shown in Table 3 below.
[0042] Table 3 Digestion system Reagent Usage Amount PCR Master Mix 50μL DpnⅠ 1μL In steps (1) to (4), the reaction system for the recombination reaction is shown in Table 4 below.
[0043] Table 4 Reaction system for the recombination reaction Reagent Usage Amount Recombinase 1μL Buffer 2μL Purified Product of Vector Fragment 1.71μL Purified Product of Gene Fragment 1.2μL Sterile Water 14.09μL (5) Digest the expression vector pPIC9K-OST-Col-As-LfcinB-As-Lfcin-As-Lf with the restriction endonuclease SacⅠ at 37 °C for 30 min to linearize it. The reaction system is shown in Table 5 below. Then use 1% agarose gel electrophoresis to detect whether it is completely digested. After complete digestion, proceed to the next experiment.
[0044] Table 5 Reaction system Reagent Usage Amount Plasmid pPIC9K-Lfcin-LfcinB-ElT 1μg 10×buffer 2μL SacⅠ 1μL Sterilized Water Make up to 20μL Electroporate the linearized plasmid pPIC9K-OST-Col-As-LfcinB-As-Lfcin-As-Lf into the competent cells of Pichia pastoris GS115, pick positive transformants and verify them. Store the correct transformant strain in a -80 °C refrigerator, denoted as Pichia pastoris engineering strain GS115-OST-Col-As-LfcinB-As-Lfcin-As-Lf.
[0045] (6) Induced expression of recombinant yeast Inoculate the Pichia pastoris engineering strain GS115-OST-Col-As-LfcinB-As-Lfcin-As-Lf stored at -80 °C into BMG medium at an inoculation amount of 5% (volume ratio), culture at 30 °C and 200 rpm for 12 - 16 h until OD 600 reaches 2 - 6. Centrifuge at 4500 rpm for 5 min at room temperature, collect the cells, resuspend the cells with BMM medium until OD600 is about 1, transfer to BMM medium, seal with gauze, culture on a shaker at 30 °C and 220 rpm for three days. During this period, add methanol to the BMM medium every 24 h to a final concentration of 1%. Take 1 mL of the bacterial liquid sample every 24 h, centrifuge at 12000 rpm for 2 min at room temperature, collect the supernatant for SDS-PAGE electrophoresis detection.
[0046] After culturing on a shaker at 30 °C and 220 rpm for three days, quantitatively determine the expression level of the antimicrobial peptide fusion protein in the collected supernatant through a BCA kit (purchased from Shanghai Sangon Biotech Co., Ltd.). The specific operation steps refer to the BCA kit instruction manual. The expression level of the recombinant Pichia pastoris pPIC9K-OST-Col-LfcinB-As-Lfcin-As-Lf fusion protein is measured to be 600 mg / L.
[0047] Comparative Example 1 Provide a multi-segment fusion antibacterial peptide fusion protein, the only difference from Example 1 is that: the OST signal peptide is replaced with the MSB signal peptide whose nucleotide sequence is as shown in SEQ ID No. 15. The preparation method refers to Example 1.
[0048] The expression level of the fusion protein in this comparative example is 281 mg / L.
[0049] Comparative Example 2 Provide a multi-segment fusion antibacterial peptide fusion protein, the only difference from Example 1 is that: the OST signal peptide is replaced with the ADV signal peptide whose nucleotide sequence is as shown in SEQ ID No. 16. The preparation method refers to Example 1.
[0050] The expression level of the fusion protein in this comparative example is 317 mg / L.
[0051] Comparative Example 3 Provide a multi-segment fusion antibacterial peptide fusion protein, the only difference from Example 1 is that: the collagen sequence is replaced with the collagen whose nucleotide sequence is as shown in SEQ ID No. 17. The preparation method refers to Example 1.
[0052] The expression level of the fusion protein in this comparative example is 187 mg / L.
[0053] Comparative Example 4 Provide a multi-segment fusion antibacterial peptide fusion protein, the only difference from Example 1 is that: the collagen sequence is replaced with the collagen whose nucleotide sequence is as shown in SEQ ID No. 18. The preparation method refers to Example 1.
[0054] The expression level of the fusion protein in this comparative example is 295 mg / L.
[0055] Comparative Example 5 Provide a multi-segment fusion antibacterial peptide fusion protein, the only difference from Example 1 is that: the collagen sequence is replaced with the collagen whose nucleotide sequence is as shown in SEQ ID No. 19. The preparation method refers to Example 1.
[0056] The expression level of the fusion protein in this comparative example is 381 mg / L.
[0057] Comparative Example 6 Provide a multi-segment fusion antibacterial peptide fusion protein, the only difference from Example 1 is that: the connection order of OST, Col, As, LfcinB, As, Lfcin, As, Lf is OST-Col-As-Lfcin-As-LfcinB-As-Lf. The preparation method refers to Example 1.
[0058] The expression level of the fusion protein in this comparative example is 215 mg / L.
[0059] Comparative Example 7 Provide a multi-segment fusion antibacterial peptide fusion protein, the only difference from Example 1 being that the connection order of OST, Col, As, LfcinB, As, Lfcin, As, and Lf is OST-Col-As-Lf-As-LfcinB-As-Lfcin. The preparation method refers to Example 1.
[0060] The expression level of the fusion protein in this comparative example was 237 mg / L.
[0061] From the comparison between Example 1 and Comparative Examples 1 to 7, it can be seen that only when the amino acid sequence of the OST signal peptide is as shown in SEQ ID No. 8, the amino acid sequence of collagen is as shown in SEQ ID No. 9, and the connection order of the antibacterial peptide fusion protein from the N-terminus to the C-terminus is the OST signal peptide, collagen, the first acid cleavage site, bovine lactoferricin B (LFcinB), the second acid cleavage site, bovine lactoferrin N-terminal small peptide (LFcin), the third acid cleavage site, and bovine lactoferrin N-terminal derivative peptide (Lf), the highest fermentation expression level of the obtained antibacterial peptide fusion protein is 600 mg / L.
[0062] The raw materials and equipment used in the present invention are, unless otherwise specified, common raw materials and equipment in the art; the methods used in the present invention are, unless otherwise specified, conventional methods in the art.
[0063] The above are only preferred embodiments of the present invention and do not impose any limitations on the present invention. Any simple modifications, changes, and equivalent transformations made to the above embodiments based on the technical essence of the present invention still fall within the protection scope of the technical solutions of the present invention.
Claims
1. A multi-segment fusion antibacterial peptide fusion protein, characterized in that: From the N-terminus to the C-terminus, it includes: an OST signal peptide, collagen, bovine lactoferricin B (LFcinB), bovine lactoferrin N-lobe peptide LFcin, and bovine lactoferrin N-lobe-derived peptide Lf, which are connected in sequence.
2. The multi-segment fusion antibacterial peptide fusion protein according to claim 1, wherein: The amino acid sequence of the OST signal peptide is as shown in SEQ ID No.8; the amino acid sequence of the collagen is as shown in SEQ ID No.9; the amino acid sequence of the bovine lactoferricin B (LFcinB) is as shown in SEQ ID No.10; the amino acid sequence of the bovine lactoferrin N-lobe peptide LFcin is as shown in SEQ ID No.11; the bovine lactoferrin N-lobe-derived peptide Lf is as shown in SEQ ID No.
12.
3. The multi-segment fusion antibacterial peptide fusion protein according to claim 1 or 2, characterized in that: From the N-terminus to the C-terminus, it includes: an OST signal peptide, collagen, a first acid cleavage site, bovine lactoferricin B (LFcinB), a second acid cleavage site, bovine lactoferrin N-lobe peptide LFcin, a third acid cleavage site, and bovine lactoferrin N-lobe-derived peptide Lf, which are connected in sequence.
4. The multi-segment fused antibacterial peptide fusion protein according to claim 1, wherein: The amino acid sequence is as shown in SEQ ID No.
14.
5. The coding gene of the antimicrobial peptide fusion protein according to any one of claims 1 to 4.
6. A recombinant vector containing the coding gene according to claim 5.
7. A cell containing the recombinant vector according to claim 6.
8. The cell according to claim 7, characterized in that: The cell is Pichia pastoris.
9. A method for preparing a multi-segment fusion antibacterial peptide fusion protein, characterized in that: It includes the following steps: Connect the OST signal peptide, collagen, the first acid cleavage site, bovine lactoferricin B (LFcinB), the second acid cleavage site, bovine lactoferrin N-lobe peptide LFcin, the third acid cleavage site, and bovine lactoferrin N-lobe-derived peptide Lf to the pPIC9K plasmid in sequence to obtain the recombinant plasmid pPIC9K-OST-Col-As-LfcinB-As-Lfcin-As-Lf, and then electrotransform the recombinant plasmid pPIC9K-OST-Col-As-LfcinB-As-Lfcin-As-Lf into Pichia pastoris GS115 for fermentation expression, so as to express the antimicrobial peptide fusion protein.
10. The application of the antimicrobial peptide fusion protein according to any one of claims 1 to 4 in the preparation of an antibacterial agent.
Citation Information
Cited By
Product, system and method of cell cultivation
US12668774B2
Culture media based on protein hydrolysate and a process for preparing thereof
US12686847B2