Candida auricula B9J08001173 gene knockout strain, preparation method thereof and effect of Candida auricula B9J08001173 gene knockout strain in drug resistance research

Abstract

The invention relates to a Candida auricula B9J08001173 gene knockout strain, a preparation method thereof and an effect of the Candida auricula B9J08001173 gene knockout strain in drug resistance research. The Candida auris B9J08001173 gene knockout strain is preserved in the China General Microbiological Culture Collection Center on February 19, 2025, and the preservation number of the Candida auris B9J08001173 gene knockout strain is CGMCC (China General Microbiological Culture Collection Center) NO.33591. The Candida auris B9J08001173 gene knockout strain disclosed by the invention is a Candida The Candida auricula B9J08001173 gene knockout strain CF1 (KO1173) is constructed for the first time at home and abroad, is an effective model for researching the function of the B9J08001173 gene and the action mechanism of the B9J08001173 gene in the drug resistance of the Candida auricula, can be used for researching the mechanism related to the drug resistance of fluconazole, and has great significance in research and development of related drugs and clinical research and medication guidance.

Description

Technical Field

[0001] The invention relates to a Candida auris B9J08_001173 gene knockout strain, a preparation method thereof and its role in drug resistance research. Background Art

[0002] Candida auris was first reported by Japan in 2009 (Satoh, K.; Makimura, K.; Hasumi, Y.; Nishiyama, Y.; Uchida, K.; Yamaguchi, H. Candida auris sp.nov., a novel ascomycetous yeast isolated from the external ear canal of an inpatient in a Japanese hospital. Microbiol. Immunol. 2009, 53, 41-44, strain number DSM21092=CBS10913=JCM15448, clade II, East Asian branch), and has strong survivability, can survive for a long time, and is very likely to cause nosocomial explosive infection. Compared with antibiotics, the variety of antifungal drugs is originally very limited, and the safe and effective drugs that can be used for systemic Candida infections are even fewer. It has been reported in many countries that clinical isolates of Candida auris are resistant to multiple antifungal drugs, and the resistant varieties are not limited to triazole drugs. Candida auris can be resistant to azole antifungal drugs such as fluconazole, voriconazole, polyenes (such as amphotericin B), echinocandins (such as caspofungin) and other antifungal drugs, and there is a phenomenon of multidrug resistance, which has never been seen in other Candida species, similar to super bacteria such as Staphylococcus aureus (MRSA) that are resistant to multiple antibiotics. Therefore, some people call it a "super pathogen" (Sarma, S.; Upadhyay, S. Current perspective on emergence, diagnosis and drug resistance in Candida auris. Infect Drug Resist 2017, 10, 155-165).

[0003] Previously, the applicant used the Candida auris Japanese isolate CBS10913 (marked as CF1 in this patent) as the starting strain to induce a series of Candida auris fluconazole-resistant models (such as Chinese patents CN115044478 B and CN114933972 B). The aforementioned resistant models can well simulate the in vitro drug-resistant evolution process of Candida auris. When conducting research, the applicant found that to deeply study the drug-resistant mechanism of Candida auris, it is also necessary to study the specific target genes that regulate Candida auris drug resistance. However, the above models cannot locate the specific target genes involved. Therefore, further research needs to be carried out in constructing a Candida auris gene knockout strain model to provide data support and experimental evidence for clinical drug use.

[0004] In 2018, the paper "Hog1 Regulates Stress Tolerance and Virulence in the Emerging Fungal Pathogen Candida auris" by Alison M Day et al. from Newcastle University was published in the journal *Msphere* (2018, 3(5)). Based on the principle of homologous recombination, gene knockout was performed in Candida auris, and the Candida auris hog1Δ mutant was constructed using the Clox system from Candida albicans. However, there are problems such as cumbersome steps in synthesizing the knockout fragment and low positive rate of transformants.

[0005] The Chinese patent "A Method for Gene Knockout and Complementation of Candida auris Based on the Principle of Homologous Recombination" (202110637179.1) applied by Professor Chen Changbin et al. from Shanghai University discloses a method for constructing knockout and complementation of Candida auris using the PRS316 plasmid. The RIM101 gene (systematically named B9J08_003060) of Candida auris BJCA001 (the first Candida auris isolate in China) was knocked out. The lengths of the upstream and downstream homologous arms of the target gene are both about 1 kb, preferably 0.9 - 1.1 kb. Too short a length will reduce the number of gene knockout transformants obtained, and too long a length will increase the difficulty of constructing the recombinant plasmid. Summary of the Invention

[0006] The technical problem to be solved by the present invention is: the problem that the existing fluconazole-resistant model of Candida auris cannot locate the specific target gene. In view of the current situation that there is no relevant research on the Candida auris B9J08_001173 gene and the knockout of the B9J08_001173 gene at home and abroad, the present invention studies the role of the B9J08_001173 gene in the drug resistance process of Candida auris by means of gene knockout, and provides a Candida auris knockout strain lacking the B9J08_001173 gene, a preparation method thereof and an application thereof in drug resistance research.

[0007] The knockout strain of the Candida auris B9J08_001173 gene of the present invention, named CF1 (KO1173), was deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on February 19, 2025, and the deposit number is CGMCC NO. 33591.

[0008] Sequencing shows that the DNA nucleotide sequence of the knockout strain CF1 (KO1173) of the Candida auris B9J08_001173 gene of the present invention is as follows:

[0009] CTTCCAGTGTGACTTATCTGTATTGACTCTACTAGGCTGTAGATAAAGGGAATTGTCTATGCAGAGATATTCGCTAGGCTTCTTTAAAGCCGAGAGCAAACGATCCACAAAACATTTCATGTTGTTTTCGACTCCAACCCAAGAGAAAAGGCTTGCACCGCTTATAGACGCCATTCAAAAGAAAAACAAAAAAGTTACGTTTTTCTTGGGTGCTGGCATATCCACCTCCTGCGGTATACCAGACTTTAGAAGCCCAGAGACTGGCCTCTACTCCAATCTCGAGAAACTCAATCTCCCATACCCAGAGGCCGTGTTTGACATTGATTACTTCAGATCGAACCCCAAAGCTTTTTATACATTGTGTGATGAGCTTTACCCTGGCAAGTTTGTACCATCGAAGTTTCACTTTCTTGTCAGGCTTTTTCAGGATAACGACAAGTTGAAGAGGGTATACACTCAGAATATTGATACATTAGAGCGGATTGCGGGTGTTGACGAAAAGTATATCGTGGAGGCTCACGGCTCATTTGCTTCCAATCACTGCATCGACTGTCATGAGGAGGTGCCAAGCGACATATTAAAGAAGCAAATGGCAGATAAACATACCAATGAAGGAATCGGTACCGGGCCCCCCCTCGAGGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGATCCAATAATGATTGGTTTGATATTTTTGTCTAGTACCATCTGTACCATTACACTTAAATTATCTTTATATCTGTCTAACTCGACTGTCTGGATTTCATTGATGTAGTCGTATGCATCGTTAGTTCCAAAAAATATTGTCATCAATTTGATATTGGTTTCCGACTCTAAAATTTTTGGAAGAATTTGTCTAGCGTGCTCTG

[0010] The ITS1 / ITS4 fragment sequence of the knockout strain CF1 (KO1173) of the Candida auris B9J08_001173 gene described in the present invention is as follows:

[0011] TGCTTTTGATTTTGCTACAACTGCATTTGGATTTTAAACTAACCCAACGTTAAGTTCAACTAAACTATAAAGAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTATGACTTGCAGACGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTGGGGTATTCCCCAAGGCATGCCTGTTTGAGCGTGATGTCTTCTCACCAATCTTCGCGGTGGCGTTGCATTCACAAA ATTACAGCTTGCACGAAAAAAATCTACGCTTTTTTTTCGTTTTGTTGTCGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAACCCGGAGGAA

[0012] The NL1 / NL4 fragment sequence is as follows:

[0013] GGACCGCATGCCTCAGTACGGCGAGTGAGCGGCAAGAGCTCAACTTTGGAATCGCTCCGGCGA

[0014] GTTGTAGTCTGGAGGTGGCCACCACGAGGTGTTCTAGCAGCAGGCAAGTCCTTTGGAACAAGGCGC

[0015] CAGCGAGGGTGACAGCCCCGTACCTGCTTTTGCTAGTGCTTCCTGTGGCCCACCGACGAGTCGAGTT

[0016] GTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGA

[0017] TAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGTACGTGA

[0018] AATTGTTGAAAGGGAAGGGCTTGCACCCAGACACGGTTTCGGCCGGGCCAGCATCAAGTAGAACGG

[0019] GGTTAAAAGACCTGGGGAATGTAGCTACCTCTTGGTAGTGTTATAGCCCTTGGGTGATGACCCCTGT

[0020] TTTGCTTGAGGACAGCGGTCTCTAGGATGCTGGCGCAATGGTTGCAAGCCACCCGTCTAAACACAC

[0021] CGACAGCACCCA

[0022] The over - knockout strain CF1 (KO1173) of the Candida auris B9J08_001173 gene described in the present invention was obtained by the following method:

[0023] 1) Extract the genomic DNA of Candida auris

[0024] 2) When constructing two homologous arms, construct the upstream and downstream homologous arms respectively

[0025] Design primers containing restriction enzyme sites to amplify the upstream target fragment. First, double - digest the upstream target fragment and the plasmid pSFS2A / caSAT1, then ligate them into a recombinant plasmid. After confirming the upstream - recombinant plasmid is correct by PCR, restriction enzyme digestion, and sequencing, using the upstream - recombinant plasmid as a vector, design primers containing restriction enzyme sites to amplify the downstream target fragment from the recombinant cloning plasmid, construct the "upstream - pSFS2A / caSAT1 - downstream" recombinant plasmid, confirm it is correct by PCR, restriction enzyme digestion, or sequencing, introduce it into Escherichia coli for standby, and screen with chloramphenicol;

[0026] 3) After extracting the "upstream - pSFS2A / caSAT1 - downstream" recombinant plasmid, perform electrotransformation. Using the East Asian clade of Candida auris (CBS10913, CF1) as the parental strain, prepare electrocompetent cells of Candida auris. After single - digesting the recombinant plasmid to linearize it, mix the enzyme - digested product of the recombinant plasmid with the electrocompetent cells of Candida auris, add it to the electroporation cuvette for electrotransformation. After resuspending and centrifuging with sorbitol, culture it in YPD at 30 °C and 150 rpm for 4 h. Take 1 mL of the bacterial solution and spread it on the YPD solid plate, and culture it at 30 °C for about 5 - 7 days to harvest the transformants.

[0027] In step 3), the voltage for electrotransformation in the electroporation cuvette is 1500 V, and the composition of the YPD medium is 2% peptone, 1% yeast extract, 2% glucose, 2% agar, containing 200 μg / mL nourseothricin.

[0028] 4) Verify the transformants by PCR, restriction enzyme digestion, and sequencing, confirm that the target sequence is integrated into the genome of the parental strain of Candida auris, and complete the gene knockout process of Candida auris.

[0029] The knockout plasmid pSFS2A / caSAT1 used in the present invention was kindly donated by Professor Huang Guanghua and Young Associate Researcher Bing Jian of Fudan University. The method was based on the article "Rapid evolution of an adaptive multicellular morphology of Candida auris during systemic infection" published in Nature Communications [Nat Commun, 2024.15(1): p.2381]. The parent strain Candida auris East Asian branch (CBS10913, Japanese isolate, CF1) and the drug-resistant Candida auris CF6 were deposited in the Medical Fungus Branch of the Center for Pathogenic Microorganisms (Viruses) of the Chinese Academy of Medical Sciences (CAMS-CCPM-D).

[0030] After a series of tests by the applicant, it was determined that this strain of Candida auris had the B9J08_001173 gene knocked out, and could be used for research related to Candida auris fluconazole resistance:

[0031] 1. Sequencing detection of Candida auris B9J08_001173 gene knockout strain: The positive transformants screened out on the plate containing nourseothricin were sequenced, and it was found that the recombinant plasmid sequence was introduced into the positive transformants, and the integrity structure of the Candida auris B9J08_001173 gene was destroyed, thus obtaining the Candida auris B9J08_001173 gene knockout strain.

[0032] 2. Growth curve before and after drug treatment:

[0033] The Danish BioSense microbial growth dynamic monitoring system (oCelloScope TM ) Determine the growth curve of each strain before and after fluconazole treatment, analyze the data using the BCANormalized, SESANormalized or TANormalized algorithm provided by the software, and compare the effects of drug treatment on growth.

[0034] 3. Mass spectrometry identification of strains:

[0035] The strains involved in the present invention were cultured at a rate of 1 to 5 × 10 6 CFU·mL -1Inoculate at a certain concentration onto the slant of YPD solid medium, and grow colonies in an incubator at 28°C - 35°C for 24 - 72 hours. Pick colonies and smear them on the target plate. Add 1 μL of 70% formic acid and dry it in a biosafety cabinet with ventilation or dry it in a 50°C metal bath for 3 - 5 minutes. Then add 1 μL of matrix solution (a mixed solution of HCCA, acetonitrile, and trifluoroacetic acid), and after drying, load it onto the machine (AUTOF MS1000 mass spectrometer) for detection.

[0036] 4. Take pictures of the strains under a microscope for observation.

[0037] Regarding the problem that the existing fluconazole-resistant model of Candida auris cannot locate the specific target gene, there are no relevant studies on the Candida auris B9J08_001173 gene and the knockout of the B9J08_001173 gene at home and abroad. The present invention provides a Candida auris knockout strain of the B9J08_001173 gene, its preparation method, and its application in drug resistance research, with the following technological advancements:

[0038] 1. In the present invention, for the target gene B9J08_001173 of Candida auris [CBS10913 (CF1), a Japanese isolate], the length of the upstream homologous arm is 501 bp, and the length of the downstream homologous arm is 522 bp, with a high knockout efficiency.

[0039] 2. During the construction of the B9J08_001173 gene knockout, electroporation is used instead of chemical transfection to improve the transformation efficiency and reduce operations; sequencing is applied to each verification process to improve efficiency and reduce errors; the Danish BioSense microbial growth dynamic monitoring system (oCelloScope TM ) can be used to observe the growth of each strain, improve efficiency, reduce operation steps, and save labor. It solves the problem that the existing fluconazole-resistant model of Candida auris cannot locate the specific target gene.

[0040] 3. Comparing the receptor strain CF1 (sensitive strain) and the drug-resistant strain CF6, it is found that under the action of 8 μg / mL fluconazole, the growth of the Candida auris strain CF1 (KO1173) with the B9J08_001173 gene knockout is better than that of the fluconazole-sensitive strain CF1. This shows that under the action of this 8 μg / mL fluconazole, the Candida auris strain with the B9J08_001173 gene knockout can increase its tolerance to the drug for growth. The Candida auris knockout strain CF1 (KO1173) of the B9J08_001173 gene can be used to study the mechanism related to fluconazole resistance.

[0041] 4. This application is the first to construct the Candida auris B9J08_001173 gene knockout strain CF1 (KO1173) at home and abroad. It is an effective model for studying the function of the B9J08_001173 gene and the mechanism of action of the B9J08_001173 gene in Candida auris drug resistance. It can be used to study the mechanisms related to fluconazole resistance, which is of great significance for the research and development of related drugs and has important implications for clinical research and medication guidance. Brief Description of the Drawings

[0042] Figure 1 It is the double digestion map of the recombinant plasmid: 1 - recombinant plasmid, 2 - digested recombinant plasmid, M - Marker band.

[0043] Figure 2 It is the PCR map of the transformant. Figure 2 Among them, M - Marker band, 1 - recombinant transformant, 2 - recombinant transformant

[0044] Figure 3 is the microscopic morphology photos of each strain, among which:

[0045] Figure 3(1) is the microscopic morphology photo of the recipient strain CF1;

[0046] Figure 3(2) is the microscopic morphology photo of the drug - resistant strain CF6;

[0047] Figure 3(3) is the microscopic morphology photo of the Candida auris B9J08_001173 gene knockout strain CF1 (KO1173).

[0048] Figure 4 is the mass spectrum of each strain, among which:

[0049] Figure 4(1) is the mass spectrum of the recipient strain CF1;

[0050] Figure 4(2) is the mass spectrum of the drug - resistant strain CF6;

[0051] Figure 4(3) is the mass spectrum of the Candida auris B9J08_001173 gene knockout strain CF1 (KO1173).

[0052] Figure 5 is the growth curve graph of each strain before and after fluconazole treatment observed by the BioSense microbial growth dynamic monitoring system (TANormalized algorithm), among which:

[0053] As shown in Figure 5(1), in the 1640 medium without adding drugs, the fluconazole - sensitive strain CF1 is represented by A2 and A3 in the figure; the fluconazole - resistant strain CF6 is represented by B1 and B3 in the figure; the Candida auris B9J08_001173 gene knockout CF1 (KO1173) strain is represented by F1, F2, and F3 in the figure.

[0054] As shown in Figure 5(2), after treatment with 8 μg / mL fluconazole + 1640 medium, the fluconazole-sensitive strain CF1 is represented by A10, A11, and A12 in the figure; the fluconazole-resistant strain CF6 is represented by B10, B11, and B12 in the figure; the Candida auris B9J08_001173 gene knockout CF1 (KO1173) strain is represented by F10, F11, and F12 in the figure. Detailed implementation manners

[0055] 1. Preparation of a Candida auris over-knockout strain of the Candida auris B9J08_001173 gene

[0056] 1) Extraction of genomic DNA:

[0057] Take MP tubes, add 600 μl of FG1 to each tube for lysis, and pick 1×10 8Transfer the bacteria at a concentration of

[0058] 2) Preparation process of the recombinant plasmid:

[0059] ① Construct the recombinant plasmid "B9J08_001173 upstream sequence - pSFS2A / caSAT1"

[0060] Design the primer sequences for amplifying the B9J08_001173 upstream sequence:

[0061] UCF1173F: 5'-gccattcaggcATGTTTTTTTCGACTCCAACCC-3’

[0062] UCF1173R: 5'-ggtaccGATTCCTTCATTGGTATG-3'

[0063] Amplify the recombinant DNA sequence 1, namely "BglI - B9J08_001173 upstream sequence - KpnI", from the Candida auris genomic DNA. Double - digest the recombinant DNA sequence 1 "BglI - B9J08_001173 upstream sequence - KpnI" and the pSFS2A / caSAT1 plasmid respectively, and ligate the digested products to form the "B9J08_001173 upstream sequence - pSFS2A / caSAT1" recombinant plasmid. Verify by sequencing primer 1: CTCAACCCTATCTCGGTCTA. The following 778 - bp recombinant sequence is obtained, where 501 bp is the B9J08_001173 upstream sequence (underlined part), and the rest is part of the vector sequence.

[0064] TTTCGGCCTATTGGTTAAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCATTCGCCATTCAGGC ATGTTTTTTTCGACTCCAACCCAAGAGAAAAGGCTTGCACCGCTT ATAGACGCCATTCAAAAGAAAAACAAAAAAGTTACGTTTTTCTTGGGTGCTGGCATATCCACCTCCTGCGGTATAC CAGACTTTAGAAGCCCAGAGACTGGCCTCTACTCCAATCTCGAGAAACTCAATCTCCCATACCCAGAGGCCGTGTT TGACATTGATTACTTCAGATCGAACCCCAAAGCTTTTTATACATTGTGTGATGAGCTTTACCCTGGCAAGTTTGTA CCATCGAAGTTTCACTTTCTTGTCAGGCTTTTTCAGGATAACGACAAGTTGAAGAGGGTATACACTCAGAATATTG ATACATTAGAGCGGATTGCGGGTGTTGACGAAAAGTATATCGTGGAGGCTCACGGCTCATTTGCTTCCAATCACTG CATCGACTG TCATGAGGAGGTGCCAAGCGACATATTAAAGAAGCAAATGGCAGATAAACATACCAATGAAGGAAT C GGTACCGGGCCCCCCCTCGAGGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGATCCAATAATGATTGGTTTGATATTTTTGTCTAGTACCATCTGTACCATTACACTTAAATTATCTTTATATCTGTCTAACTCGACTGTCTGGATTTCATTGATGTAGTCGTATGCATCGTT

[0065] The above sequencing results indicate that the "B9J08_001173 upstream sequence - pSFS2A / caSAT1" recombinant plasmid has been constructed and is transformed into Escherichia coli TOP10 competent cells for standby.

[0066] ② Construct the "B9J08_001173 upstream sequence - pSFS2A / caSAT1 - B9J08_001173 downstream sequence" recombinant plasmid

[0067] Amplification primer sequences for the upstream sequence of Design B9J08_001173:

[0068] DCF1173F: 5'-gcggccgcCCTGATATTACATTCTTTGGCG-3’

[0069] DCF1173R: 5'-ccgcggtgTCAAAGCGACAATTTGCCG-3’

[0070] Amplify the recombinant DNA sequence 2, namely "NotI - B9J08_001173 downstream sequence - SacII", from the genomic DNA of Candida auris.

[0071] Double - digest the recombinant DNA sequence 2 "NotI - B9J08_001173 downstream sequence - SacII" and the recombinant plasmid "B9J08_001173 upstream sequence - pSFS2A / caSAT1" respectively, and ligate the digested products to form the recombinant plasmid "B9J08_001173 upstream sequence - pSFS2A / caSAT1 - B9J08_001173 downstream sequence". Verify the double - digestion of the recombinant plasmid NotI - SacII to obtain a target band of more than 500bp (see Figure 1 ).

[0072] Verify by sequencing with primer 2: attagataagggtggtaatt, and obtain the following 733bp recombinant sequence, where 522bp is the B9J08_001173 downstream sequence (underlined part), and the rest is part of the vector sequence.

[0073] GGAaGTTCCTATACTTTCTAGAGAATAGGAACTTCAGATCCACTAGTTCTAGAGCGGCCGC CCTGATA TTACATTCTTTGGCGAAGGGTTGCCAGAAAAATTTTTCTACCTGTGGCACGAGGACTCTGATGATGTGGAAGTAGCC ATCGTTGCTGGTACTTCTTTGACAGTCATGCCATTTTCAACTTTGCCGGCCGAATGCGGTAAAAAATGCTTACGTGT GTTGATAAATAAGGAAGTTGTTGGTGACTTTAAATATGCCAAGCGCAAATCAGACATAATCGTTCAGCTGGACTGTG ACGAAGCAGCAGGAGTAATTGCGGATATGCTCGGGTGGAGAGATATGCTTGACGATCTTTACGAAAAAGCCAAAGCT GAACTCAAAGAGCAAAAGACAGAGACAGCAGAAGATAAAGCCGAAGAGGTTGCCGCTGGCATCAAGGAAGCCGAGAA GCCATCAAAGGCAACAACAAAGGATGAAAATGAGGAGCCTACTAAAGAGGAACGTACCCATCCACAATCTAAAGAAG AAGACTTCAACGAAGAAACAATATCGAAAAAACTCGGCAAATTGTCGCTTTGA CACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCT

[0074] The above sequencing results indicate that the recombinant plasmid "B9J08_001173 upstream sequence - pSFS2A / caSAT1 - B9J08_001173 downstream sequence" has been successfully constructed and transformed into Escherichia coli TOP10 competent cells for standby.

[0075] 3) Introduce the recombinant vector into the host:

[0076] ① Preparation of Candida auris competent cells:

[0077] Inoculate Candida auris CF1 into 50 mL of YPD liquid medium (2% peptone, 1% yeast extract, 2% glucose), and culture overnight at 30 °C with 150 rpm until the OD value is about 0.8. Wash twice with 40 mL of ddw and then discard the supernatant. Add 8 mL of ddw, 1 mL of 10×TE (pH 8.0), and 1 mL of 1 M LiOAC, mix for 1 hour, add 250 μL of 1 M DTT, centrifuge, and then add 500 μL of 1 M sorbitol and keep it on ice for standby.

[0078] ② Electroporation:

[0079] Linearize the recombinant plasmid "B9J08_001173 upstream sequence - pSFS2A / caSAT1 - B9J08_001173 downstream sequence" by single - enzyme digestion. Take 10 μL of the recombinant plasmid digestion product and mix it with 60 μL of Candida auris competent cells, add it to the electroporation cuvette, perform electroporation at 1500 V, resuspend with 1 mL of 1 M sorbitol, centrifuge at 300 rpm for 2 min, add 1 mL of YPD, and culture at 30 °C with 150 rpm for 4 h. Take 200 μL of the bacterial solution and spread it on a YPD solid plate (2% peptone, 1% yeast extract, 2% glucose, 2% agar, containing 200 μg / mL nourseothricin), and culture at 30 °C for about 5 - 7 days to harvest the transformants.

[0080] ③ Detection

[0081] Use primer 3F: TGTCTCGTTTCATGTCCCAGT and primer 3R: CAGTGGCTACAACTCAGAGCA as PCR primers, pick the transformants for PCR detection. As Figure 2 shown, a target band of about 900 bp was detected.

[0082] Sequence the PCR product of the transformants with primer 3F: TGTCTCGTTTCATGTCCCAGT, and obtain the following 877 - bp recombinant sequence. Among them, 619 bp is the B9J08_001173 sequence (where the bold part is the genomic sequence upstream of the 118 - bp B9J08_001173 knockout sequence, and the underlined part is the 501 - bp upstream target knockout sequence of B9J08_001173), and the rest is part of the knockout vector sequence.

[0083]

[0084] The above sequencing results indicate that the recombinant plasmid sequence has been integrated into the genome of the recipient Candida auris cells, and the B9J08_001173 gene knockout strain CF1 (KO1173) has been successfully constructed.

[0085] 2. Observation of strain morphology:

[0086] Using the Candida auris parental strain CF1 and the drug-resistant strain CF6 as controls, the morphology of the B9J08_001173 gene knockout strain CF1 (KO1173) was observed under a 40× microscope, as shown in Figure 3.

[0087] Figure 3(1) is CF1, Figure 3(2) is CF6, and Figure 3(3) is the B9J08_001173 gene knockout Candida auris strain CF1 (KO1173).

[0088] 3. Mass spectrometry identification:

[0089] Using the Candida auris parental strain CF1 and the drug-resistant strain CF6 as controls, the B9J08_001173 gene knockout strain CF1 (KO1173) was identified by mass spectrometry.

[0090] Each strain was inoculated onto the slant of YPD solid medium at a concentration of 1×10 6 CFU·mL -1 The colonies grew out in a 28°C incubator for 48 h. The colonies were picked and smeared on the target plate, dried by adding 1 μL of 70% formic acid in a biosafety cabinet or dried in a 50°C metal bath for 5 min. After adding 1 μL of matrix solution (a mixture of HCCA, acetonitrile, and trifluoroacetic acid) and drying, the samples were detected on a machine (AUTOF MS1000 mass spectrometer). The identification results showed that Candida auris CF1, CF6, and the B9J08_001173 gene knockout strain were all Candida auris. At the same time, differences in the characteristic peaks of each strain were found, as shown in Figure 4 for details.

[0091] Figure 4(1) is CF1, Figure 4(2) is CF6, and Figure 4(3) is the B9J08_001173 gene knockout Candida auris strain CF1 (KO1173).

[0092] 4. Biosence dynamic growth:

[0093] The Danish BioSense microbial growth dynamic monitoring system (oCelloScope TM)Measure the growth curves of each strain before and after fluconazole treatment, compare the effects of drug treatment on growth, and observe differences in the growth of induced strains from the TANormalized analysis chart. See Figure 5 for details.

[0094] As shown in Figure 5(1), in the 1640 medium without drugs, each strain can grow normally. Among them, the fluconazole-sensitive strain CF1 of Candida auris is represented by A2 and A3 in the figure; the fluconazole-resistant strain CF6 of Candida auris is represented by B1 and B3 in the figure; the Candida auris B9J08_001173 gene knockout strain CF1 (KO1173) is represented by F1, F2, and F3 in the figure.

[0095] As shown in Figure 5(2), after treatment with 8 μg / mL fluconazole + 1640 medium, compared with the fluconazole-resistant strain CF6 of Candida auris, the growth of the Candida auris B9J08_001173 gene knockout strain CF1 (KO1173) is better than that of the fluconazole-sensitive strain CF1 of Candida auris, indicating that under the action of this 8 μg / mL fluconazole drug, the Candida auris B9J08_001173 gene knockout strain CF1 (KO1173) can increase its tolerance to drug growth. Among them, the fluconazole-sensitive strain CF1 of Candida auris is represented by A10, A11, and A12 in the figure; the fluconazole-resistant strain CF6 of Candida auris is represented by B10, B11, and B12 in the figure; the Candida auris B9J08_001173 gene knockout strain CF1 (KO1173) is represented by F10, F11, and F12 in the figure.

Claims

1. A knockout strain of Candida auris B9J08_001173 gene, the Candida auris B9J08_001173 gene knockout strain has been deposited with the China General Microbiological Culture Collection Center on February 19, 2025, and the deposit number is CGMCC NO. 33591.

2. The knockout strain of Candida auris B9J08_001173 gene according to claim 1, characterized in that Its DNA nucleotide sequence is as follows: CTTCCAGTGTGACTTATCTGTATTGACTCTACTAGGCTGTAGATAAAGGGAATTGTCTATGCAGAGATATTCGCTAGGCTTCTTTAAAGCCGAGAGCAAACGATCCACAAAACATTTCATGTTGTTTTCGACTCCAACCCAAGAGAAAAGGCTTGCACCGCTTATAGACGCCATTCAAAAGAAAAACAAAAAAGTTACGTTTTTCTTGGGTGCTGGCATATCCACCTCCTGCGGTATACCAGACTTTAGAAGCCCAGAGACTGGCCTCTACTCCAATCTCGAGAAACTCAATCTCCCATACCCAGAGGCCGTGTTTGACATTGATTACTTCAGATCGAACCCCAAAGCTTTTTATACATTGTGTGATGAGCTTTACCCTGGCAAGTTTGTACCATCGAAGTTTCACTTTCTTGTCAGGCTTTTTCAGGATAACGACAAGTTGAAGAGGGTATACACTCAGAATATTGATACATTAGAGCGGATTGCGGGTGTTGACGAAAAGTATATCGTGGAGGCTCACGGCTCATTTGCTTCCAATCACTGCATCGACTGTCATGAGGAGGTGCCAAGCGACATATTAAAGAAGCAAATGGCAGATAAACATACCAATGAAGGAATCGGTACCGGGCCCCCCCTCGAGGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGATCCAATAATGATTGGTTTGATATTTTTGTCTAGTACCATCTGTACCATTACACTTAAATTATCTTTATATCTGTCTAACTCGACTGTCTGGATTTCATTGATGTAGTCGTATGCATCGTTAGTTCCAAAAAATATTGTCATCAATTTGATATTGGTTTCCGACTCTAAAATTTTTGGAAGAATTTGTCTAGCGTGCTCTG。 3. The knockout strain of the Candida auris B9J08_001173 gene according to claim 2, characterized in that The sequence of its ITS1 / ITS4 fragment is as follows: TGCTTTTGATTTTGCTACAACTGCATTTGGATTTTAAACTAACCCAACGTTAAGTTCAACTAAACTATAAAGAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTATGACTTGCAGACGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTGGGGTATTCCCCAAGGCATGCCTGTTTGAGCGTGATGTCTTCTCACCAATCTTCGCGGTGGCGTTGCATTCACAAAATTACAGCTTGCACGAAAAAAATCTACGCTTTTTTTTCGTTTTGTTGTCGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAACCCGGAGGAA。 The sequence of its NL1 / NL4 fragment is as follows: GGACCGCATGCCTCAGTACGGCGAGTGAGCGGCAAGAGCTCAACTTTGGAATCGCTCCGGCGAGTTGTAGTCTGGAGGTGGCCACCACGAGGTGTTCTAGCAGCAGGCAAGTCCTTTGGAACAAGGCGCCAGCGAGGGTGACAGCCCCGTACCTGCTTTTGCTAGTGCTTCCTGTGGCCCACCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCACCCAGACACGGTTTCGGCCGGGCCAGCATCAAGTAGAACGGGGTTAAAAGACCTGGGGAATGTAGCTACCTCTTGGTAGTGTTATAGCCCTTGGGTGATGACCCCTGTTTTGCTTGAGGACAGCGGTCTCTAGGATGCTGGCGCAATGGTTGCAAGCCACCCGTCTAAACACACCGACAGCACCCA。 4. The preparation method of the Candida auris B9J08_001173 gene over-knockout strain according to any one of claims 1-3, characterized in that It includes the following steps: 1) Extract the genomic DNA of Candida auris 2) When constructing two homologous arms, construct the upstream and downstream homologous arms respectively Design primers containing restriction sites to amplify the upstream target fragment. First, double-digest the upstream target fragment and plasmid pSFS2A / caSAT1, then ligate them into a recombinant plasmid. After confirming the upstream-recombinant plasmid is correct by PCR, restriction digestion, and sequencing, use the upstream-recombinant plasmid as a vector to design primers containing restriction sites to amplify the downstream target fragment from the recombinant cloning plasmid, construct the "upstream-pSFS2A / caSAT1-downstream" recombinant plasmid, confirm it is correct by PCR, restriction digestion, or sequencing, introduce it into Escherichia coli for backup, and screen with chloramphenicol; 3) After extracting the "upstream-pSFS2A / caSAT1-downstream" recombinant plasmid, perform electroporation. Using Candida auris East Asian clade (CBS10913, CF1) as the parental strain, prepare Candida auris electrocompetent cells. After single-digesting and linearizing the recombinant plasmid, mix the enzyme-digested product of the recombinant plasmid with the Candida auris competent cells, add them to an electroporation cuvette for electroporation. After resuspending and centrifuging with sorbitol, culture at 30 °C and 150 rpm for 4 h in YPD. Take 1 bacterial solution and spread it on a YPD solid plate, and culture at 30 °C for about 5 - 7 days to collect transformants. 4) Verify the transformants by PCR, restriction digestion, and sequencing, confirm that the target sequence is integrated into the genome of the Candida auris parental strain, and complete the Candida auris gene knockout process.

5. Use of the Candida auris B9J08_001173 gene over-knockout strain according to any one of claims 1 - 3 in the construction of Candida auris fluconazole resistance research.

Images