Heat-resistant glutamine transaminase and preparation method thereof

By digging out TGase from Krasilnikovia cinnamomea and performing enzymatic optimization, the problem of poor stability of existing glutamine transaminases at high temperatures is solved, the enzyme activity is improved and diversity is achieved, the catalytic limit of traditional enzymes is broken, and it is suitable for high-temperature crosslinking reactions in the food industry.

CN120290508APending Publication Date: 2025-07-11JIANGNAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510428876.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-08
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The existing glutamine transaminase has poor stability at high temperatures, which limits its application in the food field. The single gene source leads to convergence of enzymatic properties, lacks diversity, and is difficult to break through the limits of catalytic efficiency and stability.

Method used

TGase (KcTG) derived from Krasilnikovia cinnamomea was mined from Uniprot protein database, heat-resistant glutamine transaminase fragments were obtained through neutral protease treatment, and the enzyme was expressed using recombinant E. coli, optimizing the codons to improve its thermal stability and enzyme activity.

Benefits of technology

The KcTG fragment has a half-life of 2.48 min at 60°C, which is significantly better than commercial TGase. The enzyme activity is increased to 33.16U/mg, adapting to the needs of high-temperature crosslinking reactions and enhancing the industrial application potential of enzymes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290508A_ABST
    Figure CN120290508A_ABST
Patent Text Reader

Abstract

The invention belongs to glutamine transaminase, and particularly relates to heat-resistant glutamine transaminase and a preparation method thereof. The glutamine transaminase gene contains an amino acid sequence shown in SEQ NO: 1, the optimum temperature, the highest specific enzyme activity, the 50 DEG C half-life period and the 60 DEG C half-life period of enzyme coded by the gene are all higher than those of existing unique commercial Streptomyces mobaraensis-sourced TGase, the strain source is novel, the molecular weight is small, soybean protein isolate can be effectively crosslinked, and the glutamine transaminase gene has huge research potential and application potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to transglutaminase, and particularly relates to a heat-resistant transglutaminase and a preparation method thereof Background Art

[0002] Transglutaminase (EC 2.3.2.13, TGase) catalyzes the formation of ε-(γ-glutamyl) lysine isopeptide bonds in proteins through acyl transfer reactions. The acyl donor crosslinks with the ε-amino group of lysine residues and other acyl acceptors, resulting in intramolecular or intermolecular crosslinking. TGase has great application potential in many fields such as food, medicine, and bioengineering due to its excellent protein crosslinking properties

[0003] Since the TGase (smTG) of Streptomyces mobaraensis was reported in 1989, TGases from other microorganisms and other sources have been successively discovered by researchers. Currently, the identified TGase gene sources are relatively single, mainly distributed in the genera Streptomyces and Bacillus. Currently, commercially available TGases all come from the genus Streptomyces, and the optimal temperature is generally around 50°C, and the half-life t at 60°C 1 / 2 is less than two minutes (DOI: 10.1007 / s00726-011-1015-y). However, in many applications, TGase is usually exposed to high temperatures. For example, the crosslinking reaction in tofu processing needs to be carried out at 50°C (https: / / doi.org / 10.1016 / j.lwt.2010.10.020), while beef gels are usually made at 60°C (Reference: https: / / doi.org / 10.1016 / j.foodchem.2005.08.022). Therefore, thermal stability and the maintenance of enzyme activity at high temperatures are the main limiting factors restricting its practical applications, especially in the food field. Because during the protein crosslinking process, it is inevitable to add TGase at a high temperature (such as around 60°C) to carry out the crosslinking reaction. But if it is inactivated at high temperatures, it will seriously affect the reaction efficiency

[0004] Meanwhile, the single gene source of currently commercialized TGase results in the convergence of its enzymatic properties and lack of diversity. The single-source TGase may have approached the optimization limit in key parameters such as catalytic efficiency, stability, and ion dependence. The marginal benefit of traditional fermentation optimization or chemical modification decreases. Limited by the wild-type template, it is difficult to break through the framework of the existing structure-function relationship, which restricts the technological innovation in the field of transglutaminase and the exploration of application scenarios, highlighting the importance of developing new microbial sources and expanding the research of transglutaminase

[0005] The exploration of novel sources of TGase is of core significance in breaking the deadlock of the single gene source of commercial enzyme preparations. At the technical level, it provides cross-dimensional enzymatic properties and breaks through the theoretical limits of existing catalytic efficiency and stability; at the application level, the novel source of TGase may promote the development of new scenarios for protein resource utilization. Therefore, a novel source of heat-resistant transglutaminase is of great significance for promoting the development and innovation in the field of transglutaminase and meeting the requirements of industrial production. Summary of the Invention

[0006] Object of the Invention:

[0007] To solve the above-mentioned existing technical problems, a TGase (KcTG) and its enzyme fragments derived from Krasilnikovia cinnamomea were discovered in the Uniprot protein database in the present invention.

[0008] A heat-resistant transglutaminase, characterized in that its amino acid sequence is as shown in SEQ NO:1.

[0009] A heat-resistant transglutaminase fragment, characterized in that it is obtained by treating the heat-resistant transglutaminase with neutral protease.

[0010] The heat-resistant transglutaminase fragment described above is characterized in that its amino acid sequence is as shown in SEQ NO:2.

[0011] A recombinant plasmid pET-22b(+), characterized in that it contains optimized codons and its nucleotide sequence is as shown in SEQ NO:3.

[0012] A recombinant Escherichia coli, characterized in that it contains the recombinant plasmid pET-22b(+).

[0013] The recombinant Escherichia coli described above is characterized in that it uses E. coli BL21(DE3) as the host.

[0014] A method for producing transglutaminase, characterized in that the recombinant Escherichia coli is used to produce transglutaminase.

[0015] The method described above is characterized in that the fermentation is to culture the Escherichia coli in LB medium at 20 - 37 °C for 40 - 48 h.

[0016] A method for producing transglutaminase, characterized in that Bacillus subtilis, Streptomyces, Lactobacillus or yeast is used to express the transglutaminase with the optimized codons as claimed in claim 4.

[0017] Specifically:

[0018] In one embodiment, the method for constructing Escherichia coli is as follows: Using the method of double digestion construction, splice the gene encoding transglutaminase onto the expression vector pET-22b(+), construct the recombinant plasmid pET-22b(+)-KcTG, and transform it into E. coli BL21(DE3).

[0019] The present invention also provides a method for producing transglutaminase, which is to use the Escherichia coli for fermentative production of transglutaminase.

[0020] In one embodiment, the fermentation is to culture the Escherichia coli in LB medium at 20-37 °C for 40-48 h.

[0021] In one embodiment, the fermentation is to inoculate a certain amount of recombinant Escherichia coli into LB medium containing ampicillin, culture it overnight at 37 °C and 200 r / min, inoculate the well-cultured seed culture solution into LB medium containing ampicillin at an inoculation amount of 2% (v / v), culture it at 37 °C and 200 r / min for 4-6 h until the OD value of the bacterial solution reaches 0.8-1, add isopropyl-β-D-thiogalactoside to the culture solution to a final concentration of 1.0 mmol / L, and induce it at 20 °C at low temperature to produce transglutaminase.

[0022] The present invention also provides the application of the transglutaminase gene or the expression of the transglutaminase in the food industry. Taking soy protein isolate as an example, the cross-linking ability of the transglutaminase is investigated to prove its application potential in industrial production.

[0023] In one embodiment, the enzyme preparation is obtained by genetically engineered fermentation and is added to the substrate in the form of a pure enzyme obtained by separation and purification.

[0024] Beneficial effects

[0025] 1. The inventor mined transglutaminase from the database according to the method disclosed in CN119360944A (a method for directional mining of transglutaminase based on structural analysis), and found the protein with the serial number A0A4Q7ZRM3 in the Uniprot database. However, this database only discloses its amino acid sequence and only predicts that it may be transglutaminase without corresponding activity data. The inventor first discovered that the enzyme activities of transglutaminase KcTG and the KcTG fragment are 4.63 U / mg and 33.16 U / mg respectively; the half-life of KcTG at 50 °C is 398.13 min, and the half-life of KcTG at 60 °C is 3.93 min; the half-life of the KcTG fragment at 50 °C is 32.71 min, and the half-life of the KcTG fragment at 60 °C is 2.48 min. At present, the optimal temperature of the only commercially available TGase from Streptomyces mobaraensis is 50 - 55 °C, the highest specific enzyme activity at the optimal temperature is 26 U / mg, the half-life t1 / 2 at 50 °C is 41.8 min, and the half-life t1 / 2 at 60 °C is less than 2 min. (Reference: DOI: 10.1007 / s00726-011-1015-y). It can be seen from this that the KcTG fragment obtained in the present invention is superior to the commercially available TGase, and the sequence of the KcTG fragment is brand new and has not been reported in the literature.

[0026] 2. The transglutaminase strain source described in the present invention is novel, has a small molecular weight, a high specific enzyme activity, and good heat resistance. It is expected to break the shackles of traditional transglutaminase research, promote the development and technological innovation in the field of transglutaminase, reduce industrial costs, and has application potential. Description of the Drawings

[0027] Figure 1 The protein sequence evolutionary tree constructed for KcTG provided by the present invention;

[0028] Figure 2 The results of the specific enzyme activity of KcTG provided by the present invention varying with temperature;

[0029] Figure 3 The results of the specific enzyme activity of KcTG provided by the present invention varying with pH;

[0030] Figure 4 The results of the change in specific enzyme activity of KcTG provided by the present invention before and after treatment with neutral protease;

[0031] Figure 5 The SDS-PAGE analysis results of KcTG provided by the present invention before and after treatment with neutral protease;

[0032] Figure 6, The residual enzyme activity results of KcTG provided by the present invention at 50 °C, 60 °C and 70 °C;

[0033] Figure 7 , The decay constant results of KcTG provided by the present invention at 50 °C;

[0034] Figure 8 , The decay constant results of KcTG provided by the present invention at 50 °C;

[0035] Figure 9 , The residual enzyme activity results of the KcTG fragment at 50 °C, 60 °C and 70 °C;

[0036] Figure 10 , The decay constant results of the KcTG fragment at 50 °C;

[0037] Figure 11 , The decay constant results of the KcTG fragment at 60 °C;

[0038] Figure 12 Analysis results of the crosslinking ability of KcTG provided by the present invention before and after treatment with neutral protease. Detailed implementation manners

[0039] The plasmid involved in the present invention was synthesized by Shanghai Diwin Biotechnology Co., Ltd.

[0040] Determination of the enzyme activity of transglutaminase:

[0041] Enzyme activity test solution A: 200 mM Tris-HCl, 100 mM NH2OH-HCl, 10 mM GSH, 30 mM CBZ-Gln-Gly, pH 6.0.

[0042] Enzyme activity test solution B: Prepare 3 M HCl, 12% (w / v) trichloroacetic acid and 5% FeCl3 dissolved in 0.1 M HCl respectively, and mix the three solutions in equal amounts when in use.

[0043] Definition of enzyme activity: 1 unit of TGase enzyme activity is defined as the amount of enzyme that catalyzes the formation of 1 μmol of product per minute.

[0044] Preparation of the standard curve for enzyme activity assay: Prepare an enzyme activity standard solution with the following components: 40 mM L-glutamic acid-γ-monohydroxamic acid and 200 mM Tris-HCl, pH 6.0. Use 200 mM Tris-HCl, pH 6.0 buffer to sequentially dilute it by 2-fold dilution method for 10 gradients. Separately take 210 μL of the diluted sample and add 60 μL of enzyme activity test solution B. Measure the absorbance of the sample at a wavelength of 525 nm. Make a linear fit with the absorbance ratio to the amount of hydroxamic acid, and obtain the conversion coefficient K from the slope. When measuring the enzyme activity of the sample, the amount of hydroxamic acid generated can be calculated by its absorbance using the conversion coefficient K.

[0045] Measurement method: Add 60 μL of TGas e sample to 150 μL of enzyme activity test solution A, incubate thermally at a certain temperature for 10 min, and then add 60 μL of enzyme activity test solution B. After shaking the enzyme activity test sample, centrifuge it at 10,000 rpm for 5 min and take 200 μL of the supernatant to measure the absorbance at 525 nm; for the blank control sample, add 60 μL of enzyme activity test solution B to 60 μL of TGas e sample, incubate thermally at a certain temperature for 10 min, and then add 150 μL of enzyme activity test solution A. After performing the same shaking and centrifugation treatments on the mixed sample as above, measure the absorbance at 525 nm. Subtract the absorbance obtained from the control group from the absorbance obtained from the experimental group, and substitute it into the enzyme activity standard curve to obtain the enzyme activity corresponding to the mass of the added protein. Divide this enzyme activity by the protein concentration to obtain the specific enzyme activity of the protein U / mg.

[0046] Example 1: Construction of recombinant plasmid pET-22b(+)-KcTG

[0047] (1) Using human TGase as the root, construct an evolutionary tree of glutamine transaminase KcTG and the sequences of glutamine transaminases from microorganisms marked with black triangles in Uniprot by the neighbor-joining method, as Figure 1 shown. In the evolutionary tree, KcTG and the TGase from Streptomyces are located on different branches of the same node, indicating a relatively close genetic relationship and reflecting its potential glutamine transaminase activity. At the same time, different branches reflecting different evolutionary directions also show their differences.

[0048] (2) According to the amino acid sequence SEQ NO:1 (Uniprot number: A0A4Q7ZRM3) of Krasilnikovia cinnamomea, perform codon optimization, synthesize the gene fragment KcTG of glutamine transaminase, and ligate it between the restriction enzyme sites NdeⅠ and XhoⅠ of pET-22b(+), to obtain the recombinant plasmid pET-22b(+)-KcTG.

[0049] After that, it was transformed into Escherichia coli E. coli BL21(DE3), spread on an LB plate containing ampicillin, and transformants were picked for colony PCR and sequencing verification. A recombinant plasmid containing the glutamine transaminase gene with correct sequencing results was extracted.

[0050] The amino acid sequence of KcTG, 292 AA, as shown in SEQ NO: 1

[0051] MPKRLLRLFVIFVAGLS ISTMVAAPALATESDPRSPTPARTATQAP IAEVRPAERSLANANAATATELTPLAPALPPGVSTRTWSVEDFVELFERKYGRPMTQDERNALARGCIGVTTVNLERGNINPPLGMSFGTFATSRDVQNAINDILATNPSRTQFVAAVAQHPLLSRIDNVTDSLPGGPTSQWTAVIFSKRFYSKQDPSWTDEQADQAFRPDPATGQVDMTDYRYRAKPGYVNFDYGWLDEGSGNWWHANHAEPGMKVYQSTLRHYSRPLLDFDRQVFSVTFGRVHP

[0052] The optimized codons corresponding to KcTG: 720 bp, as shown in SEQ NO: 3

[0053] GCGGAGCGCTCCTTGGCGAACGCGAATGCGGCGACCGCAACGGAATTGACCCCGTTGGCGCCAGCTCTTCCGCCAGGCGTCAGCACACGTACCTGGAGTGTTGAAGATTTCGTGGAATTATTCGAGCGTAAATATGGCCGTCCGATGACCCAAGACGAGCGCAATGCTCTGGCGCGTGGTTGCATTGGTGTGACTACGGTAAATCTGGAAAGAGGTAACATCAACCCGCCTCTGGGTATGAGCTTCGGCACCTTTGCGACCTCCCGTGATGTTCAGAATGCGATTAACGACATCCTGGCTACGAACCCGAGCCGTACGCAATTTGTTGCTGCTGTGGCACAGCATCCGCTCCTGAGCCGTATTGATAACGTGACGGACAGCCTGCCGGGCGGTCCGACCAGCCAGTGGACCGCGGTGATCTTCTCTAAGCGCTTTTACAGCAAGCAGGATCCGTCTTGGACCGACGAGCAGGCGGATCAGGCGTTTCGTCCGGACCCGGCCACCGGTCAAGTCGATATGACCGACTACCGTTATCGCGCAAAACCGGGCTACGTGAACTTCGACTACGGCTGGCTGGATGAGGGTAGCGGTAATTGGTGGCATGCCAACCACGCGGAACCGGGTATGAAAGTTTATCAGAGCACCCTGCGTCACTATTCGCGCCCGTTGCTGGACTTCGACCGTCAAGTTTTTTCCGTGACCTTCGGCCGTGTTCACCCG

[0054] Example 2: Expression and purification of recombinant transglutaminase KcTG

[0055] LB medium: 0.5% yeast extract, 1% tryptone, 1% sodium chloride

[0056] The specific steps are as follows:

[0057] (1) Pick a single colony containing the pET-22b(+)-KcTG recombinant plasmid from the preservation plate, inoculate it into 4 mL of LB medium containing ampicillin, and culture it overnight at 37 °C with a rotation speed of 200 r / min; transfer it to 200 mL of LB medium containing ampicillin, culture it at 37 °C with a rotation speed of 200 r / min for 4 - 6 h until the OD value of the bacterial liquid reaches 0.8 - 1. Add isopropyl-β-D-thiogalactoside to the culture medium to a final concentration of 1.0 mmol / L, and induce it at 20 °C for 24 h to produce transglutaminase, and obtain the fermentation broth.

[0058] (2) Centrifuge the prepared fermentation broth at 4 °C and 8000 r / min for 20 min, and take the precipitate (bacterial cells). Add 15 mL of buffer (50 mM Tris-HCl, 100 mM sodium chloride, adjusted to pH 7.5 with hydrochloric acid) to the bacterial cells to fully resuspend the cells, then place the centrifuge tube in an ice bath and put it into an ultrasonic cell disruptor. The conditions for ultrasonic disruption are: working time 2 s, stopping time 3 s, power 200 W, for a total of 15 min. Centrifuge the obtained cell lysate at low temperature and high speed at 4 °C and 8000 r / min for 10 min to obtain the crude enzyme solution. Filter it with a 0.45 μm microporous filter membrane for standby.

[0059] (3) Obtaining the pure enzyme solution containing transglutaminase KcTG

[0060] Prepare a nickel ion affinity chromatography column. First, use a constant flow pump to pump deionized water into the column to wash about 6 - 12 times the column volume, and then equilibrate it with Binding Buffer (50 mM Tris-HCl, 500 mM NaCl, pH 7.5). After washing two times the packing volume, load the crude enzyme solution passed through the membrane obtained in step (2). Then use Binding Buffer to wash 2 - 5 times the packing volume again. Then use Washing Buffer (50 mM Tris-HCl, 500 mM NaCl, 20 mM imidazole, pH 7.5) to wash the nickel column to remove impurities non-specifically bound to the nickel column. Finally, elute it with Elution Buffer (50 mM Tris-HCl, 500 mM NaCl, 500 mM imidazole, pH 7.5). Collect the eluate of the absorption peak, and use a dialysis bag with a molecular weight cut-off of 14 kDa for dialysis. Use solution A (50 mM Tris-HCl, 10 mM EDTA, pH 7.5) and solution B (50 mM Tris-HCl, pH 7.5) to alternately dialyze for desalting to obtain the pure enzyme solution containing transglutaminase KcTG.

[0061] (4) Determination of the enzyme activity of the transglutaminase pure enzyme solution KcTG obtained in step (3) at different temperatures and different pH values, asFigure 2 As shown in Figure 3, KcTG achieved the maximum enzyme activity at 60°C. When the temperature continued to rise, the enzyme activity of KcTG decreased rapidly. Meanwhile, the optimal pH for KcTG was pH 6.

[0062] Neutral protease dispase can efficiently and specifically remove the N-terminal proenzyme region of Streptomyces mobaraensis pro-TGase, that is, modify the proenzyme. References: Purification and activation of a recombinant histidine-tagged pro-transglutaminase after soluble expression in Escherichia coli and partial characterization of the active enzyme). Prepare a neutral protease solution with a certain concentration, fully treat KcTG in a 37°C water bath to form KcTG fragments, and detect the enzyme activity. The results are as Figure 4 shown. The enzyme activity of KcTG and KcTG fragments increased from 4.63 U / mg to 33.16 U / mg.

[0063] (5) Treat the pure enzyme solution samples before and after treatment with neutral protease in step (4) with loading buffer and perform SDS-PAGE analysis. The results are as Figure 5 shown. It was observed that the band of KcTG was between 25 - 33 kDa, consistent with the predicted molecular weight of 29.74 kDa. Meanwhile, its molecular weight decreased significantly after treatment with neutral protease, indicating that neutral protease can act on KcTG.

[0064] The amino acid sequence of the KcTG fragment is: 240 AA, as shown in SEQ NO:2

[0065] AERSLANANAATATELTPLAPALPPGVSTRTWSVEDFVELFERKYGRPMTQDERNALARGCIGVTTVNLERGNINPPLGMSFGTFATSRDVQNAINDILATNPSRTQFVAAVAQHPLLSRIDNVTDSLPGGPTSQWTAVIFSKRFYSKQDPSWTDEQADQAFRPDPATGQVDMTDYRYRAKPGYVNFDYGWLDEGSGNWWHANHAEPGMKVYQSTLRHYSRPLLDFDRQVFSVTFGRVHP

[0066] Example 3: Determination of the residual enzyme activity of KcTG and the half-life at 60 °C

[0067] (1) Determine the thermal stability of KcTG under water bath conditions at 50 °C, 60 °C, and 70 °C. The specific method is as follows: First, dilute the pure KcTG enzyme solution obtained in step (3) of Example 2 to a certain concentration. Take a certain amount of the sample and perform continuous thermal incubation in a water bath at 50 °C, 60 °C, and 70 °C respectively. Sampling is carried out at regular intervals, and the taken samples are immediately placed in an ice bath. Enzyme activity assays are performed on the taken samples respectively to obtain the residual enzyme activity of TGase over time.

[0068] The results are as Figure 6 shown. The enzyme activity of KcTG hardly decreased significantly after incubation at 50 °C for 20 min. After incubation for 40 min, the enzyme activity began to decline, and the enzyme activity remained at about 80% after incubation for 120 min. When incubated at 60 °C, the enzyme activity rapidly decreased and almost completely lost after 10 min. When incubated at 70 °C, the enzyme activity rapidly decreased and almost completely lost after 2 min.

[0069] (2) Obtain the percentage of residual enzyme activity by comparing the residual enzyme activity with the initial enzyme activity. Fit it to obtain a fitting formula, and then calculate the decay constant Kd. Furthermore, calculate the time corresponding to the enzyme activity decreasing to 50% of the initial value, which is the half-life t 1 / 2 .

[0070] The decay constant at 50 °C is as Figure 7 shown. The half-life of KcTG at 50 °C is obtained as 398.13 min; the decay constant at 60 °C is as Figure 8 shown. The half-life of KcTG at 60 °C is obtained as 3.93 min.

[0071] Example 4: Determination of the residual enzyme activity of the KcTG fragment after treatment with neutral protease and the half-life at 60 °C

[0072] (1) Determine the thermal stability of the KcTG fragment under water bath conditions at 50 °C, 60 °C, and 70 °C. The specific method is as follows: First, dilute the KcTG fragment obtained in step (3) of Example 2 to a certain concentration. Take a certain amount of the sample and perform continuous thermal incubation in a water bath at 50 °C, 60 °C, and 70 °C respectively. Sampling is carried out at regular intervals, and the taken samples are immediately placed in an ice bath. Enzyme activity assays are performed on the taken samples respectively to obtain the residual enzyme activity of TGase over time. The results are as Figure 9 shown. The enzyme activity of the KcTG fragment gradually decreased with the extension of the incubation time at 50 °C, and the enzyme activity decreased to about 20% at 80 min. When incubated at 60 °C, the enzyme activity rapidly decreased and almost completely lost after 5 min. When incubated at 70 °C, the enzyme activity rapidly decreased and almost completely lost after 2 min.

[0073] (2) The percentage of residual enzyme activity relative to the initial enzyme activity is obtained, and it is fitted. After obtaining the fitting formula, the decay constant Kd is calculated. Then, the time corresponding to the enzyme activity decreasing to 50% of the initial value is the half-life t1 / 2. The decay constant at 50 °C is as Figure 10 shown, and the half-life of the KcTG fragment at 50 °C is obtained as 32.71 min; the decay constant at 60 °C is as Figure 11 shown, and the half-life of the KcTG fragment at 60 °C is obtained as 2.48 min.

[0074] Example 5: Investigation on cross-linking of soy protein isolate

[0075] Using the soy protein isolate self-extracted in the laboratory as the substrate, it is dissolved in the prepared Tris-HCl buffer (50 mM Tris-HCl, pH 7.5). After sufficient dissolution, the supernatant is filtered through a 0.22-μm water membrane and diluted to 2.5 mg / mL with the buffer. KcTG is added at 60 °C to an enzyme concentration of 0.125 mg / mL for cross-linking reaction. The reaction samples at 0, 5, 10, 20, and 30 min are placed on ice to terminate the reaction, and then used for SDS-PAGE analysis.

[0076] The results are as Figure 12 shown. Lane M represents the protein marker, and lane 1 represents the sample obtained by mixing the Tris-HCl buffer and the soy protein isolate solution in proportion, indicating a reaction time of 0 min; lanes 2-5 and lanes 6-9 respectively represent the samples obtained by mixing the untreated and neutral protease-sufficiently treated KcTG with the soy protein isolate solution in proportion and cross-linking for 5, 10, 20, and 30 min. High-molecular-weight bands appear at the top of lanes 2-9, indicating that the soy protein isolate is cross-linked. The α, α', and AS subunits of the soy protein isolate in lanes 6-9 almost completely disappear, reflecting that after being treated with neutral protease, the cross-linking ability of KcTG is greatly improved, corresponding to the significant increase in its enzyme activity.

[0077] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A heat-resistant glutaminase, characterized in that, Its amino acid sequence is shown in SEQ NO:

1.

2. A heat-resistant glutamine transaminase fragment, characterized in that, It is obtained by treating the heat-resistant glutamine transaminase described in claim 1 with neutral protease.

3. A heat-resistant glutamine transaminase fragment according to claim 2, characterized in that, Its amino acid sequence is shown in SEQ NO:

2.

4. A recombinant plasmid pET-22b(+), characterized in that, It contains optimized codons, and its nucleotide sequence is shown in SEQ NO:

3.

5. A recombinant Escherichia coli, characterized in that, It contains the recombinant plasmid pET-22b(+) described in claim 4.

6. The recombinant Escherichia coli according to claim 5, characterized in that, It uses E.coli BL21(DE3) as the host.

7. A method for producing transglutaminase, characterized in that, Produce glutamine transaminase using the recombinant Escherichia coli described in claim 5 or 6.

8. The method according to claim 7, wherein The fermentation is to culture the Escherichia coli in LB medium at 20-37 °C for 40-48 h.

9. The method according to claim 8, characterized in that, Inoculate the recombinant Escherichia coli into LB medium containing ampicillin, culture overnight at 37 °C, 200 r / min, inoculate the cultured seed culture solution into LB medium containing ampicillin at an inoculation amount of 2% v / v, culture at 37 °C, 200 r / min for 4-6 h until the OD value of the bacterial solution reaches 0.8-1, add isopropyl-β-D-thiogalactoside to the culture solution to a final concentration of 1.0 mmol / L, and induce at low temperature of 20 °C to produce glutamine transaminase.

10. A method for producing transglutaminase, characterized in that, Use Bacillus subtilis, Streptomyces, Lactobacillus or yeast to express the optimized codons described in claim 4 to produce glutamine transaminase.

Citation Information

Patent Citations

  • Method for directionally mining glutamine transaminase based on structural analysis

    CN119360944A