Bio-organic fertilizer containing Burkholderia paraherbivora and its application

Abstract

The present invention relates to a bio-organic fertilizer containing Paraburkholderia herbivora and its application, belonging to the field of biotechnology. The bio-organic fertilizer comprises: Paraburkholderia herbivora, decomposed cow dung, rice husks, fish protein fertilizer, and chitin. The bio-organic fertilizer can be used to increase the microbial carbon and microbial nitrogen content in the rhizosphere soil of plants, increase the proline content and root vitality of the plant roots, improve the nitrogen absorption and utilization rate of the plant, the potassium absorption amount, and the enzyme activity of the rhizosphere soil of the plant, and prevent and control crop diseases. Among them, Paraburkholderia herbivora is a natural strain and is more easily colonized in the soil. In addition, the present invention has a wide range of raw materials, low cost, and a simple preparation method. It does not have an adverse impact on environmental safety and can promote the sustainable development of agricultural production.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a bio-organic fertilizer containing paraburkholderia herbivora and application thereof. Background Art

[0002] In recent years, with the continued cultivation of crops, soil-borne diseases have become increasingly prevalent. Without immediate action, severe cases can lead to complete crop failure. Fungal diseases, in particular, can significantly impact plant growth, causing cell necrosis, leaf wilting, inflorescence deformities, and even plant death. However, when it comes to disease prevention and control, relying solely on specific chemical agents for soil-borne disease control not only fails to achieve the desired control effect but also risks the development of drug resistance in pathogens.

[0003] Over the past decade, rising environmental awareness has made green agriculture mainstream. When combating soilborne diseases, the goal is to minimize negative impacts on the environment and ecosystems while ensuring economic benefits. Compared to chemical pesticides, the use of biopesticides, which rely on microbial and botanical agents to control pathogens, is gaining increasing attention and is currently a focus of research. Microbial agents help increase soil microbial diversity, enhance soil fertility and crop quality, and improve plant resistance. Bio-organic fertilizers contain active microorganisms that promote crop growth. Compared to traditional chemical fertilizers, bio-organic fertilizers have a higher carbon-to-nitrogen ratio and comprehensive fertilizer effects, significantly improving the physical and chemical properties of the soil. They can enhance soil microbial activity, improve soil fertility, and increase crop yield and quality. Bio-organic fertilizers play a vital role in environmental protection and promoting soil biomass recycling.

[0004] Furthermore, currently used bio-organic fertilizers often rely on microbial strains that have undergone genetic mutation or targeted breeding. These strains are often constrained by environmental conditions during practical use, making it difficult for them to survive, reproduce, and perform their intended functions in soil or plants. Therefore, research into bio-organic fertilizers based on naturally occurring microbial strains has become a key focus in this field.

[0005] In summary, when conducting biological control of crop diseases, it is important to minimize interference with the environment and ecosystem while ensuring maximum economic benefits. As a new type of fertilizer, the research and application of bio-organic fertilizers should be based on natural bacterial strains and continuously deepened to improve preparation processes and application efficiency. Summary of the Invention

[0006] To overcome the problems of the prior art, the present invention provides Paraburkholderia praecox, a bio-organic fertilizer, and its application. The Paraburkholderia praecox provided by the present invention is a natural plant rhizosphere bacterium. Compared with genetically engineered bacteria, this strain has better soil and plant rhizosphere colonization ability. Bacterial agents and bio-organic fertilizers containing this bacterium, when applied, have advantageous effects such as preventing and controlling crop root rot and increasing proline content and root vitality in plant roots.

[0007] To achieve the above object, the present invention provides a Burkholderia paragracilis with a deposit number of CCTCC NO: M 20242399 ( Paraburkholderia graminis ) in the prevention and treatment of Dutch pea root rot ( Fusarium oxysporum ), Chayote root rot ( Pythium aphanidermatum ) and purple cabbage black root disease ( Rhizoctonia solani ), increase the microbial carbon and microbial nitrogen content in the rhizosphere soil of plants, increase the proline content and root activity of plants, increase the nitrogen absorption and utilization rate of plants, potassium absorption and enzyme activity in the rhizosphere soil of plants.

[0008] The present invention also provides a bio-organic fertilizer, which comprises the following components: decomposed cow dung, rice husk, fish protein, chitin and a Burkholderia paraphyletica agent in a weight ratio of 140-210:75-110:24-45:11.5-17.1:3; the effective viable bacteria count in the Burkholderia paraphyletica agent is not less than 2×10 10 cfu / g; wherein the deposition number of the herbaceous bacterium is CCTCC NO: M20242399;

[0009] The present invention further provides a bio-organic fertilizer for preventing and treating snow pea root rot ( Fusarium oxysporum ), Chayote root rot ( Pythium aphanidermatum ) and purple cabbage black root disease ( Rhizoctonia solani ), increase the microbial carbon and microbial nitrogen content in the rhizosphere soil of plants, increase the proline content and root activity of plants, increase the nitrogen absorption and utilization rate of plants, potassium absorption and enzyme activity in the rhizosphere soil of plants.

[0010] Beneficial effects of the present invention:

[0011] (1) The grass root Burkholderia provided by the present invention ( Paraburkholderia graminis ) is a natural strain with better colonization ability. Compared with genetically engineered strains or induced mutant strains, it is more conducive to exerting the biocontrol characteristics of the strain, thereby achieving excellent disease control effects.

[0012] (2) The bio-organic fertilizer provided by the present invention can effectively regulate the metabolism of plants, improve the nitrogen absorption and utilization rate and potassium absorption of plants, and increase the proline content and root activity in the roots of plants, thereby effectively solving problems such as serious diseases during plant growth or decreased plant resistance, and can increase the microbial carbon and microbial nitrogen content in the rhizosphere soil of plants and the enzyme activity in the rhizosphere soil of plants.

[0013] (3) The bio-organic fertilizer provided by the present invention has the characteristics of a wide range of raw material sources, low cost, and environmental friendliness. Furthermore, the preparation method of the fertilizer is simple and the storage stability is high. By carefully selecting the type and amount of raw materials in the fertilizer, the number of viable bacteria when Burkholderia paraphyletica is added reaches a high level.

[0014] (4) The present invention provides a method for preventing and treating root rot of snow peas ( Fusarium oxysporum ), Chayote root rot ( Pythium aphanidermatum ) and purple cabbage black root disease ( Rhizoctonia solani ) method is simple and easy to implement, will not have adverse effects on environmental safety, and can promote the sustainable development of agricultural production.

[0015] Biological Deposits

[0016] The present invention provides the grass root periphery Burkholderia ( Paraburkholderia graminis ), classified as: Paraburkholderia graminis YNK PB0001 was deposited with the China Center for Type Culture Collection, Wuhan University, 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, China, on October 31, 2024, with the deposit number CCTCC NO: M20242399. This strain has been disclosed in invention patent application number CN202510152906.3. DETAILED DESCRIPTION

[0017] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0018] In the present invention, Paraburkholderia herbivora YNK PB0001 and Paraburkholderia herbivora CCTCC NO: M 20242399 are the same strain, have the same meaning, and their names (numbers) can be used interchangeably.

[0019] The inventors of the present invention isolated and obtained a Burkholderia herbivora strain ( Paraburkholderia graminis ), classified as: Paraburkholderia graminis YNK PB0001 was deposited in the China Center for Type Culture Collection, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University, on October 31, 2024, with the deposit number CCTCC NO: M20242399.

[0020] Further research by the inventors found that the biological organic fertilizer containing Burkholderia herba is prepared by mixing the above-mentioned Burkholderia herba YNK PB0001 with decomposed cow dung, rice husks, fish protein fertilizer and chitin. The fertilizer can be used to prevent and control snow pea root rot, chayote root rot and purple cabbage black root disease, increase the microbial carbon and microbial nitrogen content in the rhizosphere soil of the plants, increase the proline content and root activity of the plant roots, and increase the nitrogen absorption and utilization rate of the plants, potassium absorption and enzyme activity in the rhizosphere soil of the plants.

[0021] Based on the above findings, the present application provides a bio-organic fertilizer containing Burkholderia spp., which comprises: composted cow dung, rice husk, fish protein, chitin and Burkholderia spp. inoculum in a weight ratio of 140-210:75-110:24-45:11.5-17.1:3; the effective viable bacteria count in the Burkholderia spp. inoculum is not less than 2×10 10 cfu / g.

[0022] The invention provides a bio-organic fertilizer containing Burkholderia spp., which comprises decomposed cow dung, rice husks, fish protein fertilizer, chitin grass and Burkholderia spp. CCTCC NO: M 20242399 (or a bacterial agent prepared based on the strain).

[0023] The decomposed cow dung has a moisture content of 10-16% by weight, a crude protein content of 10-16% by weight, a crude fiber content of 8-15% by weight, a crude fat content of 0.1-1% by weight, a nitrogen-free extract of 40-60% by weight, and a calcium content of 1-10% by weight, calculated on a dry matter basis;

[0024] The rice husk has a moisture content of 5-10%, a crude fiber content of 30-40% by weight, a lignin content of 20-30% by weight, a crude protein content of 1-5% by weight, a crude fat content of 0.5-2% by weight, and an ash content of 10-20% by weight based on dry matter.

[0025] The present invention has no particular restrictions on the specific composition and source of the selected auxiliary materials. They can be directly obtained from commercial sources or can be related products prepared independently according to existing technologies.

[0026] The inventors of the present invention have discovered that using chitin as a fertilizer synergist in the composition provided by the present invention not only further enhances pest control efficacy but also increases the activity of defense proteins in crops, particularly plants, and enzyme activity in the rhizosphere. Furthermore, using fish protein fertilizer as a synergist in a bio-organic fertilizer containing Burkholderia pararhizogenes can further increase the number of viable bacteria in the organic fertilizer.

[0027] The present invention provides the above-mentioned biological organic fertilizer containing Burkholderia praecox in preventing and treating snow pea root rot ( Fusarium oxysporum ), Chayote root rot ( Pythium aphanidermatum ) and purple cabbage black root disease ( Rhizoctonia solani ), increase the microbial carbon and microbial nitrogen content in the rhizosphere soil of plants, increase the proline content and root activity of plants, increase the nitrogen absorption and utilization rate of plants, potassium absorption and enzyme activity in the rhizosphere soil of plants, etc.

[0028] In the present invention, disease prevention and control refers to reducing the incidence of diseases, regulating soil nutrients (for example, increasing soil microbial carbon, microbial nitrogen content, nitrogen absorption and utilization rate of plants, potassium absorption, and increasing soil enzyme activity), and improving plant systemic resistance (for example, increasing plant root proline content and root activity).

[0029] The method for preventing and treating root rot of snow peas according to the present invention ( Fusarium oxysporum ), Chayote root rot ( Pythium aphanidermatum ) and purple cabbage black root disease ( Rhizoctonia solani ), a method for increasing the microbial carbon and microbial nitrogen content in the rhizosphere soil of plants, increasing the proline content and root activity of the plant roots, increasing the nitrogen absorption and utilization rate of the plant, the potassium absorption amount and the enzyme activity of the rhizosphere soil of the plant, the method comprising applying a bio-organic fertilizer containing Burkholderia herbivora to the rhizosphere soil of the crop plants.

[0030] There is no particular limitation on the application method in the present invention, and any commonly used method of applying fertilizer to the soil in the art can be applied to the present invention.

[0031] In the present invention, there is no particular limitation on the specific usage of the Burkholderia paragracilis and the bio-organic fertilizer, as long as they can reduce the incidence of diseases and improve the resistance of the plant root system.

[0032] According to a preferred embodiment of the present invention, for the above-mentioned application method, the application amount of the bio-organic fertilizer containing Burkholderia spp. is not less than 1×10 10 cfu / strain / time is the standard. Preferably 1×10 10 -3×10 12cfu / strain / time. More preferably 3×10 10 -3×10 12 cfu / strain / time. For example, it can be 3×10 10 cfu / plant / time, 4×10 10 cfu / plant / time, 5×10 10 cfu / plant / time, 6×10 10 cfu / plant / time, 8×10 10 cfu / plant / time, 1×10 11 cfu / plant / time, 5×10 11 cfu / plant / time, 8×10 11 cfu / plant / time, 1×10 12 cfu / plant / time, 2×10 12 cfu / plant / time, 3×10 12 cfu / strain / time, or any intermediate value between any two of the above values.

[0033] Preferably, the organic fertilizer or bio-organic fertilizer containing Burkholderia paraherbivora is applied once as base fertilizer 15-20 days before planting.

[0034] In order to make the purpose, technical solutions and beneficial effects of the present invention clearer, the preferred embodiments of the present invention will be described in detail below to facilitate understanding by technicians.

[0035] Example 1 Preparation of biological organic fertilizer

[0036] This embodiment is used to illustrate the preparation process of the bio-organic fertilizer provided by the present invention.

[0037] The formula of biological organic fertilizer is shown in Table 2, and the material composition test results of decomposed cow dung and rice husk are shown in Table 1 (wherein the water content is calculated based on the total weight of the material, and the remaining components are calculated based on the dry matter in the material). The crude protein content was determined by the Kjeldahl nitrogen method, the crude fiber content was determined by the acid hydrolysis-anthrone colorimetric method, the crude fat content was determined by the Soxhlet extraction method, the nitrogen-free extract content was determined by near-infrared analysis, and the calcium content was determined by flame atomic absorption spectrometry. The lignin content was determined by the acid dissolution method, and the ash content was determined by the slow ash method. Decomposed cow dung was purchased from Shaanxi Yiruinong Biotechnology Co., Ltd., rice husks were purchased from Qiyuanjia Trading Company in Xinwu District, fish protein fertilizer was purchased from Jinan Xinchenxu Chemical Co., Ltd., and chitin was purchased from Henan Bangrun Chemical Products Co., Ltd.

[0038] Preparation of Burkholderia parahaemolyticus inoculum:

[0039] The steps include:

[0040] (1) solid culturing the above-mentioned Burkholderia herba in a solid culture medium to obtain a test tube strain;

[0041] (2) preparing a liquid seed culture medium, and inoculating the test tube seeds therein for liquid culture to obtain liquid seeds;

[0042] (3) Prepare liquid fermentation medium and inoculate liquid seeds into it for fermentation.

[0043] In step (1), the grass root periphyton Burkholderia is inoculated by slant inoculation, and the solid culture is cultured at a temperature of 25-30°C for 40-50 hours; the solid culture medium comprises: 10-12 g / L glucose, 15-20 g / L agar, 3-5 g / L beef extract, 1-3 g / L yeast extract, 10-15 g / L peptone, and pH = 6.5-7.5.

[0044] In step (2), the test tube seeds are inoculated into a liquid seed culture medium, and the liquid culture is treated for 45-50 hours at a temperature of 25-30°C and a rotation speed of 200-250 r / min; the liquid seed culture medium comprises: 10-15 g / L peptone, 3-5 g / L beef extract, 10-12 g / L sodium chloride, and a pH of 6.5-7.5.

[0045] In this step, the liquid seed culture medium is preferably sterilized at 120-125°C for 20-30 min, and after cooling, 0.5-1.5 cm 2 The liquid seeds were obtained by culturing the mixture in a test tube at 28-30°C on a shaker with a rotation speed of 220-250 r / min for 45-50 hours.

[0046] In step (3), the liquid seeds are inoculated in a liquid fermentation medium at a volume ratio of 0.05-0.1:1 and treated for 45-50 hours at a temperature of 25-30°C and a rotation speed of 200-250 r / min; the liquid fermentation medium comprises: 20-23 g / L sucrose, 10-15 g / L peptone, 5-8 g / L yeast extract, 3-5 g / L potassium dihydrogen phosphate, 5-8 g / L ammonium sulfate, 2-4 g / L calcium carbonate, and a pH of 6.5-7.5.

[0047] In this step, the liquid fermentation medium is preferably sterilized at 120-125° C. for 20-30 min, inoculated with liquid seeds after cooling, and cultured on a shaker at 28-30° C. and 220-250 r / min for 45-50 h to obtain the fermentation liquid.

[0048] The above-mentioned preparation steps further include:

[0049] After the culture was completed, the culture solution was diluted with an appropriate amount of fresh NB medium to obtain a viable bacterial count of approximately 2 × 10 10 cfu / mL of liquid inoculum of Burkholderia paraphylla, and after drying, the viable count was about 2×10 10 cfu / g of grass root parasite Burkholderia solid inoculum.

[0050] The specific preparation method of bio-organic fertilizer is as follows: weigh the raw materials according to the ratios shown in Table 2 below, then mix and compost them, and seal the pile with mud. During composting, the moisture content of the compost material is controlled to 35±5% by weight and the temperature is 55±5°C. Turn the pile once on the 20th and 30th days of composting to obtain bio-organic fertilizer.

[0051] Table 1 Material composition of biological organic fertilizer

[0052]

[0053] Table 2 Bio-organic fertilizer formula

[0054]

[0055] Example 2: Bio-organic fertilizer containing Burkholderia paraphyletica and its application effect on plants

[0056] This example is used to illustrate the bio-organic fertilizer containing Burkholderia herbivora provided by the present invention and its application effect on plants.

[0057] (1) The bio-organic fertilizer used in this embodiment is prepared from Example 1. According to the dosage in Table 3, the bio-organic fertilizer prepared from Example 1 is applied to the rhizosphere soil of the plant, and then culture is carried out simultaneously while keeping other conditions consistent. Specific fertilization method: 15-20 days before crop planting, the bio-organic fertilizer is applied as a base fertilizer. The dosage is such that the amount of Burkholderia paraphyletica in the rhizosphere is not less than 1×10 10 The frequency of application of Burkholderia parahaemolyticus or bio-organic fertilizer is once as base fertilizer 15-20 days before planting.

[0058] (2) The control group received no treatment, and the chemical fertilizer group received conventional fertilization, in which urea, superphosphate, and potassium sulfate were prepared by themselves, with the weight ratio of N, P, and K being 15.3:9.8:22.8.

[0059] After fertilization, disease incidence was investigated at harvest time, and control effectiveness was recorded and calculated. Rhizosphere soil and root samples were collected. Microbial carbon and microbial nitrogen content and soil enzyme activity were measured in the rhizosphere soil of each crop group. Nitrogen absorption and utilization efficiency and potassium uptake were determined, as were proline content and root activity. Disease control effectiveness was also assessed.

[0060] Disease investigation methods:

[0061] Level 0: Asymptomatic

[0062] Level 1: A small amount of lesions appear on the roots (0-10%).

[0063] Level 3: 10-25% of the roots have partial lesions.

[0064] Level 5: Complete root infection.

[0065] Level 7: Plant death.

[0066] The control effect is calculated using the following two formulas:

[0067] Disease index = [(∑(number of diseased plants × representative level)) / (total number of plants × highest representative level)] × 100

[0068] The control effect (%) = [(disease index of the control group - disease index of the treatment group) / disease index of the control group] × 100%.

[0069] Disease identification: Collect the Fusarium oxysporum )、Pythium aphanidermatum( Pythium aphaniderm ) and Rhizoctonia solani ( Rhizoctonia solani ) were infected with typical root and tuber disease samples. The pathogen was isolated and purified using tissue separation to obtain a pure culture. This pure culture was then inoculated into live organisms according to Koch's postulates to verify pathogenicity. The pathogen was then re-isolated from the diseased tissues to obtain a pure culture identical to the original inoculum. This validation confirmed the isolate's pathogenicity to crops. Based on morphological characterization of the isolate, molecular identification using the ITS gene was performed to ultimately determine the taxonomic status of the pure culture.

[0070] Fusarium ( Fusarium oxysporum ) ITS gene sequence (SEQ ID NO.1):

[0071] CCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAAT

[0072] Pythium aphanidermatum ( Pythium aphanidermatum ) ITS gene sequence (SEQ ID NO.2):

[0073] GGGCTGCTTAATTGTAGTCTGCCGATGTATTTTTCAAACCCATTTACCTAATACTGATCTATACTCCAAAAACGAAAGTTTATGGTTTTAATCTATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTCTGTGTAGTCAGGGAGAGAGATGGCAGAATGTGAGGTGTCTCGCTGGCTCCCTTTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTAAGATGAAGTGTGATTCTCGAATCGCGGTGATCTGTTTGGATCGCTTTGCGCATTTGGGCGACTTCGGTTAGGACATTAAAGGAAGCAACCTCTATTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGACAGAGTGTGGTTTTCTGTTCTTTCCTTGAGGTGTACCTGAATTGTGTGAGG

[0074] Rhizoctonia solani Rhizoctonia solani ) ITS gene sequence (SEQ ID NO.3):

[0075] AAGTGCACACCTTTCTCTTCAATCCATACACACCTGTGCACCTGTGAGACCGAAGTTTTTCTAGGGGGGGAAGGAACTTTATTGGACCTACTCTCTTTGGACTTCTGTCTACTTAATCTATATAAACTCAATTTATTTTAAAATGAAT GTAATGGATGTAACACATCTAATACTAAGTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGG TATTCCTTGGAGCATGCCTGTTTGAGTATCATGAAATCTTCAAAGTCAAACCTTTTGTTAACTCAATTGGTTCTGCTTTGGTATTGGAGGTCTATTGCAGCTTCACACCTGCTCCTCTTTGTGCATTAGCTGGATCTCAGTGTTATGCT TGGTTCCACTCAGCGTGATAAGTTATCTATCGCTGAGGACACCCTGTTAAAAAGGGGTGGCCAAGGTAAATGCAGATGAACTGCTTCTAACAGTCCATTGACTTGGACAAATATTCATTTATGATCTGTCTCAATCAGGAGACACCCAC

[0076] The microbial carbon (MBC) (mg / kg) of the rhizosphere soil of the plants was determined by the chloroform fumigation culture method, and the microbial nitrogen content (MBN) (mg / kg) was determined by the chloroform fumigation-K2SO4 extraction method. The proline content (μg / g) and root activity (mg / g / h) of the plant roots were determined using kits purchased from Suzhou Gres Biotechnology Co., Ltd. The method of use was referred to the instructions. The nitrogen absorption and utilization efficiency (NRE) of the plants was determined by measuring the nitrogen absorption and utilization efficiency of the experimental treatment groups (G N ) and control treatment group (G O ) The nitrogen uptake by crop roots and the amount of fertilizer applied for each treatment (N N ), the nitrogen absorption and utilization efficiency of the plant was calculated using the Kjeldahl method and the following formula: NRE (%) = (G N -G O ) / N N ×100. Potassium absorption of plants (kg / hm -2) determination method: inductively coupled plasma atomic emission spectrometry.

[0077] Method for determining enzyme activity in the rhizosphere soil of plants:

[0078] Cellulase (S-CL) (mg 10g -1 72h -1 )、Sucrase (S-SC) (mg g -1 d -1 ) were determined using kits purchased from Suzhou Gres Biotechnology Co., Ltd. The instructions for use were as per the instructions.

[0079] From the data in Tables 4, 5, 6, 7, and 8, it can be seen that when the bio-organic fertilizer provided by the present invention is applied, the control effect on crop diseases and the improvement effect on plant rhizosphere soil microbial carbon, microbial nitrogen content, plant root proline content, root activity, plant nitrogen absorption and utilization rate, and soil enzyme activity are stronger than the control.

[0080] Table 3 Test conditions and results of the disease control effect of biological organic fertilizer

[0081]

[0082] Table 4 Effects of bio-organic fertilizer application on the microbial carbon and microbial nitrogen content in crop rhizosphere soil

[0083]

[0084] Table 5 Effects of bio-organic fertilizer application on proline content and root activity of crops

[0085]

[0086] Table 6 Effects of bio-organic fertilizer application on nitrogen absorption and utilization efficiency of plants

[0087]

[0088] Table 7 Effect of bio-organic fertilizer application on plant potassium absorption

[0089]

[0090] Table 8 Effects of bio-organic fertilizer application on enzyme activities in rhizosphere soil of plants

[0091]

[0092] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

Claims

1. A bio-organic fertilizer containing Burkholderia pararhizogenes for increasing the microbial carbon content and microbial nitrogen content in the rhizosphere soil of plants, increasing the proline content and root activity of the plant root system, increasing the nitrogen absorption and utilization rate of the plant, the potassium absorption amount and the enzyme activity of the rhizosphere soil of the plant, and preventing and controlling crop diseases, characterized in that: The bio-organic fertilizer comprises decomposed cow dung, rice husk, fish protein, chitin and grass root paraburkholderia ( Paraburkholderia graminis ) microbial agent; the number of effective viable bacteria in the grass root paraburkholderia microbial agent is not less than 2×10 10 cfu / g; wherein, the preservation number of the herbaceous Burkholderia parahaemolyticus is CCTCC NO: M20242399.

2. Bio-organic fertilizer according to claim 1, is characterized in that: The decomposed cow dung has a moisture content of 10-16% by weight, a crude protein content of 10-16% by weight, a crude fiber content of 8-15% by weight, a crude fat content of 0.1-1% by weight, a nitrogen-free extract of 40-60% by weight, and a calcium content of 1-10% by weight; and / or the rice husk has a moisture content of 5-10%, a crude fiber content of 30-40% by weight, a lignin content of 20-30% by weight, a crude protein content of 1-5% by weight, a crude fat content of 0.5-2% by weight, and an ash content of 10-20% by weight, based on dry matter.

3. Bio-organic fertilizer according to claim 1, is characterized in that: The plant is one or more of snow pea, chayote, and red cabbage, and the types of crop diseases to be controlled are: snow pea root rot, chayote root rot, and red cabbage black root disease. The pathogen of snow pea root rot is Fusarium oxysporum ( Fusarium oxysporum ), the pathogen of chayote root rot is Pythium aphanidermatum ( Pythium aphanidermatum ), the pathogen of the black root disease of purple cabbage is Rhizoctonia solani ( Rhizoctonia solani ).

4. A method for increasing the microbial carbon and microbial nitrogen content in the rhizosphere soil of plants, increasing the proline content and root activity of the plant root system, increasing the nitrogen absorption and utilization rate of the plant, the potassium absorption amount and the enzyme activity of the rhizosphere soil of the plant, and preventing and controlling crop diseases, characterized in that: The method comprises: applying the bio-organic fertilizer according to claim 1 or 2 to the soil at a dosage of 50-60 kg / mu / time, and applying the bio-organic fertilizer more than once per crop.

Images