Cap-independent linear mRNA expression system and application thereof

Abstract

The invention discloses a cap-independent linear mRNA (messenger Ribonucleic Acid) expression system and application thereof. The UPA cap-free linear mRNA does not need to add a 5'cap or nucleic acid modification in the in-vitro transcription synthesis process, can efficiently and stably express, can be used as an infectious disease vaccine or tumor vaccine expression system, and has stronger immune induction and / or tumor inhibition effects than conventional mRNA.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and particularly relates to a cap-independent linear mRNA expression system and its application. Background Art

[0002] In recent years, as a direct template for protein synthesis, mRNA has been widely used in the fields of virus prevention and personalized cancer treatment. As a new generation of vaccine technology, mRNA vaccines have the advantages of short R & D cycle, strong immunogenicity, programmable design and strong production scalability. They have been successfully applied during the epidemic, demonstrating excellent safety and significant immune protection effects. 1 In addition, mRNA vaccines also show great potential in the prevention of other viruses (such as influenza virus, Zika virus, AIDS, etc.), and multiple candidate vaccines have entered clinical trials. 2 In addition to virus vaccines, mRNA also shows important breakthroughs in the field of cancer treatment, especially in personalized cancer vaccines. 3 Personalized mRNA cancer vaccines are based on the neoantigens of patients' tumors and design specific mRNAs for encoding. When delivered into the body, they can induce specific T cell immune responses to achieve precise targeted killing of cancer cells. Compared with traditional cancer vaccines, personalized mRNA cancer vaccines have higher specificity and flexibility, and can encode and express multiple tumor neoantigens simultaneously, thereby more comprehensively activating the polyclonal T cell immune response against tumors. This characteristic of multi-antigen expression not only enhances the breadth and intensity of the immune response, but also provides a more effective solution for tumor heterogeneity. A number of studies have shown that personalized mRNA cancer vaccines have entered clinical trials and have demonstrated reliable safety and positive treatment effects in indications such as melanoma, non-small cell lung cancer, pancreatic cancer, etc. 4,5 Generally speaking, mRNA technology not only shows broad application prospects in virus prevention and control, but also has great potential in the field of personalized cancer treatment.

[0003] Currently, mRNA technologies are mainly divided into conventional linear mRNA, self-replicating mRNA (saRNA), and circular RNA (circRNA). Conventional linear mRNA is the most mature form, relying on the translation mechanism mediated by the 5'-end cap structure. It has the advantages of high expression efficiency and relatively simple preparation, and has been widely used in vaccines and protein replacement therapies. However, its disadvantages include easy degradation, low stability, the need for a cap structure, and often the need for nucleic acid modification. Self-replicating mRNA self-amplifies in cells through RNA-dependent RNA polymerase (RdRp), which can significantly reduce the required dose and improve the persistence of protein expression. However, due to its large molecule size, delivery and synthesis are relatively complex, and it may trigger an overly strong immune response. Circular RNA, due to its covalently closed 5' and 3' ends, is more stable than linear mRNA, can reduce nuclease degradation, and is suitable for long-term protein expression, gene therapy, and the development of novel vaccines. However, its translation depends on the IRES or m6A-mediated mechanism, which may affect translation efficiency, and the production process is not yet mature, still facing problems such as low cyclization efficiency, insufficient yield, and difficulty in purification. Summary of the Invention

[0004] In view of the above technical problems, the present invention provides a capless and non-dependent linear mRNA with a novel structure (hereinafter referred to as capless linear mRNA), which does not require the addition of a 5' cap or nucleic acid modification during in vitro transcription and synthesis.

[0005] In the first aspect of the present invention, there is provided a capless linear mRNA, which sequentially comprises the following elements from 5' to 3': one or more tandem 5' protection sequences (UPA), IRES, 5' UTR, the coding region of the target protein, 3' UTR, and optionally a polyA tail. The 5' protection sequence includes an exoribonuclease-resistant RNA (xrRNA) and an RNA-binding protein binding motif.

[0006] In some embodiments, the number of repetitions of the 5' protection sequence in the mRNA is 1-5 times, preferably 2 times.

[0007] In some embodiments, the xrRNA is derived from the 3' UTR of a flavivirus.

[0008] In some embodiments, the flavivirus is selected from Cell-fusing agent virus (CFAV), Dengue virus (DENV), Usutu virus (USUV), Yellow fever virus (YFV), or Zika virus (ZIKV).

[0009] In some embodiments, the 3’UTR of the flavivirus comprises the nucleotide sequence shown in any one of SEQ ID NO:12-16.

[0010] In some embodiments, the xrRNA comprises the nucleotide sequence shown in any one of SEQ ID NO:1, SEQ ID NO:17-33.

[0011] In some embodiments, the RNA binding protein binding motif is selected from polynucleotide polyA or other RNA binding protein binding motifs; preferably, the length of the RNA binding protein binding motif is 36-60bp; preferably, the length of the polynucleotide motif is 48bp.

[0012] In some embodiments, the xrRNA is ligated to the polyA to form an xrRNA-PolyA sequence.

[0013] In some embodiments, the xrRNA is UX1 derived from the 3’UTR of Usutu virus, and the UX1 comprises the nucleotide sequence shown in SEQ ID NO:1; the polynucleotide motif is polyA; the 5’ protective sequence xrRNA-PolyA is defined as the UPA sequence.

[0014] In some embodiments, the UPA comprises the nucleotide sequence shown in SEQ ID NO:8.

[0015] In some embodiments, the number of repetitions of the UPA in the mRNA is 1-5 times, preferably 2 times.

[0016] In some embodiments, the IRES comprises the nucleotide sequence shown in SEQ ID NO:3 or 4.

[0017] In some embodiments, the 5’UTR comprises the nucleotide sequence shown in any one of SEQ ID NO:5, 36, 37, and / or the 3’UTR comprises the nucleotide sequence shown in any one of SEQ ID NO:6, 7, 38, 39.

[0018] In some embodiments, the target protein comprises a tumor antigen, a bacterial antigen or a viral antigen.

[0019] In some embodiments, the tumor antigen is a tumor neoantigen, a tumor-associated antigen or a tumor-specific antigen.

[0020] In some embodiments, the tumor is cervical cancer or melanoma.

[0021] In some embodiments, the mRNA comprises the nucleotide sequence shown in any one of SEQ ID NO:51, 52, 54, 55.

[0022] In some embodiments, the infectious disease is caused by one or more viruses selected from HPV, HIV, EBV, and HBV.

[0023] The second aspect of the present invention provides a vector comprising the capless linear mRNA described in the first aspect of the present invention.

[0024] The third aspect of the present invention provides a cell comprising the capless linear mRNA described in the first aspect of the present invention or the vector described in the second aspect of the present invention.

[0025] The fourth aspect of the present invention provides a nano-lipid particle comprising the capless linear mRNA described in the first aspect of the present invention.

[0026] The fifth aspect of the present invention provides a pharmaceutical composition comprising the capless linear mRNA described in the first aspect of the present invention, and / or the vector described in the second aspect of the present invention, and / or the cell described in the third aspect of the present invention, and / or the nano-lipid particle described in the fourth aspect of the present invention.

[0027] In some embodiments, the pharmaceutical composition is a vaccine or other therapeutic protein.

[0028] In some embodiments, the other therapeutic proteins include antibodies, cytokines, and / or enzymes.

[0029] The sixth aspect of the present invention provides the use of the capless linear mRNA described in the first aspect of the present invention, and / or the vector described in the second aspect of the present invention, and / or the cell described in the third aspect of the present invention, and / or the nano-lipid particle described in the fourth aspect of the present invention, and / or the pharmaceutical composition described in the fifth aspect of the present invention in the preparation of drugs for tumors or infectious diseases.

[0030] In some embodiments, the tumor is cervical cancer or melanoma.

[0031] Preferably, the virus is selected from HPV, HIV, EBV, or HBV; preferably, the target protein is the HPV E6E7 fusion protein; preferably, the mRNA comprises the nucleotide sequence shown in any one of SEQ ID NO:51-56.

[0032] The advantages of the present invention over the prior art are:

[0033] 1. Two self-designed sequences, UPA and EV-A-S1 / EV-A-S2, are used to replace the 5' cap of traditional mRNA to form UPA-capped linear mRNA. The UPA-capped linear mRNA does not require a 5' cap structure and nucleotide modification, reducing production costs and simplifying the production process, and is particularly suitable for large-scale vaccine production and personalized cancer treatment.

[0034] 2. Improved mRNA stability and expression persistence: By introducing the UX1 sequence and polyA (UPA sequence) derived from the 3' UTR of flavivirus, the degradation of mRNA by the exonuclease XRN-1 is effectively blocked, enhancing mRNA stability. The design of tandem two UPA (2UPA) further enhances the persistence of in vivo expression, and its stability is even better than that of traditional capped mRNA (such as luciferase activity in mice lasting up to 120 h).

[0035] 3. Compact structure and high safety: The UX1 sequence is only 88 nt and contains only two small stem-loop structures, avoiding potential safety hazards caused by long sequences (such as sfRNA). Experiments have shown that the UPA-capped linear mRNA vaccine does not cause obvious toxicological reactions or organ damage in mice, and has good safety.

[0036] 4. Efficient translation and immune effect: EV-A-S1 and EV-A-S2 IRES can efficiently initiate the translation of capped mRNA. Combining UPA and optimized UTR sequences (such as β-globin UTR) enables efficient and stable protein expression. In a cancer treatment model, the UPA-capped linear mRNA vaccine induced a high level of tumor-specific T cells and significantly inhibited tumor growth.

[0037] 5. The UPA-E6E7 and 2UPA-E6E7 capped linear mRNA vaccines designed in the present invention exhibit good safety and cancer treatment effects in a mouse model, and have great potential for clinical application. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] By reading the detailed description of the non-limiting embodiments with reference to the following drawings, other features, objectives, and advantages of the present invention will become more apparent:

[0039] Figure 1 Schematic diagram of the design of UPA-capped linear mRNA. The 5' to 3' ends of the UPA and 2UPA capped linear mRNA sequences designed in the present invention are linearly arranged as UPA (UX1 + polyA) or 2UPA, EV-A-S1 IRES, 5' UTR, target gene, 3' UTR, and polyA tail in sequence.

[0040] Figure 2Screening of capless linear mRNA 5'-end protection structures. (A) Schematic diagram of xrRNA and Dumbbell structures and their nomenclature in the 3'-UTR of Flavivirus CFAV, DENV, USUV, YFV, and ZIKV viral genomic RNAs. (B) Comparison of luciferase activities in the cell supernatants after constructing the structure in (A) at the 5'-end of capless linear GLUC mRNA and transfecting HEK293T cells for 48 h.

[0041] Figure 3 Non-translated region sequence screening. (A) Schematic diagram of non-translated region screening. (B) Sequence screening between UX1 and EV-A-S1. (C) 3'-UTR screening. (D) 5'-UTR screening.

[0042] Figure 4 UX1 modification and nucleic acid modification. (A) Schematic diagram of the secondary structure of UX1 and Pseudoknot (PK) analyzed by SHAPE-Map. (B) Screening of UX1 mutants. (C) Three modified nucleotides, m6A, m1Ψ, and N4-Ac-C, were used for mRNA synthesis at ratios of 5%, 20%, and 100%, and the GLUC activities of these mRNAs were compared.

[0043] Figure 5 Evaluation of capless linear mRNA expression based on the UPA sequence. (A) Comparison of protein expression levels after transfecting HEK293T cells for 48 h with capless linear mRNAs of UPA, 2UPA, and 3UPA, capless linear mRNAs with only EV-A-S1 or PolyA+EV-A-S1, capped mRNA (CAP), and capped modified mRNA (mCAP). (B) The cell supernatants were collected and rinsed on days 1 to 5 after transfecting the mRNAs in (A) into Hela cells, and the GLUC activities relative to the first day in the supernatants were detected. (C) Changes in the total fluorescence values of mice over time after injecting UPA, 2UPA, mCAP, and CAP FLUC mRNAs into the mouse muscles. (D) In vivo fluorescence images of animals for the data in (C).

[0044] Figure 6Analysis of UPA intracellular binding proteins. (A) Schematic diagram of the method for analyzing UPA sequence-binding proteins: An avidin aptamer sequence is added after the UPA sequence and bound to streptavidin magnetic beads to isolate the binding proteins in Hela cells (Pull down). The differential bands are taken for mass spectrometry analysis. After finding the candidate proteins, Western blot and RNA immunoprecipitation analysis (RIP) are performed; a separate aptamer sequence is used as a control group. (B) Silver staining results of the gel after Pull down separation of proteins. (C) Verification results of candidate proteins by Western blot. (D) Verification results of candidate proteins by RIP. The values above the bar graphs indicate the enrichment multiples of the corresponding protein groups for UPA RNA relative to the control IGG group.

[0045] Figure 7 Safety assessment of UPA capless linear mRNA vaccine in mice. (A) Changes in the body weights of mice after injection of three vaccines, UPA-E6E7, 2UPA-E6E7, and mCAP-E6E7. (B) Serum ALT levels in mice before and after two doses of the vaccine. (C) Serum AST levels in mice before and after two doses of the vaccine. (D) Histological staining of the main organs of mice two weeks after the second dose of the vaccine.

[0046] Figure 8 Evaluation of the therapeutic effect of UPA capless linear mRNA tumor vaccine. (A) Tumor volume data of B16F10-OVA. (B) Changes in the body weights of mice during the same period. (C) Tumor volumes of individual mice in four groups administered with mCAP-FLUC, UPA-OVA, 2UPA-OVA, and mCAP-OVA, and pictures of the tumors dissected after euthanasia on the 20th day after tumor inoculation. The circles indicate mice without tumors. (D) Representative results and statistics of flow cytometry analysis of OVA antigen peptide (SIINFEKL) MHC tetramer-positive T cells.

[0047] Figure 9 Screening of 5' terminal protection structures of capless linear mRNA. (A) Tumor volume data of TC-1. (B) Changes in the body weights of mice during the same period. (C) Tumor volumes of individual mice in four groups administered with mCAP-FLUC, UPA-E6E7, 2UPA-E6E7, and mCAP-E6E7, and pictures of subcutaneous tumors on the 23rd day after tumor inoculation. (D) Representative results and statistics of flow cytometry analysis of IFNγ-positive T cells. Detailed implementation

[0048] Term definitions

[0049] As used herein, "xrRNA" or "exoribonuclease-resistant RNA" or "exoribonuclease-resistant RNA" is an RNA molecule that resists degradation by host exonucleases through a special three-dimensional structure and is widely present in the genomes of Flaviviridae viruses (such as dengue virus, Zika virus, West Nile virus, etc.). xrRNA forms a stable pseudoknot structure or stem-loop structure through base pairing, which hinders the degradation of exonucleases (such as Xrn1 of host cells) along the 5'→3' direction. Its nucleotide sequence is highly conserved in the Flaviviridae family and is usually located in the 3' non-coding region (3'-UTR) of the viral genomic RNA.

[0050] As used herein, "RNA binding protein binding motif" refers to a sequence on RNA to which the RNA binding protein motif binds.

[0051] Design of non-capped linear RNA

[0052] The present invention provides a method for designing uncapped linear mRNA and UPA uncapped linear mRNA designed and obtained by the method. The UPA uncapped linear mRNA of the present invention does not need to add a 5' cap or use a capping enzyme to add a cap during in vitro transcription synthesis, nor does it need to add nucleic acid modification. It can be synthesized under the catalysis of RNA polymerase using classic ribonucleotides, and can be efficiently and stably expressed. It can be used as a tumor vaccine expression system and has stronger immune induction and tumor inhibition effects than conventional mRNA.

[0053] In some embodiments, the design and optimization process of the capless linear mRNA of the present invention mainly includes the following steps:

[0054] 1) First, the structure UX1 that protects uncapped linear mRNA in the 3'UTR of flavivirus was screened and obtained, and it was combined with EV-A-S1 IRES to design uncapped linear mRNA.

[0055] 2) The untranslated region sequence of the uncapped linear mRNA was further screened and optimized, and it was determined that the combination of UX1 and PolyA (UPA) at the 5' end could achieve the highest expression level of the uncapped linear mRNA.

[0056] 3) The protein expression levels and stability of UPA uncapped linear mRNA, uncapped linear mRNA without UPA sequence, and CleanCap capped linear mRNA were evaluated and compared in cell lines and mice. It was found that the protein expression level and stability of two tandem UPA (2UPA) uncapped linear mRNA in cell lines were close to those of capped mRNA, and it had better expression stability in mice.

[0057] 4) Further evaluate the safety of the UPA uncapped linear mRNA vaccine. The results show that the vaccine does not cause obvious toxicological changes in mice. Finally, use the UPA uncapped linear mRNA vaccine to treat B16F10-OVA and HPV-related TC-1 mouse tumors, and it is found that the UPA uncapped linear mRNA vaccine induces a high level of tumor-specific immunity and significantly inhibits tumor growth.

[0058] In some embodiments, the UPA uncapped linear mRNA of the present invention is as shown in the appendix. Figure 1 The sequences of the UPA uncapped linear mRNA from 5' to 3' are respectively UX1 (an xrRNA sequence of Usutu virus USUV) (SEQ ID NO: 1), polyA (polyadenylate sequence) (SEQ ID NO: 2), EV-A-S1 or EV-A-S2 (engineered enterovirus EV-A IRES) (SEQ ID NO: 3, 4), 5'UTR (such as SEQ ID NO: 5 or others), target gene (drug protein or vaccine), 3'UTR (3' untranslated region sequence) (such as SEQ ID NO: 6, 7 or others), polyA tail (polyadenylate tail) (SEQ ID NO: 10). Among them, the functions of the UX1 and polyA sequences are to bind proteins in the cell to stabilize the uncapped linear mRNA and prevent degradation by the XRN-1 enzyme; while the function of EV-A-S1 is to initiate the translation of the uncapped linear mRNA to efficiently express the target gene. The UX1 sequence is only 88 nt in length and only contains two relatively small stem-loop structures.

[0059] In the present invention, the combination of protective UX1 and polyA is called the UPA sequence (SEQ ID NO: 8), and this cap-independent linear mRNA is called the UPA uncapped linear mRNA. After the UPA sequence at the 5' end of the UPA uncapped linear mRNA adopts 2 repeated UPA sequences (2UPA (SEQ ID NO: 9)), its intracellular stability is further improved, it can express the target gene more continuously and stably, and achieve better drug effects.

[0060] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the described embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.

[0061] Unless otherwise defined, the technical terms or scientific terms used herein shall have the ordinary meanings as understood by those of ordinary skill in the art to which the present invention pertains.

[0062] Example 1 Synthesis of UPA-capped linear mRNA

[0063] Construction of UPA-capped linear mRNA plasmid: The T7 promoter (SEQ ID NO: 11), UPA (SEQ ID NO: 8) or 2UPA sequence (SEQ ID NO: 9), EV-A-S1 IRES (SEQ ID NO: 3), human β-globin 5’UTR (SEQ ID NO: 5), the target gene, human HBA1 3’UTR (SEQ ID NO: 6), and a 105-nt long poly(A) sequence were inserted into the pUC57 plasmid to serve as the template plasmid for UPA-capped linear mRNA. The DNA fragments were synthesized by GenScript and amplified by PCR. The seamless cloning step was completed using the ClonExpress II One Step Cloning Kit from Novoprotein.

[0064] In vitro transcription synthesis of UPA-capped linear mRNA: Using the T7 High Yield RNA Synthesis Kit from Yeasen Biotech Co., Ltd., ATP, UTP, CTP, GTP and 10× Transcription Buffer were sequentially mixed, the linearized template plasmid DNA (500 ng was added to each 20 μl reaction system) and T7 RNA Polymerase Mix were added, and an appropriate amount of RNase Free Water was added and then mixed. The reaction was carried out at 37 °C for 2 h. The RNA was purified and quality inspected.

[0065] In vitro transcription synthesis of capped linear mRNA: All capped linear mRNA templates were constructed using the mRNA Template Cloning Kit (Takara Bio., catalog number 6143) from Takara Bio. The template plasmid in this kit contains the T7 promoter, human β-globin 5’UTR, human HBA1 3’UTR, and a 105-nt long poly(A) sequence. Using the T7 High Yield RNA Synthesis Kit for Co-transcription from Yeasen Biotech, ATP, N1-Me-Pseudo UTP (modified) or UTP (unmodified), CTP, GTP, and cap1 m7GAG cap were sequentially mixed, along with 10× Transcription Buffer. Linearized template plasmid DNA (500 ng added to a 20-μl system) and T7 RNA Polymerase Mix were added. After adding an appropriate amount of RNase Free Water and mixing, the reaction was carried out at 37 °C for 2 h. The RNA was purified and quality tested.

[0066] Example 2 Screening for the 5’-end protection structure of uncapped linear mRNA

[0067] Previously, the inventors designed the EV-A-S1 IRES through large-scale screening and engineering, which can replace the 5’ cap structure of traditional mRNA and efficiently initiate the translation of the target protein. However, another function of the linear mRNA cap is to hinder the degradation of the major intracellular RNA 5’ exonuclease XRN-1 and achieve stable expression of mRNA. Therefore, it is also necessary to find a sequence with a similar hindering effect to be combined with the EV-A-S1 IRES for constructing a stable-expressing linear mRNA without capping. According to literature reports, there are structures in the 3’UTR of flavivirus genomic RNA that can hinder XRN-1 degradation, including the xrRNA structure and the Dumbbell structure. Therefore, the inventors used RNAfold to analyze the secondary structures of the 3’UTR sequences (SEQ ID NO: 12-16) of five flaviviruses, CFAV, DENV, USUV, YFV, and ZIKV, and found a total of 18 xrRNA and Dumbbell-type structures among them ( Figure 2A) (SEQ ID NO: 1, 17 - 33), and these structures were each constructed at the 5'-most end of the linear Gaussian luciferase (GLUC) mRNA with EV-A-S1 IRES (separated from EV-A-S1 IRES by polyA to avoid interference between secondary structures). By comparing the luciferase activities in the cell supernatants after transfection of these capless linear mRNAs into HEK239T cells for 48 h (using the CALNP mRNA reagent from Beijing Dona Medicine to transfect the cells and the Beyotime Gaussian luciferase reporter gene detection kit to detect luciferase activities), the inventors found that when the five structures UX1, DX1, ZX1, DD1, and DX2 were used at the 5'-end of the capless linear mRNA, the luciferase expression level was significantly higher than that of the capless linear mRNA without a protective structure before EV-A-S1 IRES ( Figure 2 B). Among them, when UX1 from USUV (Usutu virus) was added before EV-A-S1 IRES, the luciferase expression level was increased to about 6.5 times that of the non-protected structure group. The above results indicate that adding certain flavivirus 3'-UTR structures at the 5'-end of capless linear mRNA indeed improves the expression level of capless linear mRNA. Among them, the UX1 (SEQ ID NO: 1) structure has the greatest effect on enhancing the expression level of capless linear mRNA.

[0068] UX1 (SEQ ID NO: 1)

[0069] aatttgatagtcaggccagggcaacctgccaccggaagttgagtagacggtgctgcctgcgactcaaccccaggc ggactgggttagc (SEQ ID NO: 1)

[0070] Example 3 Screening of Untranslated Region Sequences, Modification of UX1, and Nucleic Acid Modification

[0071] After the previous screening, the inventors used the most efficient UX1 as the 5'-end protection sequence of the capless linear mRNA. To further optimize the expression level of capless linear mRNA, the inventors also screened the spacer sequence between UX1 and EV-A-S1 IRES, and the 5' and 3' untranslated region sequences of the mRNA using capless linear GLUC mRNA ( Figure 3 A). The results showed that adding polyA between UX1 and EV-A-S1 significantly increased the luciferase expression level compared to no sequence or adding other poly sequences such as PolyC (SEQ ID NO: 34) and PolyT (SEQ ID NO: 35). Figure 3B). Then, the inventors compared the differences in the effects of several 5’UTR (SEQ ID NO:5, 36, 37) and 3’UTR (SEQ ID NO:6, 7, 38, 39) sequences when used in capless linear mRNAs, and found that the translation efficiency of the capless linear mRNA with both the 3’UTR and 5’UTR being the UTRs of β-globin was the highest ( Figure 3 C, 3D).

[0072] Previous studies have shown that the inhibitory effect of xrRNA on XRN-1 is regulated by the pseudoknot in its structure. Therefore, modifying the pseudoknot structure of UX1 may further enhance its effect in capless linear mRNAs. To verify this hypothesis, first, the SHAPE-Map technique was used to analyze the secondary structure of UX1, and the IPknot software was used to analyze the pseudoknot structure of UX1, and it was found that UX1 has two pseudoknot structures, PK1 and PK2 ( Figure 4 A). Mutants of UX1 with extended pseudoknot sequences (Long-PK1 (SEQ ID NO:40), Long-PK2 (SEQ ID NO:41)) or increased GC ratio of PK2 (mPK2 (SEQ ID NO:42)) were designed. Verification in capless linear GLUC mRNA showed that the expression of capless linear GLUC was decreased rather than enhanced by the three mutants ( Figure 4 B). This indicates that simply modifying the length or GC ratio of the pseudoknot cannot enhance the effect of UX1, but may instead change the stability of the overall structure of UX1.

[0073] Nucleic acid modifications such as pseudouridine can regulate the stability and translation efficiency of mRNAs. Therefore, attempts were made to introduce nucleic acid modifications into capless linear mRNAs and evaluate their protein expression levels. Different proportions of the modified nucleotides m6A, m1Ψ, and N4-Ac-C were incorporated during the in vitro transcription of capless linear GLUC mRNA, and the activity of GLUC luciferase was detected 48 h after transfection of HEK293T cells. The results showed that the expression of capless linear GLUC mRNA decreased as the proportions of the three nucleic acid modifications increased ( Figure 4 C). This may be because the functions of both UX1 and EV-A-S1 IRES in capless linear mRNAs rely on the formation of special secondary structures, and the introduction of non-classical nucleotides changes the secondary structures of these sequences and disrupts their functions.

[0074] Example 4 Evaluation of Capless Linear mRNA Expression Based on the UPA Sequence

[0075] Based on the previous experimental results, it was determined that the uncapped linear mRNA with the UX1 plus PolyA sequence (subsequently referred to as the UPA sequence) at the 5' end had the highest protein expression level. Next, uncapped linear mRNAs with one (UPA) (SEQ ID NO: 43), two (2UPA) (SEQ ID NO: 44), and three (3UPA) (SEQ ID NO: 45) tandem UPA sequences at the 5' end were designed. These UPA-uncapped linear mRNAs were compared with the CleanCap technology-capped linear mRNAs (unmodified CAP and m1Ψ-modified mCAP) (SEQ ID NO: 48) and the uncapped linear mRNAs without UPA (pA-EV-A-S1 (SEQ ID NO: 46), EV-A-S1 (SEQ ID NO: 47)). It was found that the introduction of UPA did significantly enhance the expression of uncapped linear mRNA, but the expression level was still slightly lower than that of the CleanCap technology-capped linear mRNA( Figure 5 A). Comparing multiple tandem UPA-uncapped linear mRNAs, the inventors found that the uncapped linear mRNA with two tandem UPA had the highest expression level( Figure 5 A). The stability of the uncapped linear mRNA based on the UPA sequence for long-term protein expression in the Hela cell line was further explored. The results showed that the expression stabilities of the 2UPA and 3UPA uncapped linear mRNAs in cells were comparable and basically consistent with that of the CleanCap technology-capped linear mRNA. The stability of the single UPA uncapped linear mRNA was slightly lower than that of the capped mRNA, while the expression stability of the uncapped linear mRNA with only PolyA and EV-A-S1 or only EV-A-S1 was significantly lower than that of other mRNAs( Figure 5 B). To further evaluate the ability of the UPA-uncapped linear mRNA drug to express drug proteins in mammals, the UPA, 2UPA uncapped linear FLUC (firefly luciferase) mRNA and CAP, mCAP FLUC mRNA encapsulated by SM102 LNP were injected into the muscles of BALB / c mice. Different from the results in Hela cells, the luciferase activity in the mice was continuously detected up to 120 h. It was found that the luciferase level of the 2UPA uncapped linear FLUC was continuously higher than that of the two modified mRNAs mCAP FLUC and the unmodified CAP FLUC from 48 h to 120 h( Figure 5 C, 5D).

[0076] In summary, the tandem of the UPA sequence significantly enhances the protein expression stability of uncapped linear mRNA. The uncapped linear mRNA with two tandem UPA sequences has a stronger ability to continuously express proteins in mammals than the m1Ψ-modified CleanCap-capped linear mRNA.

[0077] Example 5 Analysis of Binding Proteins of UPA Sequence in Cells

[0078] As a synthetic viral sequence, the UPA sequence may interact with some proteins in human cells and affect the function and safety of UPA uncapped linear mRNA. Therefore, an RNA sequence of UPA+avidin aptamer (SEQ ID NO:49) and a control of avidin aptamer alone (SEQ ID NO:50) were designed to isolate the binding proteins in Hela cell lysate and analyze (RIP) and verify the interaction between the UPA sequence and them by mass spectrometry, Western blot, and RNA immunoprecipitation ( Figure 6 A, 6B). After mass spectrometry detected these differential proteins such as YBX1, PABPC1, ILF2, ILF3, IGF2BP1, EIF2AK2, DDX3X, and HNRNPR, the inventors verified them by Western blot. The results showed that the UPA sequence was indeed enriched in these 7 proteins, namely YBX1, PABPC1, ILF2, ILF3, IGF2BP1, EIF2AK2, and HNRNPR, but not in DDX3X. Further, the RIP experiment was used to verify the binding of RNA to these proteins in living cells, and it was found that all 7 proteins except HNRNPR were enriched in UPA RNA. HNRNPR is mainly distributed in the nucleus rather than the cytoplasm, which may explain why it was not enriched in the UPA RNA transfected into the cytoplasm. These data show that the UPA sequence interacts with these proteins, namely YBX1, PABPC1, ILF2, ILF3, IGF2BP1, and EIF2AK2, in living cells. Among these proteins, ILF2, ILF2, and EIF2AK2 are all proteins related to immune regulation, and their binding to UPA may affect the immune induction ability of UPA uncapped linear mRNA. PABPC1 is a PolyA binding protein that can stabilize RNA and promote translation, so it can bind to the polyA of the UPA sequence to enhance the stability and translation level of UPA uncapped linear mRNA. YBX1 and IGF2BP1 are common RNA binding proteins that have the function of stabilizing RNA, and their interaction with UPA may further stabilize UPA uncapped linear mRNA. The above results show that the UPA sequence may not only stabilize RNA by blocking XRN-1, but also stabilize RNA by binding to RNA binding proteins and regulate the recognition and immune induction of RNA.

[0079] Example 5 Safety Evaluation of UPA Uncapped Linear mRNA Vaccine in Mice

[0080] The previous data description shows that the design of 2UPA plus EV-A-S1 endows uncapped linear mRNA with a translation level similar to that of CleenCap-capped mRNA with a capping efficiency of approximately 95%, and even better in vivo sustained expression ability. Uncapped linear mRNA omits the step of capping linear mRNA, which not only simplifies production, but more importantly, breaks through the technical barriers of mRNA capping and cap analogs. However, considering that both the triphosphate end and the virus-derived sequence of uncapped linear mRNA have certain immunostimulatory properties, evaluating the safety of uncapped linear mRNA is also a crucial step in the development process. Therefore, an uncapped linear mRNA HPV E6E7 fusion protein vaccine with potential clinical application was designed, and the safety of the vaccine was evaluated in mice. The inventors injected three groups of C57BL / 6 mice into the muscle with 5 μg RNA / dose / mouse of UPA-E6E7 (SEQ ID NO:51), 2UPA-E6E7 (SEQ ID NO:52) uncapped linear mRNA LNP vaccine (SM102), and capped modified mCAP-E6E7 (SEQ ID NO:53) mRNA LNP vaccine (SM102), and a homologous booster vaccine of 5 μg RNA / dose / mouse was injected one week later. During this period, the body weight of the mice and the levels of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were monitored. The results showed that the body weight changes of the three groups of mice administered within one week after the first and booster vaccinations were not significantly different from those of the untreated group ( Figure 7 A). At the same time, the serum ALT and AST levels of the mice in the administered group on the 7th day after the first and booster vaccinations also showed no significant changes compared with those before administration or in the untreated group ( Figure 7 B, 7C). Finally, the mice were euthanized two weeks after the booster vaccination, and the main internal organs were collected for histological staining. The histological results showed that there were no obvious drug-related pathological features in the hearts, livers, spleens, lungs, and kidneys of the mice in the administered group ( Figure 7 D). The above results indicate that the uncapped linear mRNA vaccines of UPA and 2UPA have good safety in mice when administered twice at 5 μg RNA / dose / mouse.

[0081] Example 6 Evaluation of the Therapeutic Effect of UPA Uncapped Linear mRNA Tumor Vaccine

[0082] Four groups of C57BL / 6 mice were subcutaneously injected with B16F10-OVA tumor cells, and on the third and tenth days after cell injection, 3 μg RNA / dose / mouse of UPA, 2UPA uncapped linear mRNA vaccines encoding OVA antigen (UPA-OVA (SEQ ID NO:54), 2UPA-OVA (SEQ ID NO:55)), and modified capped mCAP mRNA vaccine (mCAP-OVA (SEQ ID NO:56)), as well as mCAP FLUC (mCAP-FLUC) as a control, were intramuscularly injected. The tumor volumes of the mice were continuously measured from the 3rd to 20th day after cell inoculation, and it was found that the tumor growth of the mice administered with the three OVA vaccines was significantly slower than that of the control group mice, and the tumor growth in the 2UPA-OVA group was the slowest ( Figure 8 A, 8C). At the same time, the measured results of the body weights of the mice showed that no abnormal changes in the body weights of the mice were observed after administration of UPA, 2UPA uncapped linear mRNA vaccines, and modified capped mRNA vaccines, further demonstrating the safety of UPA uncapped linear mRNA vaccines ( Figure 8 B). To compare the intensity of tumor antigen T cell immunity induced by the vaccines, the peripheral blood of the mice was collected one week after the second immunization to detect the proportion of T cells targeting OVA antigen in PBMC. The results of flow cytometry analysis showed that compared with the control group, the three OVA vaccines significantly induced a high level of OVA antigen-specific T cells (average proportion of T cells positive for OVA antigen peptide (SIINFEKL, SEQ ID NO:57) MHC tetramer: UPA-OVA 15.8%; 2UPA-OVA 22.9%; mCAP-OVA 19.1%; mCAP-FLUC 0.7%) ( Figure 8 D). Consistent with the tumor growth inhibition effect, the average proportion of tumor OVA antigen-specific T cells in the 2UPA-OVA group was the highest. These results show that the UPA-based uncapped linear mRNA tumor vaccine has good specific immune induction effect and tumor treatment effect.

[0083] Example 7 Evaluation of the Therapeutic Effect of UPA Uncapped Linear mRNA HPV E6E7 Vaccine on HPV-Related Tumors

[0084] Human papillomavirus HPV is closely related to the occurrence of various cancers such as cervical cancer, anal cancer, and oropharyngeal cancer, and the tumor cells of these cancers usually express proteins such as HPV E6 and E7. Therefore, the HPV E6E7 UPA uncapped linear mRNA vaccine designed by the inventor has potential clinical value for the treatment of HPV-related tumors. To explore the tumor treatment effect of the vaccine, TC-1 cells expressing HPV E6 and E7 proteins were subcutaneously injected into C57BL / 6 mice, and when the tumors grew to the ninth day, the average tumor volume was about 50 mm3 At that time, several vaccines, namely UPA-E6E7, 2UPA-E6E7, and mCAP-E6E7 (3 μg / dose / animal), were injected. The results showed that after two immunizations, the tumor volumes of the mice administered with the three E6E7 vaccines continued to decrease significantly, while the tumor volumes of the control group mice continued to increase ( Figure 9 A, 9C). The stable increase in the body weights of the mice during the same period also indicated that the UPA-capped linear mRNA HPV E6E7 vaccine had good safety ( Figure 9 B). One week after the second vaccination, the mouse PBMCs were isolated and stimulated with antigenic peptides derived from E6 and E7 (GenScript Biotech) to analyze the proportions of E6- and E7-specific T cells among them. The results showed that all three E6E7 vaccines successfully induced a high proportion of antigen-specific T cells (average proportion of IFNγ-positive T cells: UPA-OVA 9.6%; 2UPA-OVA 15.5%; mCAP-OVA 13.6%; mCAP-FLUC 0.1%) ( Figure 9 D). Among them, the 2UPA-E6E7 vaccine induced the highest proportion of antigen-specific T cells, which was significantly higher than that of the UPA-E6E7 vaccine group, indicating that two tandem UPA sequences significantly enhanced the immune effect of the UPA-capped linear mRNA vaccine. The above results indicate that the UPA-based capped linear mRNA HPV E6E7 vaccine can efficiently induce antigen-specific T cell immunity and treat HPV-related tumors, showing great potential for clinical application.

[0085] References:

[0086] 1. Baden LR, El Sahly HM, Essink B, et al. Efficacy and Safety of the mRNA-1273 SARS-CoV-2 Vaccine. N Engl J Med. 2021;384(5):403-416. doi:10.1056 / NEJMoa2035389

[0088] 2. Pardi N, Krammer F. mRNA vaccines for infectious diseases - advances, challenges and opportunities. Nat Rev Drug Discov. 2024;23(11):838-861. doi:10.1038 / s41573-024-01042-y

[0090] 3. Liu C, Shi Q, Huang X, Koo S, Kong N, Tao W. mRNA-based cancer therapeutics. Nat Rev Cancer. 2023;23(8):526-543. doi:10.1038 / s41568-023-00586-2

[0092] 4. Weber JS, Carlino MS, Khattak A, et al. Individualised neoantigen therapy mRNA-4157(V940) plus pembrolizumab versus pembrolizumab monotherapy in resected melanoma (KEYNOTE-942): a randomised, phase 2b study. Lancet. 2024;403(10427):632-644. doi:10.1016 / S0140-6736(23)02268-7

[0096] 5. Rojas LA, Sethna Z, Soares KC, et al. Personalized RNA neoantigen vaccines stimulate T cells in pancreatic cancer. Nature. 2023;618(7963):144-150. doi:10.1038 / s41586-023-06063-y

Claims

1. A capless linear mRNA, characterized in that, In sequence from 5' to 3', it includes: 1 - 5 tandem 5' protection sequences, IRES, 5' UTR, coding region of the target protein, 3' UTR, and optionally a polyA tail; wherein the 5' protection sequence includes an exonuclease-resistant RNA (xrRNA) and / or an RNA-binding protein binding motif.

2. The mRNA according to claim 1, wherein The xrRNA is derived from the 3' UTR of flavivirus; preferably, the flavivirus is selected from Cell-fusing agent virus (CFAV), Denguevirus (DENV), Usutu virus (USUV), Yellow fever virus (YFV), or Zika virus (ZIKV); preferably, the 3' UTR of the flavivirus contains the nucleotide sequence shown in any one of SEQ ID NO: 12 - 16; preferably, the xrRNA contains the nucleotide sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 17 - 33.

3. The mRNA according to claim 1, the RNA-binding protein binding motif of the 5' protection sequence is selected from the polynucleotide motif polyA or other RNA-binding protein binding motifs; the length of the RNA-binding protein binding motif is 36 - 60 bp; preferably, the polynucleotide motif contains the nucleotide sequence shown in SEQ ID NO: 2; preferably, the polynucleotide motif is a polyadenylic acid (polyA) with a length of 48 bp.

4. The mRNA according to any one of claims 1 - 3, the xrRNA is UX1 derived from the 3' UTR of Usutu virus, and the UX1 contains the nucleotide sequence shown in SEQ ID NO: 1; the RNA-binding protein binding motif is polyA; the 5' protection sequence is the UPA sequence; preferably, the UPA contains the nucleotide sequence shown in SEQ ID NO:

8.

5. The mRNA according to claim 4, the number of repetitions of the UPA in the mRNA is 1 - 5 times, preferably 2 times.

6. The mRNA according to any one of claims 1 - 5, the IRES contains the nucleotide sequence shown in SEQ ID NO: 3 or 4, the 5' UTR contains the nucleotide sequence shown in any one of SEQ ID NO: 5, 36, 37, and / or the 3' UTR contains the nucleotide sequence shown in any one of SEQ ID NO: 6, 7, 38, 39.

7. The mRNA according to any one of claims 1-6, wherein the target protein comprises a tumor antigen, a bacterial antigen or a viral antigen; preferably, the tumor antigen is a tumor-associated antigen or a tumor-specific antigen; preferably, the tumor is cervical cancer or melanoma; preferably, the virus is selected from HPV, HIV, EBV or HBV; preferably, the target protein is an HPV E6E7 fusion protein; preferably, the mRNA comprises the nucleotide sequence shown in any one of SEQ ID NO: 51, 52, 54, 55.

8. A composition, characterized in that, The composition comprising the mRNA according to any one of claims 1-7, and the form thereof is selected from at least one of a vector, a cell, and a nano-lipid particle.

9. A pharmaceutical composition, characterized in that, The composition according to claim 8, and the dosage form thereof is a vaccine or a therapeutic protein preparation, preferably, the therapeutic protein comprises an antibody, a cytokine or an enzyme.

10. Use of the mRNA according to any one of claims 1-7, the composition according to claim 8 or the pharmaceutical composition according to claim 9 in the preparation of a therapeutic drug for tumors or infectious diseases; preferably, the tumors include cervical cancer and melanoma; preferably, the infectious disease is caused by one or more viruses selected from HPV, HIV, EBV and HBV.

Images