Recombinant yarrowia lipolytica with high yield of sclareol as well as preparation method and application of recombinant yarrowia lipolytica
By introducing specific genes into Yarrow's lipolytic strains and knocking out the DGA2 gene, the metabolic pathway was optimized, and the problem of low yield of fermentation of recombinant Yarrow's lipolytic preparation was solved, and efficient scentel production was achieved.
Patent Information
- Application Number
- CN202510477188.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-16
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2045-04-16
AI Technical Summary
In the prior art, the yield of recombinant Yarrowia lipolytica is low in fermentation of syrup perilla, resulting in the problem of waste of plant resources and high production costs.
By constructing a recombinant Yarrowia lipolytic strain, an expression cassette containing tPaGGPPS, SsSCS, SsLPPS, ERG19, ERG13, ERG12, ERG8 and CAT2 gene was introduced, and the DGA2 gene was knocked out to optimize its metabolic pathway and improve the synthesis ability of perilla sulfol.
The fermentation production of perilla perilla has been significantly increased to 2747.50mg/L, solving the problem of low yield and reducing production costs.
Smart Images

Figure CN120330072A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of genetic engineering, and in particular to a recombinant Yarrowia lipolytica capable of producing high levels of sclareol, and a preparation method and application thereof. Background Art
[0002] Sclareol (C 20 H 36 O2), scientific name (1R,2R,8aS)-decahydro-1-(3-hydroxy-3-methyl-4-pentenyl)-2,5,5,8a-tetramethyl-2-naphthol, is a semi-floral-type diterpene alcohol compound. It is a white crystalline powder at room temperature with a faint ambergris aroma. It is relatively stable in alkaline environments and mainly exists in Salvia Sclarea in nature. At present, sclareol is mainly extracted from the flowers and leaves of the herbaceous plant Sclarea sclarea of the Lamiaceae family native to southern Europe by steam distillation and extraction in industry. The content of sclareol in Salvia sclarea, the main plant source of sclareol, is not high. As an important plant-based flavor and fragrance, sclareol is the synthetic raw material of ambroxan, a substitute for ambergris. It also has anti-inflammatory, antibacterial, anti-cancer, and choleretic effects. It is widely used in the food, cosmetics and pharmaceutical industries and has great value.
[0003] The plant extraction method of sclareol from Salvia miltiorrhiza has a large demand for raw materials and is prone to waste of plant resources. Salvia miltiorrhiza has a long growth cycle and is easily affected by external factors such as geographical environment and climate change. In addition, the chemical composition of the plant is complex, making it difficult to obtain pure sclareol products, making the commonly used extraction and separation methods costly, and the yield and purity are low.
[0004] Microbial fermentation has a short growth cycle and can produce around the clock with stable yields, which can meet the growing market demand. The oil-producing yeast Yarrowia lipolytica can utilize a variety of cheap carbon sources such as glucose, fructose, and glycerol, has a sufficient acetyl-CoA pool and exogenous protein secretion ability, and is generally regarded as safe (GRAS). However, the yield of sclareol produced by recombinant Yarrowia lipolytica fermentation is currently low, so it is urgent to develop genetically engineered Yarrowia lipolytica strains with high sclareol production. Summary of the invention
[0005] The purpose of the present invention is to provide a recombinant Yarrowia lipolytica with high sclareol production, and a preparation method and application thereof, so as to solve the problems existing in the above-mentioned prior art. The ability of the recombinant Yarrowia lipolytica provided by the present invention to produce sclareol by fermentation is significantly improved, and the production of sclareol by fermentation can be greatly increased by using it.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides a recombinant Yarrowia lipolytica with high yield of sclareol. The initial strain of the recombinant Yarrowia lipolytica is Yarrowia lipolytica, and an expression cassette containing geranylgeranyl pyrophosphate synthase tPaGGPPS gene, sclareol synthase SsSCS gene, copalyl diphosphate synthase SsLPPS gene, pyrophosphate mevalonate decarboxylase ERG19 gene, 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 gene, mevalonate kinase ERG12 gene, phosphomevalonate kinase ERG8 gene, and carnitine O-acetyltransferase CAT2 gene is introduced. At the same time, the diacylglycerol acyltransferase DGA2 gene is knocked out to obtain the recombinant Yarrowia lipolytica;
[0008] The nucleotide sequence of the geranylgeranyl pyrophosphate synthase tPaGGPPS gene is as shown in SEQ ID NO.1; the nucleotide sequence of the sclareol synthase SsSCS gene is as shown in SEQ ID NO.2; the nucleotide sequence of the copalyl diphosphate synthase SsLPPS gene is as shown in SEQ ID NO.3.
[0009] Preferably, the copy number of the sclareol synthase SsSCS gene is 4 copies, and the copy number of the copalyl diphosphate synthase SsLPPS gene is 4 copies.
[0010] Preferably, the accession number of the pyrophosphate mevalonate decarboxylase ERG19 gene is GeneID: 2907970, the accession number of the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 gene is GeneID: 2907642, the accession number of the mevalonate kinase ERG12 gene is GeneID: 2906793, the accession number of the phosphomevalonate kinase ERG8 gene is GeneID: 2912386, the accession number of the carnitine O-acetyltransferase CAT2 gene is GeneID: 2906787, and the accession number of the diacylglycerol acyltransferase DGA2 gene is GeneID: 2910950.
[0011] Preferably, the Yarrowia lipolytica is Yarrowia lipolytica Po1f-tHEI.
[0012] Preferably, the promoter of the expression cassette is PFBAin, Php4d or PTEFin, and the terminator is Tsynth7t or Txpr2t.
[0013] The present invention provides a method for constructing the above-mentioned engineering bacteria, comprising the following steps:
[0014] An expression cassette containing the geranylgeranyl pyrophosphate synthase tPaGGPPS gene, the sclareol synthase SsSCS gene, the ent-kaurene-diphosphate synthase SsLPPS gene, the diphosphomevalonate decarboxylase ERG19 gene, the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 gene, the mevalonate kinase ERG12 gene, the phosphomevalonate kinase ERG8 gene, and the carnitine O-acetyltransferase CAT2 gene is introduced into the initial strain in the form of a plasmid, and the diacylglycerol acyltransferase DGA2 gene is knocked out to obtain the recombinant Yarrowia lipolytica yeast.
[0015] Preferably, the copy number of the sclareol synthase SsSCS gene is 4 copies, and the copy number of the ent-kaurene-diphosphate synthase SsLPPS gene is 4 copies;
[0016] The accession number of the diphosphomevalonate decarboxylase ERG19 gene is GeneID: 2907970, the accession number of the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 gene is GeneID: 2907642, the accession number of the mevalonate kinase ERG12 gene is GeneID: 2906793, the accession number of the phosphomevalonate kinase ERG8 gene is GeneID: 2912386, the accession number of the carnitine O-acetyltransferase CAT2 gene is GeneID: 2906787, and the accession number of the diacylglycerol acyltransferase DGA2 gene is GeneID: 2910950.
[0017] Preferably, the Yarrowia lipolytica yeast is Yarrowia lipolytica Po1f-tHEI;
[0018] The promoter of the expression cassette is PFBAin, Php4d or PTEFin, and the terminator is Tsynth7t or Txpr2t.
[0019] The present invention provides the application of the above-mentioned recombinant Yarrowia lipolytica yeast in the production of sclareol.
[0020] The present invention provides a method for producing sclareol, comprising the step of fermenting and producing sclareol by using the above-mentioned recombinant Yarrowia lipolytica yeast.
[0021] The present invention discloses the following technical effects:
[0022] By analyzing the metabolic principle of Yarrowia lipolytica, the key metabolic pathway for the production of sclareol was regulated, and eight recombinant strains CJ-1, CJ-2, CJ-3, CJ-4, CJ-5, CJ-6, CJ-7 and CJ-8 were designed and constructed. Among them, CJ-1 overexpresses the tPaGGPPS gene and the SsSL gene; CJ-2 overexpresses the tPaGGPPS gene and two copies of the SsSL gene (SsSCS gene and SsLPPS gene); CJ-3 overexpresses the tPaGGPPS gene, two copies of the SsSL gene, ERG19 gene and ERG13 gene; CJ-4 overexpresses the tPaGGPPS gene, two copies of the SsSL gene, ERG19 gene, ERG13 gene, ERG12 gene and ERG8 gene; CJ-5 overexpresses the tPaGGPPS gene, two copies of the SsSL gene, ERG19 gene, ERG13 gene, ERG12 gene, ERG8 gene and CAT2 gene; CJ-6 overexpresses the tPaGGPPS gene, two copies of the SsSL gene, ERG19 gene, ERG13 gene, ERG12 gene, ERG8 gene and CAT2 gene while knocking out the DGA2 gene; CJ-7 overexpresses the tPaGGPPS gene, three copies of the SsSL gene, ERG19 gene, ERG13 gene, ERG12 gene, ERG8 gene and CAT2 gene while knocking out the DGA2 gene; CJ-8 overexpresses the tPaGGPPS gene, four copies of the SsSL gene, ERG19 gene, ERG13 gene, ERG12 gene, ERG8 gene and CAT2 gene while knocking out the DGA2 gene. Compared with the initial strain Yarrowia lipolytica Po1f-tHEI and the recombinant strains CJ-1-CJ-7, the recombinant strain CJ-8 can ferment and synthesize sclareol and its synthesis ability is significantly improved. The sclareol yield of the recombinant strain CJ-8 reaches 2747.50 mg / L. In summary, the ability of the recombinant Yarrowia lipolytica provided by the present invention to ferment and produce sclareol is significantly improved. Using it for sclareol fermentation production can greatly increase the yield of sclareol. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 It is the biosynthetic metabolic pathway diagram of sclareol in Yarrowia lipolytica;
[0024] Figure 2 It is the GC-MS detection spectrum of the sclareol standard product and the sclareol produced by (a) the recombinant strain CJ-8 (b) after 6 days of fermentation. DETAILED DESCRIPTION OF THE INVENTION
[0025] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and implementation schemes of the present invention.
[0026] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0027] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0028] Without departing from the scope or spirit of the present invention, various improvements and variations can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.
[0029] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.
[0030] The present invention regulates the key metabolic pathway for producing sclareol by analyzing the metabolic principle of Yarrowia lipolytica ( Figure 1 ), designs and constructs eight recombinant strains to increase the yield of sclareol produced by Yarrowia lipolytica fermentation, which is specifically described in detail as follows:
[0031] The medium formulations used in the following examples are as follows:
[0032] Yeast screening medium YNB - URA: 10 g / L glucose, 6.7 g / L Yeast Nitrogen Base (YNB), 0.5 g / L uracil (URA), and 20 g / L agar powder.
[0033] Yeast screening medium YNB: 10 g / L glucose, 6.7 g / L Yeast Nitrogen Base (YNB), and 20 g / L agar powder.
[0034] YPD liquid medium: 20 g / L glucose, 20 g / L peptone, and 10 g / L yeast extract.
[0035] YPD solid medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, and 20 g / L agar powder.
[0036] YPD fermentation medium: 60 g / L glucose, 40 g / L peptone, and 20 g / L yeast powder.
[0037] 5-FOA-YPD solid medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast powder, 1 g / L 5-fluoroorotic acid (5-FOA), and 20 g / L agar powder.
[0038] The accession numbers of each gene in the following examples in NCBI are shown in Table 1:
[0039] Table 1
[0040]
[0041] The geranylgeranyl pyrophosphate synthase tPaGGPPS gene is derived from Phomopsis amygdali del., and its accession number in NCBI is A2PZA5. It retains the amino acid sequence from 390 to 719 of PaGGPPS and is obtained by codon optimization. Its nucleotide sequence is as shown in SEQ ID No.1, specifically: ATGCTGTCCACCGGCCTGTCCCTGTCCCCCGTGCACTCTAACGAGGGCAAGGACCTGCAGCGAGTCGACACCGACCACATCTTCTTCGAGAAGGCCGTGCTGGAGGCCCCCTACGACTACATCGCCTCCATGCCCTCTAAGGGCGTCCGAGACCAGTTCATCGACGCCCTCAACGACTGGCTGCGAGTCCCCGACGTGAAGGTCGGCAAGATCAAGGACGCCGTGCGAGTCCTGCACAACTCTTCTCTGCTCCTGGACGACTTCCAGGACAACTCCCCCCTGCGACGAGGCAAGCCCTCCACCCACAACATCTTCGGTTCCGCCCAGACCGTCAACACCGCCACCTACTCCATCATTAAGGCCATCGGTCAGATCATGGAGTTCTCCGCCGGCGAGTCCGTCCAGGAAGTCATGAACTCCATCATGATCCTGTTCCAGGGCCAGGCCATGGACCTGTTCTGGACCTACAACGGCCACGTCCCCTCCGAGGAGGAGTACTACCGAATGATCGACCAAAAGACCGGCCAGCTGTTCTCCATCGCCACCTCTCTGCTCCTGAACGCCGCCGACAACGAGATCCCTCGAACCAAGATCCAGTCCTGTCTGCACCGACTGACCCGACTGCTGGGCCGATGCTTCCAGATCCGAGATGACTACCAGAACCTGGTCTCCGCCGACTACACCAAGCAGAAGGGTTTCTGCGAGGACCTGGACGAGGGCAAGTGGTCCCTGGCCCTGATCCACATGATCCACAAGCAGCGATCCCACATGGCCCTGCTGAACGTGCTGTCCACCGGCCGAAAGCACGGTGGCATGACCCTCGAGCAGAAGCAGTTCGTGCTGGACATCATCGAGGAGGAGAAGTCCCTGGACTACACTCGATCTGTGATGATGGACCTGCACGTCCAGCTGCGAGCTGAGATTGGTCGAATTGAAATTCTGCTGGATTCCCCTAACCCTGCTATGAGACTTCTTTTGGAGCTGCTGCGAGTCTGA, a total of 996 bp.
[0042]
[0043]
[0044] Example 1
[0045] Construction of recombinant plasmid:
[0046] 1. Construction of recombinant plasmid pINA1269-tPaGGPPS-SsSL
[0047] The recombinant plasmid pINA1269-tPaGGPPS-SsSL uses pINA1269 as the backbone. After double digestion with Kpn I and Pml I restriction endonucleases, the tPaGGPPS-Tsynth7t-PFBAin-SsSL expression cassette was inserted.
[0048] Using tsynth7t-FBAin-F and SsSCS-FBAin-R as primers, and the genomic DNA of Yarrowia lipolytica Po1fΔku70 as the template, the promoter PFBAin of the SsSL expression cassette (P FBAin -SsSCS-GGG-SsLPPS-T xpr2t ) was amplified, namely Tsynth7-PFBAin-SsSCS. The GenBank accession number of Yarrowia lipolytica Po1fΔku70 is GCA_009372015.1, and it is committed to be distributed externally for 20 years.
[0049] The nucleotide sequences of exogenous tPaGGPPS, SsSCS, and SsLPPS were inserted into plasmid pUC57 after codon optimization by Sangon Biotech (Shanghai) Co., Ltd. to obtain the corresponding template plasmids, namely pUC57-tPaGGPPS plasmid, pUC57-SsSCS plasmid, and pUC57-SsLPPS plasmid. The nucleotide sequences of tPaGGPPS, SsSCS, and SsLPPS are shown in SEQ ID No.1 - SEQ ID No.3.
[0050] Using hp4d-tPaGGPPS-F and tsynth7t-tPaGGPPS-R, tsynth7t-R, FBAin-tsynth7t-R as primers and pUC57-tPaGGPPS plasmid as template, the tPaGGPPS gene with homologous arms of promoter Php4d and terminator Tsynth7t at both ends was amplified, namely hp4d-tPaGGPPS-Tsynth7t. Using FBAin-SsSCS-F and SsLPPS-GGG-SsSCS-R as primers and pUC57-SsSCS plasmid as template, the SsSCS gene with homologous arms of promoter PFBAin, SsLPPS gene and Linker sequence at both ends was amplified, namely PFBAin-SsSCS-GGG-SsLPPS. Using SsSCS-GGG-SsLPPS-F and xpr2t-SsLPPS-R as primers and pUC57-SsLPPS plasmid as template, the SsLPPS gene with homologous arms of SsSCS gene, Linker sequence and terminator Txpr2t at both ends was amplified, namely SsSCS-GGG-SsLPPS-Txpr2t.
[0051] After double digestion of pINA1269 plasmid with restriction enzymes Kpn I and Pml I from Takara and Thermo Fisher Scientific companies, the linearized pINA1269 plasmid was recovered using the PCR Purification Kit purification and recovery kit from TransGen Biotech Co., Ltd. in Beijing.
[0052] Using the -Basic Seamless Cloning and Assembly Kit from TransGen Biotech Co., Ltd. in Beijing, the linearized pINA1269 plasmid and each fragment (hp4d-tPaGGPPS-Tsynth7t, tPaGGPPS-Tsynth7t-PFBAin, PFBAin-SsSCS-GGG-SsLPPS and SsSCS-GGG-SsLPPS-Txpr2t) were subjected to seamless cloning to obtain the recombinant vector, which was then transformed into Escherichia coli DH5α competent cells. After screening by ampicillin-resistant plates and verification by colony PCR and sequencing, the recombinant plasmid pINA1269-tPaGGPPS-SsSL was obtained.
[0053] 2. Construction of recombinant plasmid pCRISPRyl-D069::SsSL
[0054] Method for constructing pCRISPRyl-D069 backbone: After double digestion of plasmid pCRISPRyl (purchased) with two restriction endonucleases, SacII and NotI, the linearized vector pCRISPRyl was obtained by purification and recovery. The linearized vector was subjected to seamless cloning with the sgRNA (SEQ ID NO. 48, GCTGCCATGTCATATCCACG) designed for the D069 locus, its expression cassette, and the homologous arms upstream and downstream of the locus to obtain the vector pCRISPRyl-D069. The specific steps are as follows:
[0055] Using the genomic DNA of Yarrowia lipolytica Po1fΔku70 as a template, the upper 1000 bp of the sgRNA sequence at the D069 locus was amplified using primers CU-SacII-uHAD069-F (SEQ ID NO.55, tttttcttttttttctgtacagacgcgtccgcggcgcatgtcggccagttaggctctac) and dHA-SpeI-uHAD069-R (SEQ ID NO.56, gacagcatagcagccactagtgttgatagtcaagtcactggagagatggt) as the upper homologous arm uHAD069; the lower 1000 bp of the sgRNA sequence at the D069 locus was amplified using primers uHA-SpeI-dHAD069-F (SEQ ID NO.57, cagtgacttgactatcaacactagtggctgctatgctgtctgcaacaagt) and sgRNA-dHAD069-R (SEQ ID NO.58, gttgtgtcaacttttgcaactggggtcatcttggtgacaagctgctgggc) as the lower homologous arm dHAD069. Then, using the plasmid pUC-sgRNAPro+Ter (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) as a template, the sgRNA promoter and the sgRNA module at the D069 locus were amplified using primers dHAD069-sgPro-F (SEQ ID NO.59, cagcagcttgtcaccaagatgaccccagttgcaaaagttgacacaactct) and D069sgRNA-sgPro-R (SEQ ID NO.60, ctagctctaaaaccgtggatatgacatggcagcacgtcaacctgcgccgacccggaat). The sgRNA and its sgRNA terminator module were amplified using primers D069sgRNA-F (SEQ ID NO.61, gctgccatgtcatatccacggttttagagctagaaatagcaagttaaaataaggctag) and CU-NotI-D069sgTer-R (SEQ ID NO.62, ccacctgacgtctttagcggccgcattcttcgactctagaggatctgggcctcgtgat).The above 4 fragments were seamlessly cloned and ligated with the linearized vector pCRISPRyl digested with SacII and NotI to obtain plasmid pCRISPRyl-D069, which was digested with SpeI restriction endonuclease and then purified and recovered to obtain the linearized pCRISPRyl-D069 vector.
[0056] The recombinant plasmid pCRISPRyl-D069::SsSL was based on pCRISPRyl-D069 as the backbone, and after digestion with SpeI restriction endonuclease, the SsSL expression cassette (P TEFin -SsSCS-GGG-SsLPPS-T xpr2t ) was inserted.
[0057] Using uHAD069-TEFin-F and SsSCS-TEFin-R as primers and the genomic DNA of Yarrowia lipolytica Po1fΔku70 as the template, the promoter PTEFin of the SsSL expression cassette was amplified.
[0058] Using the recombinant plasmid pINA1269-tPaGGPPS-SsSL in step 1 as the template and TEFin-SsSCS-F and dHAD069-xpr2t-R as primers, the SsSL fusion gene with the promoter PTEFin and the dHAD069 homologous arms at both ends was amplified.
[0059] After digesting the pCRISPRyl-D069 plasmid with the restriction endonuclease SpeI from Takara, the linearized pCRISPRyl-D069 plasmid was recovered using the PCR Purification Kit purification and recovery kit from TransGen Biotech Co., Ltd.
[0060] Using the -Basic Seamless Cloning and Assembly Kit from TransGen Biotech Co., Ltd., the linearized pCRISPRyl-D069 plasmid, the promoter PTEFin and the SsSL fusion gene were seamlessly cloned. The resulting recombinant vector was then transformed into Escherichia coli DH5α competent cells, screened by ampicillin-resistant plates, and verified by colony PCR and sequencing to obtain the recombinant plasmid pCRISPRyl-D069::SsSL.
[0061] 3. Construction of the recombinant plasmid pCRISPRyl-D17::ERG19+ERG13
[0062] Method for constructing pCRISPRyl-D17 backbone: The plasmid pCRISPRyl (purchased) was double digested with two restriction endonucleases, SacII and NotI, and then purified and recovered to obtain the linearized vector pCRISPRyl. The linearized vector was subjected to seamless cloning with the sgRNA (SEQ ID NO. 49, TCCGTAATATAGGTGACGAC) designed for the D17 site, its expression cassette, and the homologous arms upstream and downstream of the site to obtain the vector pCRISPRyl-D17. The specific steps are as follows:
[0063] Using the genomic DNA of Yarrowia lipolytica Po1fΔku70 as a template, the upper 1000 bp of the sgRNA sequence at the D17 locus was amplified using primers CU-SacII-uHAD17-F (SEQ ID NO.63, tttttttctgtacagacgcgtccgcggatcttctaagtccactatatcacccctccaa) and dHA-SpeI-uHAD17-R (SEQ ID NO.64, gcttccgtaatataggtgaactagtgatagaagactagcttggacaggaaaaacatgt) as the upper homologous arm uHAD17; the lower 1000 bp of the sgRNA sequence at the D17 locus was amplified using primers uHA-SpeI-dHAD17-F (SEQ ID NO.65, ccaagctagtcttctatcactagttcacctatattacggaagcagtggtactcaagct) and sgRNA-dHAD17-R (SEQ ID NO.66, ctagagttgtgtcaacttttgcaactgggatcgtctggcagatggccttggacgct) as the lower homologous arm dHAD17. Then, using the plasmid pUC-sgRNAPro+Ter (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) as a template, the sgRNA promoter and the sgRNA module at the D17 locus were amplified using primers dHAD17-sgPro-F (SEQ ID NO.67, ccaaggccatctgccagacgatcccagttgcaaaagttgacacaactctagatct) and D17sgRNA-sgPro-R (SEQ ID NO.68, ctagctctaaaacgtcgtcacctatattacggaacgtcaacctgcgccgacccggaat). The sgRNA and its sgRNA terminator module were amplified using primers D17sgRNA-F (SEQ ID NO.69, tccgtaatataggtgacgacgttttagagctagaaatagcaagttaaaataaggctag) and CU-NotI-D17sgTer-R (SEQ ID NO.70, ccacctgacgtctttagcggccgcattcTtcgactctagaggatctgggcctcgtgat).The above 4 fragments were seamlessly cloned and ligated with the linearized vector pCRISPRyl digested with SacII and NotI to obtain plasmid pCRISPRyl-D17, which was digested with SpeI restriction endonuclease and then purified and recovered to obtain the linearized pCRISPRyl-D17 vector.
[0064] The recombinant plasmid pCRISPRyl-D17::ERG19+ERG13 uses pCRISPRyl-D17 as the backbone, and after digestion with SpeI restriction endonuclease, the ERG19 expression cassette (P FBAin -ERG19-Tsynth7t) and ERG13 expression cassette (P TEFin -ERG13-T xpr2t ) were inserted.
[0065] Using uHAD17-FBAin-F and ERG19-FBAin-R as primers, and Yarrowia lipolytica Po1fΔku70 genomic DNA as the template, the promoter PFBAin of the ERG19 expression cassette was amplified. Using Tsynth7-TEFin-F and ERG13-TEFin-R as primers, and Yarrowia lipolytica Po1fΔku70 genomic DNA as the template, the promoter PTEFin of the ERG13 expression cassette was amplified. Using ERG13-xpr2t-F and dHAD17-xpr2t-R as primers, and Yarrowia lipolyticaPo1fΔku70 genomic DNA as the template, the terminator Txpr2t of the ERG13 expression cassette was amplified.
[0066] Using Yarrowia lipolytica Po1fΔku70 genomic DNA as the template, and FBAin-ERG19-F and tsynth7t-ERG19-R, tsynth7t-R, TEFin-tsynth7t-R as primers, the ERG19 gene with homologous arms of the promoter PFBAin and terminator Tsynth7t at both ends was amplified. Using Yarrowia lipolytica Po1fΔku70 genomic DNA as the template, and TEFin-ERG13-F and xpr2t-ERG13-R as primers, the ERG13 gene with homologous arms of the promoter PTEFin and terminator Txpr2t at both ends was amplified.
[0067] After digesting the pCRISPRyl-D17 plasmid with the restriction endonuclease SpeI from Takara, using the The PCR Purification Kit is used to purify and recover the linearized pCRISPRyl-D17 plasmid.
[0068] Using the -Basic Seamless Cloning and Assembly Kit from TransGen Biotech Co., Ltd., Beijing, the linearized pCRISPRyl-D17 plasmid, ERG19 gene, ERG13 gene and each element (promoter PFBAin and terminator Tsynth7t) were subjected to seamless cloning to obtain a recombinant vector, which was then transformed into Escherichia coli DH5α competent cells. Screening was carried out through an ampicillin-resistant plate, and verification was performed through colony PCR and sequencing to obtain the recombinant plasmid pCRISPRyl-D17::ERG19+ERG13.
[0069] 4. Construction of the recombinant plasmid pCRISPRyl-E153::ERG12+ERG8
[0070] Method for constructing the pCRISPRyl-E153 backbone: The plasmid pCRISPRyl (purchased) was double-digested with two restriction endonucleases, SacII and NotI, and then purified and recovered to obtain the linearized vector pCRISPRyl. The linearized vector was subjected to seamless cloning with the sgRNA (SEQ ID NO.50, GTAGAGGTACGAAACAACAC) designed for the E153 site, its expression cassette, and the homologous arms upstream and downstream of the site to obtain the vector pCRISPRyl-E153. The specific steps are as follows:
[0071] Using the genomic DNA of Yarrowia lipolytica Po1fΔku70 as a template, the upper 1000 bp of the sgRNA sequence at the E153 site was amplified as the upper homologous arm uHAE153 using primers CU-SacII-uHAE153-F (SEQ ID NO.71, tttttcttttttttctgtacagacgcgtccgcggcttgacgagctgtgagcgggccaga) and dHA-SpeI-uHAE153-R (SEQ ID NO.72, cgtatctagatcaagcacattttcccactagttgttgttgagagtgcgtttggtgtcct); the lower 1000 bp of the sgRNA sequence at the E153 site was amplified as the lower homologous arm dHAE153 using primers uHA-SpeI-dHAE153-F (SEQ ID NO.73, gcactctcaacaacaactagtgggaaaatgtgcttgatctagatacgcgattctg) and sgRNA-dHAE153-R (SEQ ID NO.74, cagatctagagttgtgtcaacttttgcaactgggaaatggggccgcgactttgcctccc). Then, using the plasmid pUC-sgRNAPro+Ter (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) as a template, the sgRNA promoter and the sgRNA module at the E153 site were amplified using primers dHAE153-sgPro-F (SEQ ID NO.75, cccagttgcaaaagttgacacaactctagatctgc) and E153sgRNA-sgPro-R (SEQ ID NO.76, ctagctctaaaacgtgttgtttcgtacctctacacgtcaacctgcgccgacccggaat). The sgRNA and its sgRNA terminator module were amplified using primers E153sgRNA-F (SEQ ID NO.77, tagaggtacgaaacaacacgttttagagctagaaatagcaagttaaaataaggctagt) and CU-NotI-E153sgTer-R (SEQ ID NO.78, ccacctgacgtctttagcggccgcattcttcgactctagaggatctgggcctcgtgat).The above 4 fragments were seamlessly cloned and ligated with the linearized vector pCRISPRyl digested by SacII and NotI to obtain the plasmid pCRISPRyl-E153, which was digested with the restriction endonuclease SpeI and then purified and recovered to obtain the linearized pCRISPRyl-E153 vector.
[0072] The recombinant plasmid pCRISPRyl-E153::ERG12+ERG8 uses pCRISPRyl-E153 as the backbone, and after digestion with the restriction endonuclease SpeI, the ERG12 expression cassette (P FBAin -ERG12-Tsynth7t) and the ERG8 expression cassette (P TEFin -ERG8-T xpr2t ) were inserted.
[0073] Using uHAE153-FBAin-F and ERG12-FBAin-R as primers, and the genomic DNA of Yarrowia lipolytica Po1fΔku70 as the template, the promoter PFBAin of the ERG12 expression cassette was amplified. Using Tsynth7-TEFin-F and ERG8-TEFin-R as primers, and the genomic DNA of Yarrowia lipolytica Po1fΔku70 as the template, the promoter PTEFin of the ERG8 expression cassette was amplified. Using ERG8-xpr2t-F and dHAE153-xpr2t-R as primers, and the genomic DNA of Yarrowia lipolytica Po1fΔku70 as the template, the terminator Txpr2t of the ERG8 expression cassette was amplified.
[0074] Using the genomic DNA of Yarrowia lipolytica Po1fΔku70 as the template, and FBAin-ERG12-F and tsynth7t-ERG12-R, tsynth7t-R, TEFin-tsynth7t-R as primers, the ERG12 gene with homologous arms of the promoter PFBAin and the terminator Tsynth7t at both ends was amplified. Using the genomic DNA of Yarrowia lipolytica Po1fΔku70 as the template, and TEFin-ERG8-F and xpr2t-ERG8-R as primers, the ERG8 gene with homologous arms of the promoter PTEFin and the terminator Txpr2t at both ends was amplified.
[0075] After digesting the pCRISPRyl-E153 plasmid with the restriction endonuclease SpeI from Takara, using the The PCR Purification Kit purifies and recovers the linearized pCRISPRyl-E153 plasmid.
[0076] Using the -Basic Seamless Cloning and Assembly Kit of TransGen Biotech Co., Ltd., Beijing, the linearized pCRISPRyl-E153 plasmid, ERG12 gene, ERG8 gene and each element (promoter PFBAin and terminator Tsynth7t) were subjected to seamless cloning to obtain a recombinant vector, which was then transformed into competent Escherichia coli DH5α cells. Screening was carried out through an ampicillin-resistant plate, and verification was performed by colony PCR and sequencing to obtain the recombinant plasmid pCRISPRyl-E153::ERG12+ERG8.
[0077] 5. Construction of the recombinant plasmid pCRISPRyl-EXG2::CAT2
[0078] Method for constructing the pCRISPRyl-EXG2 backbone: The plasmid pCRISPRyl (purchased) was double-digested with two restriction endonucleases, SacII and NotI, and then purified and recovered to obtain the linearized vector pCRISPRyl. The linearized vector was subjected to seamless cloning with the sgRNA (SEQ ID NO.51, GCCGATCTTGAGGCTCTCAA) designed for the EXG2 site, its expression cassette, and the homologous arms upstream and downstream of the site to obtain the vector pCRISPRyl-EXG2. The specific steps are as follows:
[0079] Using the genomic DNA of Yarrowia lipolytica Po1fΔku70 as a template, the upper 1000 bp of the sgRNA sequence at the EXG2 locus was amplified using primers CU-SacII-uHAEXG2-F (SEQ ID NO.79, ttcttttttttctgtacagacgcgtccgcggcgtacaatatctgccgtcctcgtaatac) and dHA-SpeI-uHAEXG2-R (SEQ ID NO.80, acactcatgctggacactcgtgtctcgactagtcgagtgtggtggtgttgtgtgaggag) as the upper homologous arm uHAEXG2; the lower 1000 bp of the sgRNA sequence at the EXG2 locus was amplified using primers uHA-SpeI-dHAEXG2-F (SEQ ID NO.81, caccacactcgactagtcgagacacgagtgtccagcatgagtgtc) and sgRNA-dHAEXG2-R (SEQ ID NO.82, tctagagttgtgtcaacttttgcaactgggctgctggcgtttttgaaaacagttccttg) as the lower homologous arm dHAEXG2. Then, using the plasmid pUC-sgRNAPro+Ter (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) as a template, the sgRNA promoter and the sgRNA module at the EXG2 locus were amplified using primers dHAEXG2-sgPro-F (SEQ ID NO.83, caaaaacgccagcagcccagttgcaaaagttgacacaactctagatc) and EXG2sgRNA-sgPro-R (SEQ ID NO.84, tctagctctaaaacttgagagcctcaagatcggcacgtcaacctgcgccgacccggaat). The sgRNA and its sgRNA terminator module were amplified using primers EXG2sgRNA-F (SEQ ID NO.85, tgccgatcttgaggctctcaagttttagagctagaaatagcaagttaaaataaggctag) and CU-NotI-EXG2sgTer-R (SEQ ID NO.86, ccacctgacgtctttagcggccgcattcttcgactctagaggatctgggcctcgtgat).The above 4 fragments were seamlessly cloned and ligated with the linearized vector pCRISPRyl digested by SacII and NotI to obtain plasmid pCRISPRyl-EXG2, which was digested with SpeI restriction endonuclease and then purified and recovered to obtain the linearized pCRISPRyl-EXG2 vector.
[0080] The recombinant plasmid pCRISPRyl-EXG2::CAT2 was based on pCRISPRyl-EXG2 as the backbone, and after digestion with SpeI restriction endonuclease, the CAT2 expression cassette (P TEFin -CAT2-T xpr2t ) was inserted.
[0081] Using uHAEXG2-TEFin-F and CAT2-TEFin-R as primers, and the genomic DNA of Yarrowia lipolytica Po1fΔku70 as the template, the promoter PTEFin of the CAT2 expression cassette was amplified. Using CAT2-xpr2t-F and dHAEXG2-xpr2t-R as primers, and the genomic DNA of Yarrowia lipolytica Po1fΔku70 as the template, the terminator Txpr2t of the CAT2 expression cassette was amplified.
[0082] Using the genomic DNA of Yarrowia lipolytica Po1fΔku70 as the template, and TEFin-CAT2-F and xpr2t-CAT2-R as primers, the CAT2 gene with homologous arms of the promoter PTEFin and terminator Txpr2t at both ends was amplified.
[0083] After digesting the pCRISPRyl-EXG2 plasmid with the restriction endonuclease SpeI from Takara, the linearized pCRISPRyl-EXG2 plasmid was recovered using the PCR Purification Kit purification and recovery kit from Beijing TransGen Biotech Co., Ltd.
[0084] Using the -Basic Seamless Cloning and Assembly Kit from Beijing TransGen Biotech Co., Ltd., the linearized pCRISPRyl-EXG2 plasmid, the CAT2 gene and each element (promoter PTEFin and terminator Txpr2) were seamlessly cloned to obtain a recombinant vector, which was then transformed into Escherichia coli DH5α competent cells, screened by an ampicillin-resistant plate, and verified by colony PCR and sequencing to obtain the recombinant plasmid pCRISPRyl-EXG2::CAT2.
[0085] 6. The empty plasmid pCRISPRyl-DGA2 (dHADGA2-SpeI-uHADGA2) is stored in the laboratory.
[0086] Method for constructing the pCRISPRyl-DGA2 empty plasmid: The plasmid pCRISPRyl (purchased) is double digested with two restriction endonucleases, SacII and NotI, and then purified and recovered to obtain the linearized vector pCRISPRyl. The linearized vector is subjected to seamless cloning with the sgRNA (SEQ ID NO.52, GGATGTTATGTCGTGAACGG) designed for the DGA2 site, its expression cassette, and the homologous arms upstream and downstream of the site to obtain the vector pCRISPRyl-DGA2. The specific steps are as follows:
[0087] Using the genomic DNA of Yarrowia lipolytica Po1fΔku70 as a template, the upper 1000 bp of the sgRNA sequence at the DGA2 locus was amplified as the upper homologous arm uHADGA2 using the primers CU-SacII-uHADGA2-F (SEQ ID NO.87, tttttcttttttttctgtacagacgcgtccgcggatgtacggcgaaggagcgataatcg) and dHA-SpeI-uHADGA2-R (SEQ ID NO.88, gctactgatgagtgttatgactagtaggtggtgttggtaaatatagcttaactgttatc); the lower 1000 bp of the sgRNA sequence at the DGA2 locus was amplified as the lower homologous arm dHADGA2 using the primers uHA-SpeI-dHADGA2-F (SEQ ID NO.89, aagctatatttaccaacaccacctactagtcataacactcatcagtagcctttacagtg) and sgRNA-dHADGA2-R (SEQ ID NO.90, agagttgtgtcaacttttgcaactgggcgcattagaagtaattagcctgaggaggggtt). Then, using the plasmid pUC-sgRNAPro+Ter (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) as a template, the sgRNA promoter and the sgRNA module at the DGA2 locus were amplified using the primers dHADGA2-sgPro-F (SEQ ID NO.91, ctcaggctaattacttctaatgcgcccagttgcaaaagttgacacaactctagatctgc) and DGA2sgRNA-sgPro-R (SEQ ID NO.92, tctagctctaaaacccgttcacgacataacatccacgtcaacctgcgccgacccggaat). The sgRNA and its sgRNA terminator module were amplified using the primers DGA2sgRNA-F (SEQ ID NO.93, cgtggatgttatgtcgtgaacgggttttagagctagaaatagcaagttaaaataaggct) and CU-NotI-DGA2sgTer-R (SEQ ID NO.94, gccacctgacgtctttagcggccgcattcttcgactctagaggatctgggcctcgtga).The above 4 fragments were seamlessly cloned and ligated with the linearized vector pCRISPRyl digested with SacII and NotI to obtain the plasmid pCRISPRyl-DGA2.
[0088] 7. Construction of the recombinant plasmid pCRISPRyl-AXP::SsSL
[0089] Method for constructing the pCRISPRyl-AXP backbone: The plasmid pCRISPRyl (purchased) was digested with two restriction endonucleases, SacII and NotI, and then purified and recovered to obtain the linearized vector pCRISPRyl. The linearized vector was seamlessly cloned with the sgRNA (SEQ ID NO.53, GATACTCCTGGACGTCCAGA) designed for the AXP site, its expression cassette, and the homologous arms upstream and downstream of the site to obtain the vector pCRISPRyl-AXP. The specific steps are as follows:
[0090] Using the genomic DNA of Yarrowia lipolytica Po1fΔku70 as a template, the upper 1000 bp of the sgRNA sequence at the AXP locus was amplified using primers CU-SacII-uHAAXP-F (SEQ ID NO.95, tcttttttttctgtacagacgcgtccgcgggaacggcaccagctggttaatgtggggt) and dHA-SpeI-uHAAXP-R (SEQ ID NO.96, ttttctggtacaaccacttttactagtttcgacctggtcctcagtcattgcctctggt) as the upper homologous arm uHAAXP; the lower 1000 bp of the sgRNA sequence at the AXP locus was amplified using primers uHA-SpeI-dHAAXP-F (SEQ ID NO.97, actgaggaccaggtcgaaactagtaaaagtggttgtaccagaaaacagatccacaagt) and sgRNA-dHAAXP-R (SEQ ID NO.98, gttgtgtcaacttttgcaactgggaattgcatccaacaatgttgaacctgcaattga) as the lower homologous arm dHAAXP. Then, using the plasmid pUC-sgRNAPro+Ter (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) as a template, the sgRNA promoter and the sgRNA module at the AXP locus were amplified using primers dHAAXP-sgPro-F (SEQ ID NO.99, caggttcaacattgttggatgcaattcccagttgcaaaagttgacacaactctaga) and AXPsgRNA-sgPro-R (SEQ ID NO.100, ctaaaactctggacgtccaggagtatcacgtcaacctgcgccgacccgga). The sgRNA and its sgRNA terminator module were amplified using primers AXPsgRNA-F (SEQ ID NO.101, atactcctggacgtccagagttttagagctagaaatagcaagttaaaataaggctagt) and CU-NotI-AXPsgTer-R (SEQ ID NO.102, ccacctgacgtctttagcggccgcattcttcgactctagaggatctgggcctcgtgat).The above 4 fragments were seamlessly cloned and ligated with the linearized vector pCRISPRyl digested with SacII and NotI to obtain plasmid pCRISPRyl-AXP, which was digested with SpeI restriction endonuclease and purified to obtain the linearized pCRISPRyl-AXP vector.
[0091] Primers (uHAAXP-TEFin-F and dHAAXP-xpr2t-R) were designed based on the AXP locus of Yarrowia lipolytica, and the remaining steps were the same as those for the construction of the recombinant plasmid pCRISPRyl-D069::SsSL.
[0092] 8. Construction of the recombinant plasmid pCRISPRyl-F262::SsSL
[0093] Construction method of the pCRISPRyl-F262 backbone: The plasmid pCRISPRyl (purchased) was digested with SacII and NotI restriction endonucleases and purified to obtain the linearized vector pCRISPRyl. The linearized vector was seamlessly cloned with the sgRNA (SEQ ID NO.54, ACTGCTCTAGAGACTTCCGA) designed for the F262 locus, its expression cassette, and the homologous arms upstream and downstream of the locus to obtain the vector pCRISPRyl-F262. The specific steps are as follows:
[0094] Using the genomic DNA of Yarrowia lipolytica Po1fΔku70 as a template, the upper 1000 bp of the sgRNA sequence at the F262 locus was amplified as the upper homologous arm uHAF262 using primers CU-SacII-uHAF262-F (SEQ ID NO.103, ctttttttttctgtacagacgcgtccgcggagatggaagagtgtgtttgattctgttcat) and dHA-SpeI-uHAF262-R (SEQ ID NO.104, gtactgtagactcgtgggcactagttgatctaaaccgtcccaaagccgttc); the lower 1000 bp of the sgRNA sequence at the F262 locus was amplified as the lower homologous arm dHAF262 using primers uHA-SpeI-dHAF262-F (SEQ ID NO.105, cggtttagatcaactagtgcccacgagtctacagtacgaatacc) and sgRNA-dHAF262-R (SEQ ID NO.106, agatctagagttgtgtcaacttttgcaactgggtggttcaggtcgtcgtcatcatcttg). Then, using the plasmid pUC-sgRNAPro+Ter (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) as a template, the sgRNA promoter and the sgRNA module at the F262 locus were amplified using primers dHAF262-sgPro-F (SEQ ID NO.107, cccagttgcaaaagttgacacaactctagatctgc) and F262sgRNA-sgPro-R (SEQ ID NO.108, ctagctctaaaactcggaagtctctagagcagtacgtcaacctgcgccgacccggaat). The sgRNA and its sgRNA terminator module were amplified using primers F262sgRNA-F (SEQ ID NO.109, acgtactgctctagagacttccgagttttagagctagaaatagcaagttaaaataaggc) and CU-NotI-F262sgTer-R (SEQ ID NO.110, ccacctgacgtctttagcggccgcattcTtcgactctagaggatctgggcctcgtgat).The above 4 fragments were seamlessly cloned and ligated with the linearized vector pCRISPRyl digested with SacII and NotI to obtain plasmid pCRISPRyl-F262, which was digested with SpeI restriction endonuclease and then purified and recovered to obtain the linearized pCRISPRyl-F262 vector.
[0095] Primers (uHAF262-TEFin-F and dHAF262-xpr2t-R) were designed based on the F262 locus of Yarrowia lipolytica, and the remaining steps were the same as those for the construction of the recombinant plasmid pCRISPRyl-D069::SsSL.
[0096] In this example, the PCR amplification system for the construction of each recombinant plasmid is shown in Table 2, the double digestion system is shown in Table 3, and the seamless cloning system is shown in Table 4. The reaction program for PCR amplification is as follows: pre-denaturation at 95 °C for 10 min; denaturation at 95 °C for 20 s; annealing at 62 °C for 20 s; extension at 72 °C for 1 min / kb; cycle Go to 2, 5 cycles; denaturation at 95 °C for 15 s; annealing at 60 °C for 15 s; extension at 72 °C for 1 min / kb; cycle Go to 6, 15 cycles; denaturation at 95 °C for 15 s; annealing at 58 °C for 15 s; extension at 72 °C for 1 min / kb; cycle Go to 10, 11 cycles; finally, extension at 72 °C for 10 min; cooling and storage at 12 °C for 5 min.
[0097] Table 2 PCR amplification system
[0098] Component Volume Primer F 2 μL Primer R 2 μL 2×PhantaMax Buffer 25 μL dNTP Mix 1 μL Gene template 1 μL PhantaMax Super-Fidelity DNA Polymeras 1 μL Ultra-pure water 18 μL
[0099] Table 3 Double digestion system
[0100] Component Volume Plasmid 50 μL Ultra-pure water 40 μL Buffer 10 μL Restriction endonuclease KpnI 3 μL Restriction endonuclease PmlI 3 μL
[0101] Table 4 Seamless cloning system
[0102] Component Volume 2×Basic Assembly Mix 6 μL Linearized plasmid backbone 2 μL Inserted gene fragment 4 μL
[0103] In this example, the gene insertion situations of each recombinant plasmid are shown in Table 5, and the primers used in the construction process are shown in Table 6.
[0104] Table 5 Inserted sequences in each recombinant plasmid
[0105]
[0106] Table 6 Primer names
[0107]
[0108]
[0109]
[0110]
[0111] Construction of Recombinant Bacteria in Example 2
[0112] The competent cells and recombinant plasmids corresponding to each recombinant bacterium are shown in Table 7.
[0113] Table 7 Competent Cells and Recombinant Plasmids Corresponding to Each Recombinant Bacterium
[0114] Name of recombinant bacterium Competent cells Imported recombinant plasmid CJ-1 Yarrowia lipolytica Po1f-tHEI pINA1269-tPaGGPPS-SsSL CJ-2 CJ-1 pCRISPRyl-D069::SsSL CJ-3 CJ-2 pCRISPRyl-D17::ERG19 + ERG13 CJ-4 CJ-3 pCRISPRyl-E153::ERG12 + ERG8 CJ-5 CJ-4 pCRISPRyl-EXG2::CAT2 CJ-6 CJ-5 pCRISPRyl-DGA2 CJ-7 CJ-6 pCRISPRyl-AXP::SsSL CJ-8 CJ-7 pCRISPRyl-F262::SsSL
[0115] 1. Construction of Recombinant Bacterium CJ-1
[0116] As shown in Table 7, pINA1269-tPaGGPPS-SsSL constructed in Example 1 was introduced into Yarrowia lipolytica Po1f-tHEI (Yarrowia lipolytica Po1f-tHEI, this strain was disclosed in "Constructing a green oleaginous yeast cell factory for sustainable production of the plant-derived diterpenoid sclareol", and it was promised to be distributed externally for 20 years. In this literature, the name of the strain was Po1f-Δku70,ΔIntC::tHMC,ΔSCP2::ERG20; at the same time, this strain was also disclosed in the Chinese patent application with the publication number "CN116656518A" and was the recombinant bacterium 1 in Example 2 of this application document), and the recombinant bacterium CJ-1 was obtained. The specific method is as follows:
[0117] (1) After digesting the pINA1269-tPaGGPPS-SsSL plasmid with the restriction endonuclease BsrGI from Takara, the linearized pINA1269-tPaGGPPS-SsSL plasmid was recovered using the PCR Purification Kit purification and recovery kit from Beijing TransGen Biotech Co., Ltd.
[0118] (2) Yarrowia lipolytica Po1f-tHEI was cultured in YPD liquid medium for 24 h and then used to prepare competent cells.
[0119] (3) Using the Zymogen Frozen EZ Yeast Transformation Kit II yeast transformation kit from Zymo Research Corporation, the above linearized recombinant plasmid was transformed into the competent cells of Yarrowia lipolytica Po1f-tHEI, and the cells were spread on plates for screening. Yeast screening medium YNB-URA was used for screening.
[0120] 2. Construction of recombinant strain CJ-2
[0121] As shown in Table 7, the pCRISPRyl-D069::SsSL constructed in Example 1 was introduced into the competent cells of recombinant strain CJ-1 to obtain recombinant strain CJ-2. The specific method is as follows:
[0122] (1) Recombinant strain CJ-1 was cultured in YPD liquid medium for 24 h and then used to prepare competent cells.
[0123] (2) Using the Zymogen Frozen EZ Yeast Transformation Kit II yeast transformation kit, the recombinant plasmid pCRISPRyl-D069::SsSL was transformed into the competent cells of recombinant strain CJ-1, and the cells were spread on plates for screening. Screening medium YNB was used for screening. The positive clones identified by PCR were activated and streaked on a 5-FOA-YPD plate, and then placed in an incubator at 30 °C for 3 days. Single colonies were streaked simultaneously on yeast screening medium YNB-URA plates and yeast screening medium YNB plates to observe the growth of the bacteria. Single colonies that could grow on the yeast screening medium YNB-URA plate but could not grow on the yeast screening medium YNB plate were identified by PCR again. The positive clones that successfully discarded the free-form knock-in / knock-out plasmid containing URA were named recombinant strain CJ-2.
[0124] 3. Construction of recombinant strain CJ-3
[0125] As shown in Table 7, the pCRISPRyl-D17::ERG19+ERG13 constructed in Example 1 was introduced into the competent cells of recombinant strain CJ-2 to obtain recombinant strain CJ-3. The specific method is as follows:
[0126] (1) Recombinant strain CJ-2 was cultured in YPD liquid medium for 24 h and then used to prepare competent cells.
[0127] (2) The recombinant plasmid pCRISPRyl-D17::ERG19+ERG13 was transformed into the competent cells of recombinant bacterium CJ-2 using the Zymogen Frozen EZ Yeast Transformation Kit II from Zymo Research Corporation, and then plated for screening. Screening was carried out using the yeast screening medium YNB. After activating the positive clones identified by PCR, they were streaked on a 5-FOA-YPD plate and placed in an incubator at 30 °C for 3 days. Single colonies were streaked simultaneously on a YNB-URA plate and a YNB plate of the yeast screening medium to observe the growth of the bacteria. Single colonies that could grow on the YNB-URA plate of the yeast screening medium but could not grow on the YNB plate of the yeast screening medium were selected for PCR identification again. The positive clones that successfully discarded the free-form knock-in / knock-out plasmid containing URA were named recombinant bacterium CJ-3.
[0128] 4. Construction of recombinant bacterium CJ-4
[0129] As shown in Table 7, the pCRISPRyl-E153::ERG12+ERG8 constructed in Example 1 was introduced into the competent cells of recombinant bacterium CJ-3 to obtain recombinant bacterium CJ-4. The specific method is as follows:
[0130] (1) Recombinant bacterium CJ-3 was cultured in YPD liquid medium for 24 h and then used to prepare competent cells.
[0131] (2) The recombinant plasmid pCRISPRyl-E153::ERG12+ERG8 was transformed into the competent cells of recombinant bacterium CJ-3 using the Zymogen Frozen EZ Yeast Transformation Kit II from Zymo Research Corporation, and then plated for screening. Screening was carried out using the yeast screening medium YNB. After activating the positive clones identified by PCR, they were streaked on a 5-FOA-YPD plate and placed in an incubator at 30 °C for 3 days. Single colonies were streaked simultaneously on a YNB-URA plate and a YNB plate of the yeast screening medium to observe the growth of the bacteria. Single colonies that could grow on the YNB-URA plate of the yeast screening medium but could not grow on the YNB plate of the yeast screening medium were selected for PCR identification again. The positive clones that successfully discarded the free-form knock-in / knock-out plasmid containing URA were named recombinant bacterium CJ-4.
[0132] 5. Construction of recombinant bacterium CJ-5
[0133] As shown in Table 7, the pCRISPRyl-EXG2::CAT2 constructed in Example 1 was introduced into the competent cells of recombinant bacterium CJ-4 to obtain recombinant bacterium CJ-5. The specific method is as follows:
[0134] (1) The recombinant bacterium CJ-4 was cultured in YPD liquid medium for 24 h and then used to prepare competent cells.
[0135] (2) The recombinant plasmid pCRISPRyl-EXG2::CAT2 was transformed into the competent cells of recombinant bacterium CJ-4 using the Zymogen Frozen EZ Yeast Transformation Kit II yeast transformation kit from Zymo Research Corporation, and the plates were screened. Screening was carried out using the yeast screening medium YNB. The positive clones identified correctly by PCR were activated and streaked on a 5-FOA-YPD plate, and then placed in an incubator at 30 °C for 3 days. Single colonies were streaked simultaneously on a yeast screening medium YNB-URA plate and a yeast screening medium YNB plate, and the growth of the bacteria was observed. Single colonies that could grow on the yeast screening medium YNB-URA plate but could not grow on the yeast screening medium YNB plate were identified by PCR again. The positive clones that had successfully discarded the URA-containing free-form knock-in / knock-out plasmid were named recombinant bacterium CJ-5.
[0136] 6. Construction of recombinant bacterium CJ-6
[0137] As shown in Table 7, the pCRISPRyl-DGA2 stored in the laboratory was introduced into the competent cells of recombinant bacterium CJ-5 to obtain recombinant bacterium CJ-6. The specific method is as follows:
[0138] (1) The recombinant bacterium CJ-5 was cultured in YPD liquid medium for 24 h and then used to prepare competent cells.
[0139] (2) The empty plasmid pCRISPRyl-DGA2 was transformed into the competent cells of the recombinant strain CJ-5 using the Zymogen Frozen EZ Yeast Transformation Kit II from Zymo Research Corporation, and the cells were spread on plates for screening. Screening was carried out using the yeast screening medium YNB. After activating the positive clones identified by PCR, they were streaked on a 5-FOA-YPD plate and placed in an incubator at 30 °C for 3 days. Single colonies were streaked simultaneously on a yeast screening medium YNB-URA plate and a yeast screening medium YNB plate, and the growth of the bacteria was observed. Single colonies that could grow on the yeast screening medium YNB-URA plate but could not grow on the yeast screening medium YNB plate were identified by PCR again. The positive clones that successfully discarded the free-form knock-in / knock-out plasmid containing URA were named the recombinant strain CJ-6.
[0140] 7. Construction of the recombinant strain CJ-7
[0141] As shown in Table 7, pCRISPRyl-AXP::SsSL constructed in Example 1 was introduced into the competent cells of the recombinant strain CJ-6 to obtain the recombinant strain CJ-7. The specific method is as follows:
[0142] (1) The recombinant strain CJ-6 was cultured in YPD liquid medium for 24 h and then used to prepare competent cells.
[0143] (2) The recombinant plasmid pCRISPRyl-AXP::SsSL was transformed into the competent cells of the recombinant strain CJ-6 using the Zymogen Frozen EZ Yeast Transformation Kit II from Zymo Research Corporation, and the cells were spread on plates for screening. Screening was carried out using the yeast screening medium YNB. After activating the positive clones identified by PCR, they were streaked on a 5-FOA-YPD plate and placed in an incubator at 30 °C for 3 days. Single colonies were streaked simultaneously on a yeast screening medium YNB-URA plate and a yeast screening medium YNB plate, and the growth of the bacteria was observed. Single colonies that could grow on the yeast screening medium YNB-URA plate but could not grow on the yeast screening medium YNB plate were identified by PCR again. The positive clones that successfully discarded the free-form knock-in / knock-out plasmid containing URA were named the recombinant strain CJ-7.
[0144] 8. Construction of the recombinant strain CJ-8
[0145] As shown in Table 7, the pCRISPRyl-F262::SsSL constructed in Example 1 was introduced into the competent cells of recombinant bacterium CJ-7 to obtain recombinant bacterium CJ-8. The specific method is as follows:
[0146] (1) The recombinant bacterium CJ-7 was cultured in YPD liquid medium for 24 h and then used to prepare competent cells.
[0147] (2) The recombinant plasmid pCRISPRyl-F262::SsSL was transformed into the competent cells of recombinant bacterium CJ-7 using the Zymogen Frozen EZ Yeast Transformation Kit II yeast transformation kit from Zymo Research Corporation, and the plate was screened. Screening was carried out using yeast screening medium YNB. The positive clones identified correctly by PCR were activated and streaked on a 5-FOA-YPD plate, and then placed in an incubator at 30 °C for 3 days. Single colonies were streaked simultaneously on a yeast screening medium YNB-URA plate and a yeast screening medium YNB plate, and the growth of the bacteria was observed. Single colonies that could grow on the yeast screening medium YNB-URA plate but could not grow on the yeast screening medium YNB plate were identified by PCR again. The positive clones that successfully discarded the free-form knock-in / knock-out plasmid containing URA were named recombinant bacterium CJ-8.
[0148] Example 3
[0149] 1. Fermentation culture and product treatment of yeast engineering bacteria
[0150] Fermentation culture of yeast engineering bacteria:
[0151] The recombinant bacteria CJ-1, CJ-2, CJ-3, CJ-4, CJ-5, CJ-6, CJ-7 and CJ-8 constructed in Example 2 were respectively used for fermentative production of sclareol. The specific method is as follows: The recombinant bacteria were activated, streaked on a YPD solid medium plate and cultured at 30 °C for 36 h to obtain single colonies. Multiple single colonies were picked and inoculated into 5 mL of YPD fermentation medium and cultured for 30 h to obtain a seed solution (OD 600 = 6), and then inoculated into 50 mL of YPD fermentation medium at an inoculation amount of initial OD 600 = 0.5, and fermented at 30 °C and 220 rpm for 12 h, then n-dodecane accounting for 10% of the fermentation broth volume was added, and the shaking culture was continued for 6 days.
[0152] Treatment of fermentation products:
[0153] After fermentation, the fermentation broth was transferred to a 50 mL centrifuge tube, centrifuged at 7500 rpm for 8 min, and the uppermost organic phase was collected for standby.
[0154] 2. Qualitative and Quantitative Analysis of Sclareol
[0155] Detection of Sclareol:
[0156] The fermentation products of each recombinant bacterium were diluted 10 times with dodecane and then filtered through an oil-based nylon filter membrane (0.22 μm), and detected by gas chromatography-mass spectrometry (GC-MS).
[0157] GC-MS detection conditions: injection port temperature 250 °C, injection volume 1 μL, non-split; chromatographic column: Agilent HP-5ms (30 m × 250 μm × 0.25 μm); chromatographic conditions: initial temperature 60 °C, rising to 160 °C at a rate of 10 °C / min, holding time 1 min, then rising to 280 °C at 40 °C / min and holding for 4 min. The entire gas phase program is 18 min in total, and a standard product of sclareol is used for qualitative and quantitative analysis.
[0158] The results of GC-MS detection are shown in Table 8. Among them, the sclareol yield of the recombinant bacterium CJ-8 is the highest, reaching 2747.50 mg / L, that is, 2747.50 mg of sclareol is produced per liter of fermentation broth. The GC-MS detection spectrum of sclareol produced by the recombinant bacterium CJ-8 after 6 days of fermentation is shown in Figure 2 ... The results in Table 8 show that the ability of strain CJ-8 to produce sclareol has been greatly improved, indicating that by introducing truncated geranylgeranyl pyrophosphate synthase tPaGGPPS, multi-copy expression of the SsSL fusion protein, strengthening the ERG19 gene, ERG13 gene, ERG12 gene and ERG8 gene in the MVA pathway, and regulating the acetyl-CoA metabolic flux, the sclareol yield can be significantly increased.
[0159] Table 8 Sclareol Yields of Different Strains
[0160] Strain name Sclareol production (mg / L) Yarrowia lipolytica Po1f-tHEI 0 CJ-1 29.83 CJ-2 342.68 CJ-3 445.93 CJ-4 858.11 CJ-5 931.30 CJ-6 1113.17 CJ-7 1898.56 CJ-8 2747.50
[0161] The above-described embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. A recombinant Yarrowia lipolytica yeast with high yield of sclareol, characterized in that, Using Yarrowia lipolytica as the initial strain, an expression cassette containing the geranylgeranyl pyrophosphate synthase tPaGGPPS gene, sclareol synthase SsSCS gene, labda-8,13-dienyl diphosphate synthase SsLPPS gene, diphosphomevalonate decarboxylase ERG19 gene, 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 gene, mevalonate kinase ERG12 gene, phosphomevalonate kinase ERG8 gene, and carnitine O-acetyltransferase CAT2 gene was introduced, and at the same time, the diacylglycerol acyltransferase DGA2 gene was knocked out to obtain the recombinant Yarrowia lipolytica; The nucleotide sequence of the geranylgeranyl pyrophosphate synthase tPaGGPPS gene is shown in SEQ ID NO.1; the nucleotide sequence of the sclareol synthase SsSCS gene is shown in SEQ ID NO.2; the nucleotide sequence of the labda-8,13-dienyl diphosphate synthase SsLPPS gene is shown in SEQ ID NO.
3.
2. The recombinant Yarrowia lipolytica according to claim 1, characterized in that, The copy number of the sclareol synthase SsSCS gene is 4 copies, and the copy number of the labda-8,13-dienyl diphosphate synthase SsLPPS gene is 4 copies.
3. The recombinant Yarrowia lipolytica according to claim 1, characterized in that, The accession number of the diphosphomevalonate decarboxylase ERG19 gene is GeneID: 2907970, the accession number of the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 gene is GeneID: 2907642, the accession number of the mevalonate kinase ERG12 gene is GeneID: 2906793, the accession number of the phosphomevalonate kinase ERG8 gene is GeneID: 2912386, the accession number of the carnitine O-acetyltransferase CAT2 gene is GeneID: 2906787, and the accession number of the diacylglycerol acyltransferase DGA2 gene is GeneID: 2910950.
4. The recombinant Yarrowia lipolytica according to claim 1, characterized in that, The Yarrowia lipolytica is Yarrowia lipolytica Po1f-tHEI.
5. The recombinant Yarrowia lipolytica according to claim 1, characterized in that, The promoter of the expression cassette is PFBAin, Php4d or PTEFin, and the terminator is Tsynth7t or Txpr2t.
6. The method for constructing the recombinant Yarrowia lipolytica according to claim 1, characterized in that, It includes the following steps: An expression cassette containing the geranylgeranyl pyrophosphate synthase tPaGGPPS gene, sclareol synthase SsSCS gene, labda-8,13-dienyl diphosphate synthase SsLPPS gene, diphosphomevalonate decarboxylase ERG19 gene, 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 gene, mevalonate kinase ERG12 gene, phosphomevalonate kinase ERG8 gene, and carnitine O-acetyltransferase CAT2 gene was introduced into the initial strain in the form of a plasmid, and the diacylglycerol acyltransferase DGA2 gene was knocked out to obtain the recombinant Yarrowia lipolytica.
7. The construction method according to claim 6, characterized in that, The copy number of the sclareol synthase SsSCS gene is 4 copies, and the copy number of the labda-8,13-dienyl diphosphate synthase SsLPPS gene is 4 copies; The accession number of the mevalonate pyrophosphate decarboxylase ERG19 gene is GeneID: 2907970, the accession number of the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 gene is GeneID: 2907642, the accession number of the mevalonate kinase ERG12 gene is GeneID: 2906793, the accession number of the phosphomevalonate kinase ERG8 gene is GeneID: 2912386, the accession number of the carnitine O-acetyltransferase CAT2 gene is GeneID: 2906787, and the accession number of the diacylglycerol acyltransferase DGA2 gene is GeneID: 2910950.
8. The construction method according to claim 6, characterized in that, The initial strain is Yarrowia lipolytica Po1f-tHEI; The promoter of the expression cassette is PFBAin, Php4d or PTEFin, and the terminator is Tsynth7t or Txpr2t.
9. Use of the recombinant Yarrowia lipolytica according to any one of claims 1-5 in the production of sclareol.
10. A method for producing sclareol, characterized in that, It includes the step of fermenting and producing sclareol by using the recombinant Yarrowia lipolytica according to any one of claims 1-5.
Citation Information
Patent Citations
Recombinant yarrowia lipolytica with high yield of beta-elemene as well as construction method and application of recombinant yarrowia lipolytica
CN116656518A
Recombinant yarrowia lipolytica with high yield of beta-elemene as well as construction method and application thereof
CN117660516A
Recombinant yarrowia lipolytica capable of efficiently and rapidly producing sclareol as well as construction method and application of recombinant yarrowia lipolytica
CN119351238A
Method for improving biosynthesis efficiency of sclareol
CN119530267A
Pichia pastoris engineering strain with high yield of sclareol as well as construction method and application of pichia pastoris engineering strain
CN119530270A
Cited By
Recombinant strain with high yield of sclareol as well as construction method and application of recombinant strain
CN120944862A