Gene recombinant peptide rRGD3mu targeting ITGB1 and application of gene recombinant peptide rRGD3mu

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a gene recombinant peptide rRGD3mu targeting ITGB1 and application of the gene recombinant peptide rRGD3mu, and the amino acid sequence of the gene recombinant peptide rRGD3mu is as shown in SEQ ID NO.1. The gene recombinant peptide rRGD3mu is synthesized and disclosed for the first time, experiments prove that the gene recombinant peptide rRGD3mu strongly inhibits generation and development of tumor cells by taking ITGB1 as a target spot, and the gene recombinant peptide rRGD3mu can be applied to the field of preparation of targeted tumor drugs.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a gene recombinant peptide rRGD3 targeting ITGB1 mu and its application. Background Art

[0002] Cancer has currently become the leading cause of death globally, and the development of highly effective and low-toxic anti-cancer drugs has become an important goal in the current pharmaceutical field.

[0003] Currently, in addition to traditional chemotherapy drugs and hormonal drugs, anti-cancer drugs also cover multiple fields such as targeted therapy drugs, immunotherapy drugs, and epigenetic drugs. Targeted therapy drugs include small molecule inhibitor drugs targeting specific gene mutations (such as EGFR, ALK, BRAF inhibitors) and monoclonal antibodies (such as Herceptin for the treatment of HER2-positive breast cancer and Rituximab for B-cell lymphoma); immunotherapy drugs include immune checkpoint inhibitors such as PD-1 / PD-L1 inhibitors (such as Keytruda, Opdivo) and CTLA-4 inhibitors (such as Yervoy); epigenetic drugs that can inhibit tumor growth by regulating gene expression include protein deacetylase (HDAC) inhibitors and DNA methyltransferase inhibitors. Among the above anti-cancer drugs, targeted therapy drugs have shown great potential due to their precise target anti-cancer effects. However, it cannot be ignored that targeted anti-cancer drugs still have their own limitations, which include: drug resistance due to gene mutations and bypass activation of cancer cells, target limitations due to target dependence and heterogeneity of cancer cells, high R & D costs and treatment costs, uncertain long-term effects, and the impact of patient gene differences on drug efficacy. Therefore, it has become an urgent task to find broad-spectrum, highly effective, and low-cost targeted anti-cancer drugs. Summary of the Invention

[0004] The purpose of the present invention is to provide a gene recombinant peptide rRGD3 targeting ITGB1 mu and its application. The present invention synthesizes and discloses the gene recombinant peptide rRGD3 for the first time mu , and it is experimentally confirmed that the gene recombinant peptide rRGD3 mu strongly inhibits the occurrence and development of tumor cells by targeting ITGB1.

[0005] The present invention provides a gene recombinant peptide rRGD3 targeting ITGB1 mu , and the amino acid sequence of the gene recombinant peptide rRGD3 mu is shown as SEQ ID NO.1.

[0006] The present invention also provides the gene recombinant peptide rRGD3 muAn alternative, said alternative comprising an active peptide having at least 90% homology with SEQ ID NO.1 based on conservative amino acid substitutions and / or an active peptide comprising at least the SEQ ID NO.1 sequence.

[0007] The present invention also provides a gene recombinant peptide rRGD3 encoding the above mu or a nucleic acid molecule of the above alternative.

[0008] The present invention also provides the gene recombinant peptide rRGD3 mu or the above alternative or the above nucleic acid molecule for use in the preparation of an anti-tumor drug.

[0009] The present invention also provides a primer pair for amplifying the above nucleic acid molecule, said primer pair comprising a forward primer and a reverse primer; the nucleotide sequence of the forward primer is as shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO.3.

[0010] The present invention also provides a biomaterial containing the above nucleic acid molecule and expressing the gene recombinant peptide rRGD3 mu or the above alternative.

[0011] The present invention also provides the above primer pair or the above biomaterial for use in the preparation of an anti-tumor drug.

[0012] The present invention also provides an anti-tumor drug comprising the gene recombinant peptide rRGD3 mu 、the above alternative, the above nucleic acid molecule, the above biomaterial and one or more of small molecule agonists related to the above nucleic acid molecule.

[0013] As a preferred embodiment, the anti-tumor drug further comprises a pharmaceutically acceptable excipient or carrier; the preparation form of the anti-tumor drug includes tablets, pills, powders or injections.

[0014] As a preferred embodiment, calculated by the body weight of the mouse, the dosage of the anti-tumor drug is 25 - 100 μg / kg.

[0015] Beneficial effects: The present invention provides a gene recombinant peptide rRGD3 targeting ITGB1 mu , the amino acid sequence of the gene recombinant peptide rRGD3 mu is as shown in SEQ ID NO.1. The present invention synthesizes and discloses the gene recombinant peptide rRGD3 for the first time mu , and through experiments, it is confirmed that the gene recombinant peptide rRGD3 mu by targeting ITGB1, potently inhibits the occurrence and development of tumor cells, and can be applied to the field of preparation of targeted tumor drugs, rRGD3mu It is expected to be applied to the field of preparing anti-tumor drugs targeting ITGB1. Brief Description of the Drawings

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments.

[0017] Figure 1 Tricine SDS-PAGE electrophoresis pattern of the purified rRGD3 peptide in Example 1; among them, lane 2 is the prestained ultra-low molecular weight protein Marker; lanes 1, 3, and 4 are the purified protein rRGD3 mu ; mu ;

[0018] Figure 2 Inhibitory effect of rRGD3 on the proliferation of human nasopharyngeal carcinoma CNE2 cells detected by the CCK method in Example 2; among them, A is the inhibitory effect of rRGD3 within 24 hours, the abscissa is the concentration (μM) of rRGD3, the ordinate is the viability (%) of human nasopharyngeal carcinoma CNE2 cells, and the IC mu is 2.118 μM; B is the inhibitory effect of rRGD3 within 48 hours, the abscissa is the concentration (μM) of rRGD3, the ordinate is the viability (%) of human nasopharyngeal carcinoma CNE2 cells, and the IC mu is 1.246 μM; C is the inhibitory effect of rRGD3 within 72 hours, the abscissa is the concentration (μM) of rRGD3, the ordinate is the viability (%) of human nasopharyngeal carcinoma CNE2 cells, and the IC mu is 0.8172 μM; 50 Inhibitory effect of rRGD3 on the activities of human nasopharyngeal carcinoma CNE2 cells in Example 3; among them, A is the inhibitory effect of rRGD3 on the migration, invasion, and colony formation of CNE2 cells, Scale bar = 100 μm; B is the inhibitory effect of rRGD3 on the adhesion of CNE2; C is the induction of apoptosis of CNE2 cells shown by Giemsa staining under the action of rRGD3, Scale bar = 100 μm, n = 3, compared with the control group, *p < 0.05, **p < 0.01. mu Inhibitory effect of rRGD3 on the adhesion of CNE2; C is the induction of apoptosis of CNE2 cells shown by Giemsa staining under the action of rRGD3, Scale bar = 100 μm, n = 3, compared with the control group, *p < 0.05, **p < 0.01. mu is 0.8172 μM; 50 Inhibitory effect of rRGD3 on the activities of human nasopharyngeal carcinoma CNE2 cells in Example 3; among them, A is the inhibitory effect of rRGD3 on the migration, invasion, and colony formation of CNE2 cells, Scale bar = 100 μm; B is the inhibitory effect of rRGD3 on the adhesion of CNE2; C is the induction of apoptosis of CNE2 cells shown by Giemsa staining under the action of rRGD3, Scale bar = 100 μm, n = 3, compared with the control group, *p < 0.05, **p < 0.01. mu Inhibitory effect of rRGD3 on the activities of human nasopharyngeal carcinoma CNE2 cells in Example 3; among them, A is the inhibitory effect of rRGD3 on the migration, invasion, and colony formation of CNE2 cells, Scale bar = 100 μm; B is the inhibitory effect of rRGD3 on the adhesion of CNE2; C is the induction of apoptosis of CNE2 cells shown by Giemsa staining under the action of rRGD3, Scale bar = 100 μm, n = 3, compared with the control group, *p < 0.05, **p < 0.01. mu is 0.8172 μM; 50 Inhibitory effect of rRGD3 on the activities of human nasopharyngeal carcinoma CNE2 cells in Example 3; among them, A is the inhibitory effect of rRGD3 on the migration, invasion, and colony formation of CNE2 cells, Scale bar = 100 μm; B is the inhibitory effect of rRGD3 on the adhesion of CNE2; C is the induction of apoptosis of CNE2 cells shown by Giemsa staining under the action of rRGD3, Scale bar = 100 μm, n = 3, compared with the control group, *p < 0.05, **p < 0.01.

[0019] Figure 3 rRGD3 in Example 4 mu Effect of rRGD3 on human nasopharyngeal carcinoma CNE2 cells; among them, A is the inhibitory effect of rRGD3 on the migration, invasion, and colony formation of CNE2 cells, Scale bar = 100 μm; B is the inhibitory effect of rRGD3 on the adhesion of CNE2; C is the induction of apoptosis of CNE2 cells shown by Giemsa staining under the action of rRGD3, Scale bar = 100 μm, n = 3, compared with the control group, *p < 0.05, **p < 0.01. mu Effect of rRGD3 on the migration, invasion, and colony formation of CNE2 cells, Scale bar = 100 μm; B is the inhibitory effect of rRGD3 on the adhesion of CNE2; C is the induction of apoptosis of CNE2 cells shown by Giemsa staining under the action of rRGD3, Scale bar = 100 μm, n = 3, compared with the control group, *p < 0.05, **p < 0.01. mu Effect of rRGD3 on the adhesion of CNE2; C is the induction of apoptosis of CNE2 cells shown by Giemsa staining under the action of rRGD3, Scale bar = 100 μm, n = 3, compared with the control group, *p < 0.05, **p < 0.01. mu Induction of apoptosis of CNE2 cells under the action of rRGD3 shown by Giemsa staining, Scale bar = 100 μm, n = 3, compared with the control group, *p < 0.05, **p < 0.01.

[0020] Figure 4 rRGD3 in Example 4mu Inhibitory effect on xenograft tumors of human nasopharyngeal carcinoma CNE2 cells in nude mice; among them, A is rRGD3 mu Effect on the body weight change trend of tumor-bearing nude mice; B is rRGD3 mu Effect on the volume and growth trend of subcutaneous xenograft tumors; C is rRGD3 mu Apparent graph of the effect on the volume and growth trend of subcutaneous xenograft tumors; D is rRGD3 mu Effect on the weight of subcutaneous xenograft tumors, n = 6; E is rRGD3 mu H&E staining result graph of tumor tissue after the action of subcutaneous xenograft tumors, Scale bar = 100μm (100×) (upper part) and 50μm (200×) (lower part), *p < 0.05, **p < 0.01 vs the model group;

[0021] Figure 5 It is rRGD3 in Example 5 mu Inhibitory effect of rRGD3 on human nasopharyngeal carcinoma CNE2 cells and related results of ITGB1; among them, A is the Limma differential analysis to detect the expression of ITGB1 in HNSC patients, n = 566; B is the Western Blot analysis of the expression levels of ITGB1 in NP69 cells and CNE2 cells, n = 3; C-D is rRGD3 detected by Western Blot mu Expression level of ITGB1 in CNE2 cells after drug administration, n = 3, *p < 0.05, **p < 0.01; E is the gray value statistical graph of the expression levels of ITGB1 in NP69 cells and CNE2 cells analyzed by Western Blot, n = 3; F-G is rRGD3 detected by Western Blot mu Gray value statistical graph of the expression level of ITGB1 in CNE2 cells after drug administration, n = 3, *p < 0.05, **p < 0.01. Detailed implementation mode

[0022] The present invention provides a gene recombinant peptide rRGD3 targeting ITGB1 mu , said gene recombinant peptide rRGD3 mu The amino acid sequence is shown in SEQ ID NO.1: RGDCRGDTRRHTWRHTRRHTDTHGHTRRHKLRHEHTQRHTGARGDARRHGHNKHLHRCHHHHH*. Examples of the present invention prove that rRGD3 mu can down-regulate the ITGB1 molecule in human nasopharyngeal carcinoma CNE2 cells, and with the increase of the drug administration concentration, the expression level of ITGB1 gradually decreases. It is speculated that ITGB1 is the target of rRGD3 muKey targets for treating nasopharyngeal carcinoma.

[0023] The present invention also provides an alternative to the gene recombinant peptide rRGD3 mu The alternative includes an active peptide having at least 90% or more homology with the SEQ ID NO.1 based on amino acid conservative substitution and / or an active peptide containing at least the SEQ ID NO.1 sequence. As a specific embodiment, the active peptide is not limited to the 63-amino acid sequence of the present invention. Any sequence containing the sequence segment shown in SEQ ID NO.1 of the present invention will have antitumor activity on the basis of retaining the integrity of the sequence segment.

[0024] As a specific embodiment, the homology includes any one of homologies of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% or more.

[0025] As a specific embodiment, the conservative substitution means that one amino acid is replaced by another amino acid within the same category. For example, one acidic amino acid is replaced by another acidic amino acid, one basic amino acid is replaced by another basic amino acid, or one neutral amino acid is replaced by another neutral amino acid. Exemplary substitutions are shown in Table 1.

[0026] Table 1 Exemplary amino acid substitutions

[0027]

[0028]

[0029] The present invention also provides a nucleic acid molecule encoding the gene recombinant peptide rRGD3 mu or the alternative. As a specific embodiment, the sequence of the nucleic acid molecule is as shown in SEQ ID NO.4: 5’-CGTGGAGACTGTCGTGGAGACACACGGAGACACACGTGGAGACACACGCGGAGACACACGGACACACACGGACACACACGGAGACACAAGCTGAGGCACGAACACACGCAGAGACACACGGGGGCCCGCGGAGACGCACGGAGACACGGACACAACAAACATTTACACAGATGTCACCACCACCACCACTGA-3’. As a specific embodiment, the key of the nucleic acid molecule of the present invention is that it can encode the gene recombinant peptide rRGD3 mu or the alternative; it can be understood that without affecting the gene recombinant peptide rRGD3 of the present invention muBased on the coding or expression of the above-mentioned alternatives, sequences with other functions can also be added to both ends of the nucleic acid molecule sequence of the present invention, which are not specifically limited herein. It can be understood that the sequence shown in SEQ ID NO.4 is only the nucleotide sequence specifically obtained in one implementation manner of the present invention. On this basis, other nucleotide sequences that can also encode the recombinant peptide rRGD3 of the present invention can be designed according to the degeneracy of codons. mu Or the nucleic acid sequence of the above-mentioned alternative, which is not specifically limited herein.

[0030] The present invention also provides the recombinant peptide rRGD3 described above. mu Or the application of the above-mentioned alternative or the nucleic acid molecule in the preparation of anti-tumor drugs.

[0031] The present invention also provides a primer pair for amplifying the nucleic acid molecule. The primer pair includes a forward primer and a reverse primer; the nucleotide sequence of the forward primer is as shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO.3.

[0032] The sequences of the primer pair of the present invention are as follows:

[0033] Forward primer (SEQ ID NO.2): 5’-CATATGCGTGGAGACTGTCGTGGAGA-3’;

[0034] Reverse primer (SEQ ID NO.3): 5’-AAGCTTTCAGTGGTGGTGGTGGTGAC-3’.

[0035] The present invention also provides a biological material containing the nucleic acid molecule and expressing the recombinant peptide rRGD3 mu Or the above-mentioned alternative. As a specific implementation manner, the biological material includes one or more of a recombinant sequence containing the nucleic acid molecule, a recombinant expression vector containing the nucleic acid molecule, and a recombinant cell containing the nucleic acid molecule. As a specific implementation manner, the basic backbone of the recombinant expression vector containing the nucleic acid molecule includes the pET23b vector. In a specific embodiment of the present invention, the recombinant expression vector containing the nucleic acid molecule is obtained by inserting the nucleic acid molecule into the pET23b vector to obtain pET23b-rRGD3 mu Recombinant expression vector. As a specific implementation manner, the recombinant cell containing the nucleic acid molecule includes BL21(DE3) E.coli cells containing the nucleic acid molecule.

[0036] The present invention also provides the application of the above-mentioned primer pair or the biological material in the preparation of anti-tumor drugs. The present invention has been experimentally confirmed that rRGD3 muIt has the ability to inhibit the activities of human nasopharyngeal carcinoma CNE2 cells in vitro, and can inhibit the migration, invasion, and adhesion of CNE2 cells in a dose-dependent manner, and can also inhibit the proliferation of CNE2 cells by inducing apoptosis.

[0037] The present invention also provides an anti-tumor drug, comprising the recombinant peptide rRGD3 mu and one or more of the substitute, the nucleic acid molecule, the biomaterial, and the small molecule agonist related to the nucleic acid molecule. As a specific embodiment, the anti-tumor drug further comprises a pharmaceutically acceptable excipient or carrier; the dosage form of the anti-tumor drug includes tablets, pills, powders, or injections.

[0038] In the present invention, based on the body weight of mice, the dosage of the anti-tumor drug is 25-100 μg / kg. As a specific embodiment, the dosage can be any one of 25 μg / kg, 30 μg / kg, 35 μg / kg, 40 μg / kg, 45 μg / kg, 50 μg / kg, 55 μg / kg, 60 μg / kg, 65 μg / kg, 70 μg / kg, 75 μg / kg, 80 μg / kg, 85 μg / kg, 90 μg / kg, 95 μg / kg, and 100 μg / kg. As a specific embodiment, with the increase of the rRGD3 mu administration dose, the area of cell necrosis gradually increases, the number of nuclear fragmentation increases, the formation of vacuoles increases, and a large amount of newly formed fibrous connective tissue can be seen; compared with the positive control group, the changes in the high-dose group (100 μg / kg) of rRGD3 mu are more obvious.

[0039] The present invention first synthesizes and discloses the recombinant peptide rRGD3 mu , and through experiments, it is confirmed that the recombinant peptide rRGD3 mu strongly inhibits the occurrence and development of tumor cells by targeting ITGB1, and can be applied to the field of preparing targeted tumor drugs. rRGD3 mu is expected to be applied to the field of preparing anti-tumor drugs targeting ITGB1.

[0040] In order to further illustrate the present invention, the following examples will be used to describe in detail a recombinant peptide rRGD3 mu targeting ITGB1 provided by the present invention and its applications, but they should not be construed as limiting the protection scope of the present invention.

[0041] Unless otherwise specified, the present invention has no special requirements for the preparation raw materials, and commercially available products well-known to those skilled in the art can be used.

[0042] Example 1 rRGD3mu Recombinant Expression and Preparation

[0043] 1. rRGD3 mu Gene Cloning and Screening and Identification of Positive Recombinant

[0044] 1) Acquisition of rRGD3 mu gene: The rRGD3 mu gene (as shown in SEQ ID NO.4) was obtained by artificial synthesis. When synthesizing this sequence gene, an Nde I restriction site was added to the 5' end of the sequence, and a HindIII restriction site was added to the 3' end of the sequence. The artificial gene synthesis was completed by Nanjing Genscript Biotechnology Co., Ltd.

[0045] 2) Ligation of the target gene DNA fragment with the vector pET23b (manufacturer: Biovector NTCC.Inc., catalog number: 590272): Since the designed primers respectively carry Nde I and Hind III restriction sites, and these two restriction sites are also the multiple cloning sites of pET23b, this makes it possible to ligate the target gene DNA fragment with the vector pET23b. After ligation, pET23b-rRGD3 mu recombinant expression vector was obtained. The primer sequences are as follows:

[0046] P1: 5'-CATATGCGTGGAGACTGTCGTGGAGA-3' (as shown in SEQ ID NO.2);

[0047] P2: 5'-AAGCTTTCAGTGGTGGTGGTGGTGAC-3' (as shown in SEQ ID NO.3).

[0048] 3) The ligation product pET23b-rRGD3 mu recombinant expression vector was transformed into the cloning bacterium BL21(DE3) E.coli (E.coli BL21, Bivector NTCC.Inc., catalog number: NTCC503982.) by the CaCl2 method: The host bacterium E.coli BL21 was inoculated into LB (Amp - ) and cultured overnight. The next day, part of the bacterial solution was transferred to 50 mL of LB culture medium and continued to be cultured at 37°C until OD 600Reach 0.3. Place the culture on ice for 10 min, centrifuge at 5000 rpm at 4 °C for 10 min. Discard the supernatant, invert the centrifuge tube for 1 min, add 5 mL of ice-precooled 0.1 M CaCl2 solution to sensitize and suspend the cells, and place on ice for 10 min. Centrifuge at 5000 rpm at 4 °C for 10 min to recover the cells, discard the supernatant, add 2 mL of ice-cold 0.1 M CaCl2 solution to every 25 mL of the original culture, suspend the cells and place on ice for 3 h, and aliquot the cells at 200 μL per portion. Add 10 μL of the pET23b-rRGD3 mu recombinant expression vector solution to 200 μL of competent cells and gently mix. After heat shock at 42 °C for 90 s, quickly return it to ice. After cooling the cells for 2 min, add 800 μL of LB (Amp - ) medium, and shake the bacteria at 37 °C at 225 rpm for 90 min. Take 100 μL of the transformation product and spread it on a 90 mm LB (Amp + ) agar plate. After placing it at room temperature for 30 min, invert the petri dish and culture it at 37 °C for 16 h. After colonies grow on the LB (Amp + ) agar plate, screening and identification of positive transformants can be carried out.

[0049] 4) Screening and identification of positive transformants: Identification is carried out by double digestion with Bg II and Hind III. After the 150 bp gene fragment (including the restriction site sequence) of rRGD3 mu is inserted into the pET23b plasmid, the plasmid that can be double-digested to obtain fragments with lengths of 2228 bp and 1587 bp is the positive recombinant plasmid.

[0050] Double digestion reaction system: 1 μL of Bg II, 1 μL of Hind III, 2 μL of K Buffer, 100 ng of pET23b, and make up to 20 μL with H2O.

[0051] 2. Induce the expression of the positive recombinant bacteria with IPTG at a final concentration of 1 mM. The induction expression conditions are overnight induction at 30 °C.

[0052] 3. Extraction and purification of rRGD3 mu peptide

[0053] 1) Extraction of soluble bacterial supernatant: Centrifuge at 10000 g for 10 min to harvest the bacteria, discard the supernatant, and let the residual liquid flow out as much as possible. Resuspend the cells at a ratio of adding 4 mL of ice-cold 1×Binding buffer to every 100 mL of the original culture medium. Place the above sample on ice and ultrasonically lyse the cells until the solution is no longer viscous. Centrifuge at 14000 g for 20 min to remove cell debris.

[0054] 2) Filter the supernatant with a 0.45 μm disposable sterilizing filter.

[0055] 3) Equilibrate a 1 mL nickel ion affinity chromatography column with 10 mL of 1× Binding Buffer and then load the sample.

[0056] 4) Wash the column with 10 mL of 1× Binding Buffer.

[0057] 5) Wash the column with 10 mL of 1× Wash Buffer.

[0058] 6) Elute the target protein with 5 mL of 1× Elute Buffer.

[0059] The buffer formulation is shown in Table 2.

[0060] Table 2 Buffer Formulation

[0061] Stock solution Formulation 8×Binding Buffer 40 mM imidazole; 4 M NaCl; 160 mM Tris-HCl (pH 7.9) 8×Wash Buffer 480 mM imidazole; 4 M NaCl; 160 mM Tris-HCl (pH 7.9). 4×Elute Buffe 4 M imidazole; 2 M NaCl; 80 mM Tris-HCl (pH 7.9).

[0062] 4. Identification by Tricine-SDS PAGE

[0063] Perform identification of rRGD3 by Tricine SDS-PAGE for small molecular weight proteins with a 16.5% separating gel concentration containing urea. mu The specific operation is as follows:

[0064] 1) Prepare the stock solutions as shown in Table 3;

[0065] Table 3 Preparation of Stock Solutions

[0066] Stock solution Formulation Anode buffer 0.2 M Tris, pH 8.9 Cathode buffer 0.1 M Tris, 0.1 M Tricine, 0.1% SDS, pH 8.25 Gel Buffer 3.0 M Tris, 0.3% SDS Acrylamide-bisacrylamide (49.5% T, 3% C) 48% acrylamide (w / v), 1.5% bisacrylamide (w / v) Acrylamide-bisacrylamide (49.5% T, 6% C) 46.5% acrylamide (w / v), 3% bisacrylamide (w / v)

[0067] 2) Prepare the gel plate:

[0068] Tricine SDS-PAGE requires the preparation of three layers of gel, and the concentrations of the three layers of gel are shown in Table 4;

[0069] Table 4 Concentrations of the Three Layers of Gel

[0070] Stacking Gel concentration 4% T, 3% C Spacer Gel concentration 10% T, 3% C Separating Gel concentration containing 6 M urea 16.5% T, 6% C

[0071] 3) Electrophoresis: The initial voltage is 30 V to ensure that all samples completely enter the stacking gel. Then run the spacer gel at 80 V and the separating gel at 150 V;

[0072] 4) Quick fixation, staining, and decolorization: Fix in a fixing solution composed of 50% methanol and 10% glacial acetic acid for 60 min, stain for 2 h, and decolorize in a decolorizing solution (10% glacial acetic acid), changing the solution every 30 min until the protein bands are clearly visible.

[0073] The specific results are as follows Figure 1 shown Figure 1 as the Tricine SDS-PAGE electrophoresis diagram of purified peptide rRGD3 mu Among them, lanes 1, 3, and 4 are the purification results of rRGD3 mu and lane 2 is the protein molecular weight standard. It can be seen that the purity of the extracted rRGD3 Figure 1 is higher than 95%. The protein concentration was measured by the Coomassie Brilliant Blue G-250 method, and the average concentration of the purified rRGD3 we obtained mu was measured to be 0.485 μg / μL. mu

[0074] Example 2 Detection of the effect of rRGD3 mu on the proliferation of human nasopharyngeal carcinoma CNE2 cells

[0075] 1. After trypsin treatment, the CNE2 cells cultured to the logarithmic phase (AoYinbio Cell Center, SAc0502) were centrifuged for 3 min (2000 rpm), the supernatant was discarded, and an appropriate amount of complete medium was added to prepare a cell suspension with a density of 1×10 5 / ml;

[0076] 2. Take a 96-well plate, add 100 μL of cell suspension and rRGD3 at gradient concentrations (0 μM, 0.5 μM, 1 μM, 2 μM, 4 μM, 6 μM, 8 μM, and 16 μM) to each well mu , and the volume of the added drug was made up to 10 μL with PBS, and they were cultured at 37°C and 5% CO2 for 24 h, 48 h, and 72 h respectively;

[0077] 3. Add 10 μL of CCK-8 solution (MCE) to each well and continue to culture for 4 h;

[0078] 4. Use an enzyme-linked immunosorbent assay (ELISA) reader to detect the OD value of each well at a wavelength of 450 nm;

[0079] 5. Conduct 6 groups of repeated experiments, take the average value, and use Excel to statistically calculate the proliferation activity of rRGD3 mu on CNE2 cells. The formula is as follows:

[0080] Cell viability = (average OD value of each group of cells / average OD value of the control group) × 100%

[0081] 6. Use GraphPad Prism 8.0 to plot the graph and calculate the half-maximal inhibitory concentration IC 50 .

[0082] The specific results are as follows Figure 2As shown, the abscissa is the concentration of rRGD3 mu , with the unit of μM; the ordinate is the cell viability (%) of CNE2 cells. Among them, A is the effect of gradient concentration of rRGD3 mu acting on CNE2 cells for 24 h on cell viability; B is the effect of gradient concentration of rRGD3 mu acting on CNE2 cells for 48 h on cell viability; C is the effect of gradient concentration of rRGD3 mu acting on CNE2 cells for 72 h on cell viability. It can be seen from the experimental results that rRGD3 mu can inhibit the proliferation of human nasopharyngeal carcinoma CNE2 cells in a dose-dependent manner in vitro. The IC50 values at 24 h, 48 h, and 72 h of its action are 2.118 μM, 1.246 μM, and 0.8172 μM respectively. rRGD3 mu inhibits the proliferation of CNE2 cells in a dose- and time-dependent manner.

[0083] Example 3 Effect of rRGD3 mu on the in vitro viability of human nasopharyngeal carcinoma CNE2 cells

[0084] 1. Observation of cell morphology by Giemsa staining: Take CNE2 cells in the logarithmic growth phase and inoculate them into 24-well plates at a density of 8×10 4 cells / well. When the cells are cultured to the appropriate density, rRGD3 mu drugs with different concentration gradients (1 μM, 2 μM, and 4 μM) are given, and the cells are continued to be cultured in the cell incubator for 24 h. After the drug administration is completed, the supernatant is discarded, and after washing with PBS, 4% paraformaldehyde is added for fixation, and then Giemsa staining solution is used for staining. After the staining is completed, the staining solution is slowly washed with sterilized water, and after drying, an inverted microscope is used for observation and photographs are taken to obtain experimental images.

[0085] 2. Transwell migration experiment: Each bottle (T25 cell culture bottle) of cells is digested with 1 ml of trypsin (Gibco) for 5 min, centrifuged for 3 min (2000 rpm), and resuspended with serum-free RPMI-1640 medium and rRGD3 mu drug solutions with different concentration gradients (1 μM, 2 μM, and 4 μM) to adjust the final concentration of the cell suspension to 1×10 5 cells / mL. 200 μL of cell suspension (i.e., 2×10 4 cells / well) is added to the Transwell chamber, and 700 μL of 20% RPMI-1640 medium is added to the lower chamber, and the cells are continued to be cultured in the cell incubator for 24 h. After the drug administration is completed, the chamber is taken out, washed with PBS, fixed with 4% paraformaldehyde, stained with crystal violet dye, and photographed with an inverted microscope.

[0086] 3. Transwell invasion assay: Matrigel matrix gel and serum-free RPMI-1640 medium were pre-mixed at a ratio of 1:7 and added to Transwell chambers at 80 μL / well, then placed in a cell incubator and allowed to solidify after 2 h. After cell digestion and centrifugation, the cells were resuspended with serum-free RPMI-1640 medium and rRGD3 mu drug solutions at different concentration gradients (1 μM, 2 μM, and 4 μM) to adjust the final concentration of the cell suspension to 1×10 5 cells / mL. 200 μL of the cell suspension was added to the Transwell chamber, and 700 μL of 20% RPMI-1640 medium was added to the lower chamber. The cells were further cultured in the cell incubator for 24 h. After 24 h, the chambers were taken out, washed with PBS, fixed with 4% paraformaldehyde, stained with crystal violet dye, and photographed using an inverted microscope.

[0087] 4. Adhesion assay: Three adhesion factors, vitronectin (VN), fibronectin (FN), and laminin (LN), were pre-diluted to adjust the final concentration to 0.1 μg / μL and added to 96-well plates at 40 μL / well respectively, then wrapped with tin foil and placed in a 4°C refrigerator overnight. The next day, the adhesion factors were recovered. After cell digestion and centrifugation, the cells were resuspended with 10% RPMI-1640 medium and rRGD3 mu drug solutions at different concentration gradients (1 μM, 2 μM, and 4 μM), and seeded into 96-well plates at a density of 2×10 4 cells / well, with 3 replicates in each group. The cells were cultured in the cell incubator for 24 h. After the drug treatment, CCK-8 reagent was added, and the absorbance value at a wavelength of 450 nm was measured using an enzyme-linked immunosorbent assay (ELISA) reader to calculate the cell adhesion rate.

[0088] 5. Cloning assay: Cells in the logarithmic growth phase were seeded into 6-well plates at a density of 5×10 3 cells / well. After the cells adhered, rRGD3 mu drugs at different concentration gradients (1 μM, 2 μM, and 4 μM) were added. After 24 h of drug administration, the supernatant was removed, and the cells were cultured under normal culture conditions for 14 days. When visible clones appeared, the culture was terminated. After removing the supernatant, the cells were washed, fixed, stained, dried, photographed, and counted.

[0089] The specific results are as Figure 3 shown, where Figure 3 in A, Giemsa staining shows the effect of rRGD3 mu on the morphology of CNE2 cells, n = 3, Scale bar = 100 μm. The experimental results show that the number of CNE2 cells in the control group is relatively large and the cell morphology is intact. As the concentration of rRGD3 muWith the increase of the administration concentration, the number of cells gradually decreased, and the cell morphology gradually shrank into a round shape. When the concentration of rRGD3 mu reached 2 μM, a large number of fragmented cells could be observed, and the cells were completely fragmented at 4 μM. This indicates that rRGD3 mu can inhibit the proliferation of CNE2 cells in a concentration-dependent manner and induce their death. Figure 3 In B, it is the effect of rRGD3 mu on the adhesion ability of CNE2 cells, n = 3. The experimental results show that compared with the control group, with the increase of the administration dose, the adhesion rates between CNE2 cells and the adhesion factors vitronectin (VN), fibronectin (FN), and laminin (LN) gradually decreased, and rRGD3 mu can effectively inhibit its adhesion ability. Figure 3 In C, it is the effect of rRGD3 mu on the migration, invasion, and cloning abilities of CNE2 cells, n = 3, Scale bar = 100 μm, *p < 0.05, **p < 0.01 vs the control group. The experimental results show that compared with the control group, with the increase of the administration concentration, the cell colonies significantly decreased. When the concentration of rRGD3 mu reached 4 μM, almost no cell colonies could be observed, significantly inhibiting the colony formation ability of CNE2 cells.

[0090] Thus, it can be seen that rRGD3 mu has the ability to inhibit the activities of human nasopharyngeal carcinoma CNE2 cells in vitro. It can inhibit the migration, invasion, and adhesion of CNE2 cells in a dose-dependent manner and inhibit the proliferation of CNE2 cells by inducing apoptosis.

[0091] Example 4 The effect of rRGD3 mu on the proliferation of transplanted tumors of human nasopharyngeal carcinoma CNE2 tumor cells in nude mice

[0092] 1. Establishment of a nude mouse subcutaneous transplanted tumor model: Take 30 male BALB / C nude mice at 3 - 4 weeks of age and pre-feed them in a SPF-grade specification for one week. Digest and centrifuge the CNE2 cells in the logarithmic growth phase, and resuspend the cells according to the ratio of Matrigel: serum-free RPMI-1640 medium = 1:5 to make the final concentration 2.5×10 7 cells / mL. Inject 200 μL of the CNE2 cell suspension into the right axilla of the nude mice, that is, 5×10 6 cells / mouse. Wait for the cells to form tumors in the nude mice after 10 days of growth.

[0093] 2. Drug administration and data recording: Randomly divided into 5 groups (n = 6): model group, low-dose rRGD3mu group (25 μg / kg), medium-dose rRGD3mu group (50 μg / kg), high-dose rRGD3mu group (100 μg / kg), and 5-Fu (MCE, HY-90006) positive control group (10 mg / kg). Drugs and an equal amount of normal saline were continuously intraperitoneally injected daily (b.i.d) for 14 days. During this period, the body weight (g), major axis a (mm), and minor axis b (mm) of the nude mice were measured every other day, and the tumor volume V (V = 1 / 2 × a × b2) was calculated. After 14 days, blood was taken from the abdominal aorta and the mice were sacrificed, and the tumors were removed, weighed, and photographed. Some tumor tissues were fixed with 4% paraformaldehyde, and the remaining tissues were stored at -80 °C.

[0094] 3. HE staining: The fixed tumor tissues were dehydrated in an ethanol solution with increasing concentration, then infiltrated with xylene solution, followed by paraffin embedding, and finally 5-μm sections were made. After the sections were dewaxed with xylene solution, ethanol solution with decreasing concentration, and triple-distilled water, they were stained with hematoxylin-eosin dye and photographed under an upright microscope.

[0095] The specific results are as Figure 4 shown. Among them Figure 4 A shows the effect of rRGD3 mu on the body weight of nude mice. The experimental results showed that compared with the model group and the positive control group, there was no significant change in the body weight of the nude mice in the rRGD3 mu drug administration group; Figure 4 B-C shows the effect of rRGD3 mu on the volume of subcutaneous transplanted tumors. The experimental results showed that compared with the model group, with the increase of the drug administration concentration, the growth of the subcutaneous transplanted tumor volume was inhibited, and the inhibitory effect of the high-dose rRGD3 mu group (100 μg / kg) was higher than that of the 5-Fu (10 mg / kg) group. Figure 4 D shows the effect of rRGD3 mu on the weight of subcutaneous transplanted tumors, n = 6. Compared with the positive control group, the tumor weight of the high-dose rRGD3 mu group (100 μg / kg) was lower, indicating that its inhibitory effect on tumor growth was stronger. Figure 4 E shows the effect of rRGD3 muH&E staining results of tumor tissues after the effect on subcutaneous transplanted tumors, Scale bar=100μm(100×)and 50μm(200×), *p<0.05, **p<0.01 vs the model group. The experimental results showed that, compared with the model group, as the dosage of the drug increased, the area of cell necrosis gradually increased, the number of nuclear fragmentation increased, the formation of vacuoles increased, and a large amount of newly formed fibrous connective tissue could be seen; compared with the positive control group, rRGD3 mu In the high-dose group (100 μg / kg), the above changes were more obvious. In summary, rRGD3 mu could significantly inhibit the growth of subcutaneous transplanted tumors of CNE2 cells.

[0096] Example 5 Western Blot detection of the effect of rRGD3 mu on proteins related to the ITGB1 pathway

[0097] 1. Preparation of samples

[0098] 1) Digest and resuspend the tumor cells in the logarithmic growth phase, and evenly inoculate them into 4 culture flasks. Incubate at 37°C and 5% CO2 for about 24 h until the cell density reaches 80%;

[0099] 2) After changing the culture medium, add gradient concentrations of rRGD3 mu (final concentrations of 1.75 μM, 3.5 μM, and 7 μM) to each culture flask. The system is made up with empty culture medium and incubated at 37°C and 5% CO2 for 24 h;

[0100] 3) Scrape the cells in the culture flask with a cell scraper, collect them together with the culture medium into a centrifuge tube, wash the culture flask and the cell scraper with 1 mL of PBS, and collect the residual cells;

[0101] 4) After balancing, centrifuge for 5 min (4°C, 12,000 rpm), discard the supernatant, and place the precipitate on ice for later use;

[0102] 5) Prepare the cell lysate, calculate the usage according to the need, and evenly mix the RIPA lysate and the protease inhibitor PMSF (RIPA:PMSF = 100:1);

[0103] 6) Add 400 μL of cell lysate to the precipitate respectively. After mixing evenly, let it stand on ice for 20 min, and shake it every 5 min to fully lyse the cells;

[0104] 7) Add 100 μL of 5×Loading Buffer to the lysed samples respectively. After mixing evenly, boil in a water bath for 10 min to obtain protein samples, and store them at -20°C.

[0105] 2. SDS-PAGE Electrophoresis

[0106] 3. Gel Cutting: Cut the gel according to the molecular weight of the detected protein and the position of the Marker;

[0107] 4. Membrane Transfer

[0108] 1) Cut a PVDF membrane of appropriate size and soak it in methanol for 3 min;

[0109] 2) Cut 8 pieces of filter paper of appropriate size and soak them together with the PVDF membrane in the membrane transfer buffer for 10 min;

[0110] 3) Place the above materials on the membrane transfer instrument in the order of graphite electrode → 4 layers of filter paper → PVDF membrane → protein gel → 4 layers of filter paper → metal electrode for membrane transfer, and the membrane transfer speed is about 1 kDa / min;

[0111] 5. Blocking: Put the PVDF membrane into the blocking buffer and block it on a shaker at room temperature for 2 h;

[0112] 6. Incubation with Primary Antibody: Put the PVDF membrane into the incubation bag with the primary antibody diluted according to the instructions and incubate it overnight at 4°C;

[0113] 7. Membrane Washing: Recover the primary antibody, store it at -20°C, put the PVDF membrane into 1×TBST Buffer, and wash it on a shaker at room temperature 4 times, 10 min each time;

[0114] 8. Incubation with Secondary Antibody: Put the PVDF membrane into the secondary antibody diluted according to the instructions and incubate it on a shaker at 37°C for 1 h;

[0115] 9. Membrane Washing: Recover the secondary antibody, store it at -20°C, put the PVDF membrane into 1×TBST Buffer, wash it on a shaker at room temperature 4 times, 10 min each time, and then put the PVDF membrane into 1×PBS and wash it on a shaker at room temperature for 10 min;

[0116] 10. Preparation of ECL Luminescent Solution: Calculate the usage amount according to the experimental needs and uniformly mix Solution A and Solution B in the kit (Solution A: Solution B = 1:1);

[0117] 11. Chemiluminescence: Take out the PVDF membrane, evenly cover the ECL luminescent solution on the PVDF membrane, and perform exposure imaging using a chemiluminescent gel imaging system;

[0118] 12. Gray Scale Analysis: Use ImageJ to perform gray scale analysis on the molecular bands, use Excel and GraphPad Prism 8.0 for statistics and plotting, and the experimental results are statistically analyzed for the relative gray scale values of the detected protein molecules in tabular form and visually displayed in the form of a column chart. The abscissa represents rRGD3 muThe concentration is represented on the vertical axis, and the relative expression level of the detected protein molecule is represented on the horizontal axis;

[0119] 13. Data processing: The t-test was used to statistically analyze the experimental data, and the statistical results were expressed in the form of mean ± standard deviation. p < 0.05 indicates a difference between experimental groups, p < 0.01 indicates a significant difference between experimental groups, and p < 0.001 indicates an extremely significant difference between experimental groups.

[0120] The results are as Figure 5 shown. Figure 5 What is shown is rRGD3 mu The inhibitory effect on human nasopharyngeal carcinoma CNE2 cells may be related to ITGB1. Among them, Figure 5 A in it shows the expression of ITGB1 in HNSC patients detected by Limma differential analysis, n = 566. Limma differential analysis was performed on the gene expression profile data of HNSC patients in the TCGA database (https: / / portal.gdc.cancer.gov / ), and the results showed that ITGB was significantly upregulated in HNSC patients, suggesting a certain pro-cancer effect. Figure 5 B in it shows the expression levels of ITGB1 in NP69 cells and CNE2 cells analyzed by Western Blot, n = 3. The results showed that the expression level of ITGB1 in human nasopharyngeal carcinoma CNE2 cells was significantly higher than that in human normal nasopharyngeal epithelial cells NP69. C-D in the figure is the expression level of ITGB1 in CNE2 cells detected by Western Blot after rRGD3 mu administration, n = 3, *p < 0.05, **p < 0.01. The research results showed that rRGD3 mu could significantly downregulate the expression level of ITGB1 in human nasopharyngeal carcinoma CNE2 cells, and with the increase of the administration concentration, the expression level of ITGB1 gradually decreased. In summary, it is speculated that ITGB1 may be the key target for rRGD3 mu to treat nasopharyngeal carcinoma, and rRGD3 mu could significantly inhibit the expression of ITGB1 in CNE2 cells.

[0121] The above experimental results can prove that rRGD3 mu promotes apoptosis of nasopharyngeal carcinoma cells and inhibits the EMT process of nasopharyngeal carcinoma cells through ITGB1. rRGD3 mu is expected to become a new type of anti-tumor targeted drug targeting ITGB1.

[0122] Thus, it can be seen that the present invention first synthesizes and discloses the gene recombinant peptide rRGD3 mu , and through experiments, it is confirmed that the gene recombinant peptide rRGD3 muBy targeting ITGB1 and potently inhibiting the occurrence and development of tumor cells, it can be applied to the field of preparation of targeted anti-tumor drugs.

[0123] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A genetically recombinant peptide rRGD3 targeting ITGB1 mu , characterized in that The gene recombinant peptide rRGD3 mu has the amino acid sequence shown in SEQ ID NO.

1.

2. An alternative of the genetically recombinant peptide rRGD3 according to claim 1 mu , characterized in that The substitute includes an active peptide having at least 90% homology with the SEQ ID NO.1 based on conservative amino acid substitution and / or an active peptide containing at least the SEQ ID NO.1 sequence.

3. Encoding the gene recombinant peptide rRGD3 as claimed in claim 1 mu or a nucleic acid molecule of the alternative as claimed in claim 2.

4. Use of the recombinant peptide rRGD3 according to claim 1 mu or the alternative according to claim 2 or the nucleic acid molecule according to claim 3 in the preparation of an anti-tumor drug.

5. A primer pair for amplifying the nucleic acid molecule according to claim 3, characterized in that, The primer pair includes a forward primer and a reverse primer; The nucleotide sequence of the forward primer is as shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO.

3.

6. A biomaterial containing the nucleic acid molecule described in claim 3 and expressing the recombinant peptide rRGD3 of the gene described in claim 1 mu or the substitute described in claim 2.

7. Use of the primer pair according to claim 5 or the biomaterial according to claim 6 in the preparation of an anti-tumor drug.

8. An antitumor drug, characterized in that, Comprising one or more of the gene recombinant peptide rRGD3 as described in claim 1 mu , the substitute as described in claim 2, the nucleic acid molecule as described in claim 3, the biological material as described in claim 6, and the small molecule agonist related to the nucleic acid molecule as described in claim 3.

9. The anti-tumor drug according to claim 8, wherein The anti-tumor drug further includes a pharmaceutically acceptable excipient or carrier; the dosage form of the anti-tumor drug includes tablets, pills, powders or injections.

10. The anti-tumor drug according to claim 8 or claim 9, characterized in that, Based on the body weight of the mouse, the dosage of the anti-tumor drug is 25 - 100 μg / kg.

Images