Construction method and application of a Volvariella volvacea promoter and overexpression vector

Abstract

This invention discloses a method for constructing and applying a Volvariella volvacea promoter and overexpression vector. This invention screens and verifies, for the first time, the driving effect of an endogenous Volvariella volvacea promoter in a transgenic expression system, confirming that the UBQ promoter has excellent expression activity. It also constructs a highly efficient Volvariella volvacea transgenic tool vector, providing technical support for Volvariella volvacea genetic improvement and molecular breeding. It also establishes a Volvariella volvacea protoplast fluorescence screening system, facilitating subsequent high-throughput screening and gene function research.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to a method for constructing a Volvariella volvacea promoter and an overexpression vector and applications thereof. Background Art

[0002] straw mushroom( Volvariellavolvacea (Bull.) Singer Mushrooms (also known as orchid mushrooms and hemp mushrooms) are a thermophilic edible fungus with a short growth cycle, rapid fruiting, and significant economic benefits. As an important tropical and subtropical cultivated species, the development of genetic improvement and molecular breeding technologies is crucial for improving cultivation efficiency and product quality.

[0003] In recent years, with the development of gene editing technology, research on exogenous expression has entered a new stage. The application of CRISPR / Cas9 technology has enabled gene knock-in and precise editing. Simultaneously, the introduction of synthetic biology strategies has further expanded the potential of exogenous expression. For example, by heterologously expressing terpenoid synthase genes, edible fungi have been transformed into "cell factories" that produce specific medicinal compounds. These breakthroughs have not only advanced the study of functional genomics but also provided new ideas for the industrial application of edible fungi. However, because Volvariella volvacea is a multinucleate, non-locking basidiomycete, research in molecular biology of animals and plants lags behind. Gene function research and the construction of exogenous gene expression systems have long been limited. The lack of an efficient and stable expression system has become a bottleneck restricting the molecular breeding and functional gene research of Volvariella volvacea.

[0004] Green fluorescent protein (GFP), as a commonly used reporter gene, has been widely used in gene expression studies in various biological systems. However, there is still a lack of feasible expression systems and systematic research on promoter screening in Volvariella volvacea. Summary of the Invention

[0005] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide a Volvariella volvacea promoter.

[0006] Another object of the present invention is to provide a Volvariella volvacea overexpression vector.

[0007] Another object of the present invention is to provide applications of the above-mentioned Volvariella volvacea promoter or Volvariella volvacea overexpression vector.

[0008] The purpose of the present invention is achieved through the following technical solutions:

[0009] A Volvariella volvacea promoter UBQ, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0010] A Volvariella volvacea terminator UBQ-nos, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0011] A Volvariella volvacea overexpression vector comprises an expression cassette consisting of the Volvariella volvacea promoter UBQ and the Volvariella volvacea terminator UBQ-nos.

[0012] The screening marker of the volvacea overexpression vector is sdhB Gene.

[0013] The application of the above-mentioned Volvariella volvacea promoter UBQ, Volvariella volvacea terminator UBQ-nos and Volvariella volvacea overexpression vector in Volvariella volvacea gene editing.

[0014] The application of the above-mentioned Volvariella volvacea promoter UBQ, Volvariella volvacea terminator UBQ-nos and Volvariella volvacea overexpression vector in expressing foreign proteins in Volvariella volvacea.

[0015] The present invention has the following advantages and effects compared to the prior art:

[0016] 1. We screened and verified for the first time the driving effect of the endogenous promoter of Volvariella volvacea in a transgenic expression system, confirming that the UBQ promoter has excellent expression activity;

[0017] 2. A highly efficient transgenic vector for Volvariella volvacea was constructed, providing technical support for the genetic improvement and molecular breeding of Volvariella volvacea;

[0018] 3. A fluorescent screening system for protoplasts of Volvariella volvacea was established, which will facilitate subsequent high-throughput screening and gene function research. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the plasmid map of the overexpression vector UBQ-GFP constructed in Example 1.

[0020] Figure 2 These are the experimental results of the rapid detection of GFP expression in Example 2; Group A is 35S-GFP, Group B is UBQ-GFP, and Group C is Hyd3-GFP.

[0021] Figure 3 This is the experimental result of qPCR detection of expression level in Example 2. DETAILED DESCRIPTION

[0022] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0023] If specific experimental conditions are not specified in the following embodiments, conventional experimental conditions or those recommended by the reagent company will generally be used. Materials and reagents used were commercially available unless otherwise specified.

[0024] Example 1 Construction and transformation of vector

[0025] 1.1 Editing vector construction

[0026] In the previous study, several potential high-efficiency Volvariella volvacea promoters were discovered. In order to verify their effects, expression cassettes and vectors were constructed to verify their functions.

[0027] The sequence of the promoter UBQ is shown in SEQ ID NO. 1, and the sequence of the terminator UBQ-nos is shown in SEQ ID NO. 2. A gene company was commissioned to synthesize them, and corresponding primers were designed and amplified to obtain the promoter and terminator fragments. GFP was selected as the reporter gene, and a plasmid carrying GFP was used as a template to design corresponding primers to amplify the GFP fragment.

[0028] Select mutants sdhB The succinate dehydrogenase gene is used as a selection marker, and after point mutation, it can encode a carboxin resistance gene, which can be obtained by point mutation or gene synthesis.

[0029] The vector was digested with endonucleases to obtain linearized fragments, and efficient seamless cloning and sdhB The fragments of the gene, promoter UBQ, GFP gene and terminator UBQ-nos were connected to obtain the efficient overexpression vector UBQ-GFP (SEQ ID NO.6) of Volvariella volvacea.

[0030] Referring to the above steps, the promoter fragment was replaced with the 35S promoter commonly used in plant overexpression vectors to prepare the overexpression vector 35S-GFP. In addition, the promoter was replaced with another endogenous promoter of Volvariella volvacea, Hydrophobin-3 (SEQ ID NO. 3), and the terminator was replaced with Hydrophobin-3-nos (SEQ ID NO. 4) to prepare the overexpression vector Hyd3-GFP.

[0031] 1.2 Vector transformation

[0032] (1) Protoplast preparation using straw mushroom fruiting bodies

[0033] Prepare a 2% enzyme solution: Weigh 0.2g of lyase (L1412, Sigma Aldrich) into a 15ml centrifuge tube. Add 250µL of 0.2M MES buffer (pH 5.7), 7.5ml of 0.8M mannitol solution, and 1.7ml of ddH2O. Place the fruiting bodies of the Volvariella volvacea into the enzyme solution and enzymatically digest them at 30°C for 1.5 hours. Collect the protoplasts.

[0034] (2) Protoplast transformation and screening

[0035] Adjust the protoplast concentration to 1×10 8 / mL, gently flick to resuspend, and aliquot into 2ml centrifuge tubes. Take 160μL of protoplasts and add 160μL of STC solution and 5μg of the overexpression vector UBQ-GFP obtained in Step 1 to each tube. Gently flick to mix the protoplasts. Add 50μL of PTC buffer and gently mix. Let stand at room temperature for 5 minutes, centrifuge at 2000rpm, remove the supernatant, add 1ml of 4°C pre-chilled PDA liquid medium, and gently mix. Add to 100ml of cooled PDA solid medium, pour into plates, and incubate at 30°C for 22 hours. After the protoplasts germinate, overlay a layer of PDA solid medium containing 4μg / mL carboxin. Protoplasts that germinate are transformants that successfully express the vector and are numbered and used in subsequent experiments.

[0036] Example 2 Expression Effect Verification

[0037] 2.1 Rapid detection of GFP expression

[0038] The transformants screened in Example 1 were picked and observed under a laser confocal microscope to quickly identify the expression effect of GFP. The excitation wavelength was 488 nm and the emission wavelength was 507 nm.

[0039] The experimental results are as follows Figure 2 As shown, only the transformant into which UBQ-GFP was introduced showed a green fluorescent signal, proving that GFP was successfully expressed, while no fluorescent signal was observed in the transformants into which the other two expression vectors were introduced, proving that the GFP gene was not expressed.

[0040] 2.2 qPCR detection

[0041] After cDNA samples were extracted from the transformants, real-time quantitative PCR (qPCR) was performed to assess the relative transcription level of the GFP gene using the TUBa gene as an internal standard. The specific primers used were as follows:

[0042] TUBa-F: GAGCCCAATGTTATCGATGAAGTGC;

[0043] TUBa-R:GTTCTTGCCAATTGTGTAGTGCCC;

[0044] GFP-F:GAACCGCATCGAGCTGAA;

[0045] GFP-R:TGCTTGTCGGCCATGATATAG.

[0046] The experimental results are as follows Figure 3As shown in the figure, it can be clearly seen that a large amount of GFP gene expression was detected in the transformant into which UBQ-GFP was introduced, while in the other two transformants, although the resistance gene was successfully expressed, the GFP gene carried could not be successfully expressed, proving that these two promoters cannot achieve efficient expression of exogenous genes in Volvariella volvacea.

[0047] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A Volvariella volvacea promoter UBQ, characterized by: The nucleotide sequence of the Volvariella volvacea promoter UBQ is shown in SEQ ID NO.

1.

2. A Volvariella volvacea terminator UBQ-nos, characterized by: The nucleotide sequence of the Volvariella volvacea terminator UBQ-nos is shown in SEQ ID NO.

2.

3. A Volvariella volvacea overexpression vector, characterized by: The Volvariella volvacea overexpression vector carries an expression cassette consisting of Volvariella volvacea promoter UBQ and Volvariella volvacea terminator UBQ-nos; The nucleotide sequence of the Volvariella volvacea promoter UBQ is shown in SEQ ID NO.1; The nucleotide sequence of the Volvariella volvacea terminator UBQ-nos is shown in SEQ ID NO.

2.

4. The Volvariella volvacea overexpression vector according to claim 3, wherein: The screening marker of the volvacea overexpression vector is sdhB Gene.

5. Use of the Volvariella volvacea promoter UBQ according to claim 1, the Volvariella volvacea terminator UBQ-nos according to claim 2, or the Volvariella volvacea overexpression vector according to any one of claims 3 to 4 in expressing foreign proteins in Volvariella volvacea.

Images