Nucleic acid aptamers, nucleic acid aptamer derivatives and their applications
The screening and optimization of nucleic acid aptamers through SELEX technology solves the problem of lack of specific targeting DLL3, provides high-affinity and easy-to-synthetic nucleic acid aptamers for tumor diagnosis and treatment of small cell lung cancer, and achieves efficient and low-cost tumor detection.
Patent Information
- Application Number
- CN202510864740.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-26
- Publication Date
- 2025-08-22
- Estimated Expiration
- 2045-06-26
AI Technical Summary
There are currently no nucleic acid aptamers specifically targeting Delta-like ligand 3, and it is urgent to develop highly specific and highly stable nucleic acid aptamers for tumor diagnosis and treatment of small cell lung cancer.
Nucleic acid aptamers were screened and optimized through index enrichment system evolution (SELEX) technology to obtain nucleic acid aptamers that specifically target DLL3, and chemically modify and label them to form nucleic acid aptamer derivatives, which are used to detect and diagnose tumor cells with high expression of DLL3.
Nucleic acid aptamer with high affinity, no immunogenicity, easy chemical synthesis and preservation can be quickly and effectively detected the expression of Delta-like ligand 3 on the surface of tumor cells, with low cost and good repetition.
Smart Images

Figure CN120350014B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biomedical detection, and in particular to a nucleic acid aptamer specifically targeting Delta-like ligand 3, a nucleic acid aptamer derivative and applications thereof. Background Art
[0002] Delta-like ligand 3 (DLL3) is a cell surface protein that is considered a selective marker for high-grade neuroendocrine tumors, characterized by low or absent cell surface expression in normal adult human tissue. DLL3 expression is observed in over 75% of patients with small cell lung cancer (SCLC), and DLL3 expression in SCLC persists across disease stages and treatment. Preclinical studies in mouse models have demonstrated that DLL3 regulates SCLC tumor growth through the Snail pathway, with DLL3 knockout resulting in reduced tumor proliferation, while overexpression generally promotes tumor growth. Furthermore, tumors with high DLL3 expression exhibit suppression of immune-related signaling pathways, leading to DLL3 being targeted for radioimmunotherapy in mouse models. The tumor selectivity of DLL3 expression has led to the development of several DLL3-targeted therapies, which are currently under clinical investigation in patients with various high-grade neuroendocrine cancers.
[0003] SC16 is a humanized monoclonal antibody targeting DLL3 that selectively binds to both human and mouse DLL3. It has been used for targeted therapy and molecular imaging in small cell lung cancer and neuroendocrine prostate cancer. Aptamers offer advantages over traditional monoclonal antibodies in tumor diagnosis and precision medicine. Aptamers are highly structured DNA or RNA fragments that can specifically bind to cellular target molecules. They possess high affinity and specificity for a specific ligand molecule or class of ligands and are known as "chemical antibodies." Aptamers form specific three-dimensional structures, such as hairpins and G-quadruplexes, through intermolecular interactions such as van der Waals forces, hydrogen bonds, electrostatic interactions, and hydrophobic interactions. Aptamers are therefore capable of binding to their targets with high affinity and specificity. Systematic Evolution of Ligands by Exponential Enrichment (SELEX) is a technique for screening aptamers that efficiently and specifically bind to target molecules. Aptamers selected using SELEX can bind to a wide range of targets, including biomacromolecules, cells, viruses, bacteria, and tissues. Numerous aptamer sequences have been reported. Aptamers selected using SELEX possess target-specific recognition capabilities similar to monoclonal antibodies, but offer the following advantages over antibodies: ① They are an in vitro selection system, eliminating the need for immune cells or animals; ② they can be prepared by chemical synthesis in large quantities, with minimal batch-to-batch variability; ③ they are stable and easy to store and transport; ④ they have a small molecular weight (4-50 kDa); ⑤ they can be easily labeled, modified, and restructured to enhance serum stability; and ⑥ they exhibit low toxicity and are non-immunogenic, allowing for high-dose topical or intravenous administration. Due to these advantages, aptamers have found widespread application in numerous fields, including disease diagnosis and treatment, drug screening, and molecular imaging.
[0004] At present, there are no reports on research on nucleic acid aptamers specifically targeting DLL3. There is an urgent need to develop new nucleic acid aptamers with high specificity and high stability targeting DLL3 for application in tumor diagnosis and treatment. Summary of the Invention
[0005] The present invention aims to overcome the shortcomings of the prior art by providing a nucleic acid aptamer, a nucleic acid aptamer derivative, and its application. The nucleic acid aptamer described herein can specifically target DLL3 on the surface of tumor cells and specifically recognize small cell lung cancer cells, such as SHP77 and H69, which highly express DLL3. The present invention also discloses methods for screening and optimizing the nucleic acid aptamer. The nucleic acid aptamer exhibits advantages such as high affinity and specificity, lacks immunogenicity, is simple to chemically synthesize, is stable, and is easily stored and labeled.
[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:
[0007] In a first aspect, the present invention provides a nucleic acid aptamer specifically targeting Delta-like ligand 3, wherein the nucleotide sequence is selected from any one of the following:
[0008] i. nucleic acid aptamer D3A1, the nucleotide sequence of which is shown in SEQ ID NO: 1;
[0009] ii. nucleic acid aptamer D3A2, the nucleotide sequence of which is shown in SEQ ID NO: 2;
[0010] iii. nucleic acid aptamer D3A1T, the nucleotide sequence of which is shown in SEQ ID NO: 3;
[0011] iv. nucleic acid aptamer D3A2T, the nucleotide sequence of which is shown in SEQ ID NO: 4;
[0012] v. an oligonucleotide sequence having a homology of more than 60% with any one of the aptamers i-iv;
[0013] vi. a truncated sequence of the aptamer described in i or ii;
[0014] vii and i-iv any one of the aptamer hybrid DNA sequence;
[0015] viii. an RNA sequence reverse transcribed from any one of the nucleic acid aptamers i-iv.
[0016] This study used the Systematic Evolution by Exponential Enrichment (SELEX) technique to screen for long single-stranded aptamer DNA targeting DLL3, and then sequence-optimized these aptamers to generate two additional short strands. In vitro affinity testing and targeting assays in small cell lung cancer (SCLC) tumor cells, along with a series of experiments, confirmed the specific targeting of the aptamers by DLL3-overexpressing tumor cells, such as SHP77 and H69. This allows for molecular diagnosis of DLL3-overexpressing tumors at the cellular level and in tumor-bearing mouse models.
[0017] As a preferred embodiment of the nucleic acid aptamer specifically targeting Delta-like ligand 3 of the present invention, its nucleotide sequence is an oligonucleotide sequence with a homology of 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% or more with any of the nucleic acid aptamers i-iv.
[0018] Preferably, the nucleic acid aptamer is a lyophilized powder; the nucleic acid aptamer of the present invention is synthesized by a solid phase synthesis method, and is preferably in the form of a lyophilized powder.
[0019] In a second aspect, the present invention provides a nucleic acid aptamer derivative that specifically targets Delta-like ligand 3, which is obtained by modifying any one of the nucleic acid aptamers described in i-iv above.
[0020] As a preferred embodiment of the nucleic acid aptamer derivative specifically targeting Delta-like ligand 3 of the present invention, the modification includes labeling with a marker or chemical modification.
[0021] As a further preferred embodiment of the nucleic acid aptamer derivative specifically targeting Delta-like ligand 3 of the present invention, the label includes at least one of an isotope label, a fluorescent label, a biotin label, an enzyme label and a chemiluminescent label.
[0022] As a further preferred embodiment of the nucleic acid aptamer derivative specifically targeting Delta-like ligand 3 of the present invention, the chemical modification includes at least one of methylation modification, amination modification, sulfhydrylation modification, phosphorylation modification, thiolation modification, carboxylation modification and isotope modification.
[0023] In one embodiment, the nucleic acid aptamer derivative is a derivative of the nucleic acid aptamer obtained by labeling the 5' end of any one of the nucleic acid aptamers i-iv with a cyanine dye group.
[0024] Preferably, the nucleic acid aptamer derivative is a lyophilized powder; the nucleic acid aptamer derivative of the present invention is synthesized by a solid phase synthesis method, and is preferably in the form of a lyophilized powder.
[0025] In a third aspect, the present invention provides a reagent for detecting Delta-like ligand 3, comprising the aforementioned nucleic acid aptamer and / or the aforementioned nucleic acid aptamer derivative.
[0026] In a fourth aspect, the present invention provides a method for detecting Delta-like ligand 3, comprising mixing a sample to be tested with the nucleic acid aptamer and / or the nucleic acid aptamer derivative, and detecting Delta-like ligand 3 in the sample.
[0027] In a fifth aspect, the present invention uses the nucleic acid aptamer, the nucleic acid aptamer derivative, and the reagent in preparing a product for detecting or purifying Delta-like ligand 3.
[0028] As a preferred embodiment of the application of the present invention, the product includes at least one of a kit, a biosensor, and a detection chip.
[0029] In a sixth aspect, the present invention applies the nucleic acid aptamer, the nucleic acid aptamer derivative, and the reagent to identify and bind to tumor cells for non-therapeutic or diagnostic purposes, and to prepare drugs for diagnosing and / or treating tumors.
[0030] As a preferred embodiment of the application of the present invention, the tumor is small cell lung cancer; and the tumor cells are small cell lung cancer cells.
[0031] Compared with the prior art, the present invention has the following beneficial effects:
[0032] The nucleic acid aptamers obtained through screening in the present invention have high affinity, are non-immunogenic, can be chemically synthesized in vitro, have a low molecular weight, can be labeled or modified at different sites, and have stable sequences and are easy to store. The nucleic acid aptamers of the present invention are used to detect the expression of Delta-like ligand 3 on the surface of tumor cells with high efficiency, simplicity, and rapidity. The nucleic acid aptamers of the present invention have lower synthesis costs than antibody preparation, shorter production cycles, and better reproducibility. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 Schematic diagram of the SELEX screening principle in Example 1;
[0034] Figure 2 This is the enrichment process of nucleic acid aptamers as the number of screening rounds increases in Example 1;
[0035] Figure 3 Schematic diagram of the preparation process of nucleic acid aptamers in Example 3;
[0036] Figure 4 is a high-resolution mass spectrum of the nucleic acid aptamer in Example 3;
[0037] Figure 5 This is the in vitro serum stability test of the nucleic acid aptamer in Example 4;
[0038] Figure 6 is the structure of the nucleic acid aptamer in Example 5;
[0039] Figure 7 Affinity detection of the two long-chain nucleic acid aptamers in Example 6 (surface plasmon resonance SPR);
[0040] Figure 8 Affinity detection (surface plasmon resonance SPR) of the two truncated nucleic acid aptamers in Example 6;
[0041] Figure 9 The western blot results of DLL3 protein expression in small cell lung cancer tumor cells in Example 7 are as follows;
[0042] Figure 10 This is a high-resolution mass spectrum of the nucleic acid aptamer labeled with a cyanine dye group in Example 8;
[0043] Figure 11 Flow cytometry results of the nucleic acid aptamer recognition of small cell lung cancer cells SHP77 and H69 in Example 9;
[0044] Figure 12 The confocal microscopy results of the nucleic acid aptamer recognition of small cell lung cancer cells SHP77 and H69 in Example 9;
[0045] Figure 13 Flow cytometry test results of the affinity of the nucleic acid aptamer to small cell lung cancer cells SHP77 in Example 10;
[0046] Figure 14 This is the in vivo fluorescence imaging result of the nucleic acid aptamer D3A1T in Example 11 on mice bearing small cell lung cancer SHP77 tumor.
[0047] Figure 15 This is the result of nucleoside imaging of the tumor of mice bearing small cell lung cancer cells SHP77 by the nucleic acid aptamer D3A1T in Example 11. DETAILED DESCRIPTION
[0048] In the present invention, the nucleic acid aptamer refers to an aptamer composed of nucleic acid, i.e., a three-dimensional structure formed by the secondary structure and then the tertiary structure of a single-stranded nucleic acid via hydrogen bonds, etc., firmly and specifically binds to a target substance, and has a ligand molecule that specifically hinders or inhibits the physiological activity and other functions of the target substance. Nucleic acid aptamers are generally known to have RNA aptamers composed only of RNA and DNA aptamers composed only of DNA, but the nucleic acids constituting the nucleic acid aptamers in this specification are not particularly limited. For example, they include DNA aptamers, RNA aptamers, aptamers composed of a combination of DNA and RNA, aptamers containing modified nucleic acids in a part thereof, aptamers composed only of modified nucleic acids, etc. Preferably, they are DNA aptamers. The nucleic acid refers to a biological macromolecule formed by connecting nucleotides as constituent units through phosphodiester bonds in principle. The invention includes DNA formed by linking deoxyribonucleotides having only one of the bases adenine, guanine, cytosine, and thymine, RNA formed by linking ribonucleotides having only one of the bases adenine, guanine, cytosine, and uracil, or a combination thereof.
[0049] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.
[0050] Unless otherwise specified, the experimental methods used in the examples are conventional methods. Materials and reagents used are commercially available unless otherwise specified. The aptamer sequences and cyanine dye-labeled aptamers in the examples were synthesized by Shanghai Sangon Biotechnology Co., Ltd.; DLL3 protein was purchased from Abotek, catalog number RP02041; anti-Delta-like ligand 3 antibody was purchased from Abcam, catalog number ab229902; the wash buffer was DPBS containing 5 mM MgCl2 and 4.5 mg / mL glucose; and the binding buffer was wash buffer supplemented with 0.1 mg / mL tRNA and 1 mg / mL bovine serum albumin.
[0051] Example 1: Screening of nucleic acid aptamers
[0052] Couple DLL3 protein and HSA protein. Take 300 μL carboxyl magnetic beads, wash them 4 times with ultrapure water, and remove the supernatant; add the prepared EDC and NHS (mixed in advance), and incubate at room temperature for 15-20 min. Separate the magnetic beads with a magnetic separator, remove the supernatant, wash twice with DPBS, add 100 ug protein (prepared with NaAC in advance), incubate at room temperature for 20-60 min, separate the magnetic beads with a magnetic separator, and remove the supernatant. Add ethanolamine to block and incubate at room temperature for 5-10 min. Separate the magnetic beads with a magnetic separator, remove the supernatant, and wash 4 times with DPBS. Then further perform the repeated screening process (see Figure 1 ), taking the first round of screening as an example, the specific steps are as follows:
[0053] (1) Take a tube of Lib library powder (76 bp random DNA sequence library), centrifuge at 14,000 rpm for 5-10 min, add DPBS and vortex to dissolve, centrifuge at 14,000 rpm for 5-10 min, and then renature (95°C for 5-10 min, 4°C for 10-20 min, and equilibrate to room temperature);
[0054] (2) Add the library to the positive screening magnetic beads, slowly blow evenly with a gun, and incubate at room temperature for 30-45 minutes;
[0055] (3) Separate the magnetic beads using a magnetic separator, take the supernatant, add it to the positive screening magnetic beads, incubate at room temperature for 30-45 minutes, and wash with DPBS three times;
[0056] (4) Add ultrapure water to the magnetic beads and boil in a boiling water bath for 5-10 minutes. Separate the magnetic beads using a magnetic separator and retain the supernatant.
[0057] (5) The supernatant was subjected to PCR amplification, and the number of cycles of each amplification round was determined by denaturing PAGE;
[0058] (6) After amplification, single strands are separated by streptavidin magnetic beads;
[0059] (7) Subsequent screening can be adjusted according to the results of each round of screening, and the operation steps are the same as above.
[0060] Finally, if Figure 2 As shown, the libraries obtained in each round of screening were subjected to flow cytometry to determine affinity.
[0061] Finally, the nucleic acid aptamers D3A1 and D3A2 with strong affinity were screened out, and their nucleotide sequences are as follows:
[0062] The nucleotide sequence of D3A1 is:
[0063] 5'-TCCAGCACTCCACGCATAACCCTGGGGGAGGGAGTTACGTTTGGGTGGGTCGAGGGGTTATGCGTGCTACCGTGAA-3';
[0064] The nucleotide sequence of D3A2 is:
[0065] 5'-TCCAGCACTCCACGCATAACGGGGGTGGGGCTTTAAATATGGTTGGGGGGGTCGAGTTATGCGTGCTACCGTGAA-3'.
[0066] Example 2: Optimization of nucleic acid aptamers
[0067] The primer end sequence is truncated to remove the primer binding regions at both ends of the original sequence of the nucleic acid aptamer screened in Example 1.
[0068] The nucleotide sequence from which D3A1 is removed includes 1-11 nucleotides from the first nucleotide at the 5' end and 1-11 nucleotides from the first nucleotide at the 3' end, and the nucleotide sequence from which D3A1 is removed includes 1-11 nucleotides from the first nucleotide at the 3' end and the remaining nucleotide residues are represented as D3A1T, and the nucleotide sequence thereof is:
[0069] 5'-ACGCATAACCCTGGGGGAGGGAGTTACGTTTGGGTGGGTCGAGGGGTTATGCGT-3'.
[0070] The nucleotide sequence from which D3A2 is removed includes 1-12 nucleotides from the first nucleotide at the 5' end and the nucleotide sequence from which D3A2 is removed includes 1-12 nucleotides from the first nucleotide at the 3' end and the nucleotide residues remaining are represented as D3A2T, and the nucleotide sequence thereof is as follows:
[0071] 5'-CGCATAACGGGGGTGGGGCTTTTAAATATGGTTGGGGGGGTCGAGTTATGCG-3'.
[0072] Example 3: Preparation of nucleic acid aptamers
[0073] The nucleic acid aptamers of Examples 1 and 2 were synthesized by solid phase synthesis, and the DNA containing the solid phase carrier and the protecting group was synthesized in multiple steps, and finally the final product was obtained by amino deprotection and purification. Figure 3 Oligonucleotide sequences were synthesized using the phosphoramidite technique in solid phase synthesis.
[0074] The solid phase synthesis method described in this embodiment is as follows:
[0075] First, depending on the scale, synthesis was performed on a solid support made of controlled-pore glass (CPG support) using a nucleic acid synthesizer. All phosphoramidite monomers were removable under alkaline conditions. All phosphoramidite monomers were dissolved in anhydrous acetonitrile (100 mM) and dried over molecular sieves. A solution of 5-ethylmercaptotetrazole (0.6 M) in acetonitrile was used as the activator solution. The coupling time was 200 seconds. Unreacted active groups were capped using a mixture of acetic anhydride, N-methylimidazole, pyridine, and acetonitrile (N-methylimidazole / acetonitrile ratio of 1:4; acetic anhydride / pyridine / acetonitrile ratio of 2:3:5) to cleave and deprotect the solid support-bound oligomers.
[0076] Secondly, after the solid phase synthesis is completed, the dried solid support is treated with an ammonia solution at 55°C for 16 hours, the solution is evaporated and the solid residue is redissolved in water and purified by HPLC to obtain the target nucleic acid chain. Figure 4 As shown, high-resolution mass spectrometry was used for quality control, and the results showed that the molecular weight of D3A1 was 23628.27 Da, the molecular weight of D3A2 was 23642.29 Da, the molecular weight of D3A1T was 16925.95 Da, and the molecular weight of D3A2T was 16322.57 Da, indicating that all DNA sequences were correct.
[0077] Example 4: In vitro serum stability test of nucleic acid aptamers
[0078] The stability of nucleic acid aptamers determines their potential for subsequent practical applications. The nucleic acid aptamers prepared in Examples 1 and 2 were dissolved in RPMI1640 medium containing 10% FBS at a concentration of 3 μM each. The cells were then divided into 8 tubes and incubated in a 37°C incubator for 0 h, 1 h, 2 h, 4 h, 6 h, 8 h, 12 h, and 48 h. Following incubation, the tubes were immediately denatured in a 95°C thermostatic metal bath for 5 minutes, cooled on ice, and then stored at -80°C. After all samples were collected, agarose gel electrophoresis was performed and imaging was performed.
[0079] like Figure 5 As shown in the figure, compared with the long-chain D3A1 and D3A2, the short-chain nucleic acid aptamers D3A1T and D3A2T obtained by truncation optimization have relatively higher in vitro stability.
[0080] Example 5: Structural detection of nucleic acid aptamers
[0081] The three-dimensional structures of G-quadruplexes as aptamers may be important because they improve the properties of nucleic acids, such as increased resistance to nuclease degradation. Circular dichroism (CD) spectroscopy is one of the most commonly used methods for characterizing quadruplex types and their formation.
[0082] The prepared nucleic acid aptamer samples of Examples 1 and 2 were heated at 95°C in a thermostatic metal bath for 5 minutes, then allowed to stand at 4°C for 10 minutes before equilibration to room temperature. The samples were diluted to 1 µM in DPBS (supplemented with 5 mM MgCl₂) and scanned from 200 nm to 300 nm in a 1 mm, 400 µL assay dish (under nitrogen protection throughout the experiment).
[0083] like Figure 6 As shown, the nucleic acid aptamers D3A1, D3A2, D3A1T and D3A2T all have characteristic peaks of G-quadruplex structure.
[0084] Example 6: Affinity detection of nucleic acid aptamers
[0085] The affinity between the target protein and the aptamer is determined by SPR detection, and the binding and dissociation kinetics of the aptamer and the target protein are evaluated. The specific experimental steps are as follows:
[0086] (1) Coupling of target protein DLL3: Using a CM5 chip, the sensor surface was activated by injecting a mixture of 50 mM N-hydroxysuccinimide (NHS) and 200 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) for 7 minutes. The target protein DLL3 was then diluted to 30 μg / mL with 10 mM Acetate, pH 4.5, at a flow rate of 10 μL / min, with a target coupling of 1000 RU, and immobilized on the CM5 chip surface. Finally, the surface was blocked with 1 M ethanolamine (pH 8.5).
[0087] (2) Test conditions for nucleic acid aptamers D3A1 and D3A2: The binding characteristics of the target protein DLL3 with D3A1 and D3A2 were preliminarily determined and evaluated in manual mode. 800 nM was determined as the highest analytical concentration for D3A1 and D3A2. A two-fold gradient dilution was performed, with a total of six analytical concentrations. The concentration gradient was 0 nM, 50 nM, 100 nM, 200 nM, 400 nM, and 800 nM, respectively. The flow rate during sample analysis was set at 30 μL / min, the association time was 120 s, and the dissociation time was 720 s.
[0088] (3) Test conditions for the nucleic acid aptamer D3A1T: The binding characteristics of the target protein DLL3 and D3A1T were preliminarily determined and evaluated in manual mode. 200 nM was determined as the highest analytical concentration of D3A1T, and a 2-fold gradient dilution was performed, with a total of 9 analytical concentrations. The concentration gradient was 0 nM, 1.56 nM, 3.125 nM, 6.25 nM, 12.5 nM, 25 nM, 50 nM, 100 nM, and 200 nM, respectively. The flow rate during sample analysis was set at 30 μL / min, the association time was 120 s, and the dissociation time was 720 s.
[0089] (4) Test conditions for nucleic acid D3A2T: The binding characteristics of the target protein DLL3 and D3A2T were preliminarily determined and evaluated in manual mode. 200 nM was determined as the highest analytical concentration of D3A2T, and a 2-fold gradient dilution was performed, with a total of 10 analytical concentrations set. The concentration gradient was 0 nM, 0.78 nM, 1.56 nM, 3.125 nM, 6.25 nM, 12.5 nM, 25 nM, 50 nM, 100 nM, and 200 nM, respectively. The flow rate during sample analysis was set at 30 μL / min, the association time was 120 s, and the dissociation time was 720 s.
[0090] (4) Determination of kinetic parameters: The experiment was run in multiple cycles, with the response signal plotted with analysis time as the horizontal axis and response value as the vertical axis. The data were fitted using BIAcore T200 analysis software using a 1:1 Langmuir binding model to determine kinetic constants such as the association rate constant, dissociation rate constant, and association-dissociation constant.
[0091] like Figure 7 and Figure 8 As shown, the binding dissociation constants of nucleic acid aptamers D3A1, D3A2, D3A1T and D3A2T were 82.5 nM, 54.8 nM, 2.358 nM and 2.668 nM, respectively, and D3A1T had the highest affinity for DLL3 protein.
[0092] Example 7: Detection of DLL3 protein expression in tumor cells
[0093] Evaluate DLL3 expression in various small cell lung cancer cell lines for subsequent aptamer applications. DLL3 protein expression was detected using western blot assays using whole-cell extracts obtained from the cell lines. The details are as follows:
[0094] 20 μg of total protein from small cell lung cancer cells (SHP77 and H69) was mixed with protein loading buffer and boiled at 100°C for 10 minutes. Proteins were separated using a 10% SDS-AGE gel (100 V constant voltage, 80 minutes). Proteins were transferred to a PVDF membrane (Millipore) and further incubated with an anti-DLL3 antibody. Immobilon Western Chemiluminescent HRP Substrate (Millipore) was used for protein chemiluminescence detection.
[0095] like Figure 9 As shown, small cell lung cancer cells SHP77 and H69 highly expressed DLL3.
[0096] Example 8: Cyanine dye group labeled nucleic acid aptamer
[0097] The nucleic acid aptamers D3A1, D3A2, D3A1T, and D3A2T were labeled with the cyanine dye group Cy5, respectively. The details are as follows:
[0098] The dissolved Cy5 activated ester (DMSO-dissolved, equivalent to 10) was added to the amino-modified nucleic acid aptamer, and an appropriate amount of carbonate solution was added. Ultrasonic mixing was performed until completely dissolved. The reaction was carried out at 25°C for 1 h. After the reaction, the Cy5 fluorescently labeled nucleic acid aptamer was purified by HPLC.
[0099] like Figure 10As shown, mass spectrometry confirmed the identity of each labeled aptamer derivative.
[0100] Example 9: Specific targeting recognition and binding experiments of nucleic acid aptamers
[0101] (1) The Cy5-labeled aptamers in Example 8 were used to perform flow cytometry on human SCLC cell lines SHP77 and H69. Cells of each cell line (5×10 5 Cells were washed twice with wash buffer and then incubated with DNA aptamer (250 nM) in binding buffer at 4°C for 30 minutes. After incubation, the samples were washed three times with wash buffer and analyzed using the BD FACSVerse™ system.
[0102] (2) The Cy5-labeled nucleic acid aptamer in Example 8 was used to perform confocal imaging on human SCLC cell lines SHP77 and H69, and the cells of each cell line (5×10 5 Cells were washed twice with wash buffer and then incubated with DNA aptamer (250 nM) in binding buffer at 4°C for 30 minutes. After incubation, the cells were washed three times with wash buffer and imaged using a Leica Zeiss TCS SP8 confocal microscope.
[0103] A control DNA strand with no binding ability (Con) and a control DNA strand with a random sequence (Lib) were also used for comparison. The nucleotide sequence used in Con is shown in SEQ ID NO.5 (SEQ ID NO.5: CGTACGGTCGACGCTAGCTCTAACTGATTATTATTATTATTATTATT ATTCGGTTAGACACGTGGAGCTCGGATCC); the nucleotide sequence used in Lib is a library with consistent length but random sequence obtained by randomly combining the bases during the synthesis process after selecting a specific number of 76 bases during DNA synthesis without specifying the base type. Figure 11 and Figure 12 As shown, the nucleic acid aptamers D3A1, D3A2, D3A1T and D3A2T can specifically target the human SCLC cell lines SHP77 and H69 with high expression of DLL3.
[0104] Example 10: Detection of affinity of nucleic acid aptamers for cell surface DLL3
[0105] Flow cytometry can be used to make a relative quantitative assessment of the affinity of the nucleic acid aptamer, that is, to determine its dissociation constant. The nucleic acid aptamer labeled with Cy5 in Example 8 was prepared in a gradient concentration, and the final incubation volume was ensured to be 200 μL. SHP77 cells (5×105 Cells were washed twice with wash buffer and then mixed with a pre-prepared gradient of aptamers in binding buffer. The cells were incubated at 4°C for 30 minutes. After incubation, the cells were washed three times with wash buffer and analyzed using the BD FACSVerse™ system.
[0106] The results are as follows Figure 13 As shown, the dissociation constants of the nucleic acid aptamers D3A1, D3A2, D3A1T and D3A2T were 114.4 nM, 104.6 nM, 30.6 nM and 100.5 nM, respectively, which were consistent with the results in Example 6. D3A1T had the highest affinity for the DLL3 protein.
[0107] Example 11: Aptamer D3A1T specifically recognizes tumors in tumor-bearing mice
[0108] The nucleic acid aptamer D3A1T was used to perform in vivo fluorescence imaging experiments and radionuclide imaging experiments in small animals, namely, fluorescence and radionuclide imaging experiments to demonstrate that D3A1T specifically recognizes subcutaneous small cell lung cancer.
[0109] (1) Model construction
[0110] A SHP77 tumor-bearing mouse model with high DLL3 expression was constructed, and the model construction method included the following steps:
[0111] Human SCLC tumor cells SHP77, which were confirmed to have high DLL3 expression by Western blot, were pre-cultured. The cultured tumor cells were digested and resuspended in DPBS, and then the cells were counted and mixed with Matrigel (Corning) at a ratio of 1:1. The mixed cell suspension was placed on ice and tumor implantation was performed as soon as possible. 100 μL of cell suspension (containing 5×10 6 The subcutaneous transplant tumor model was established by injecting 5-week-old NZG mice (Weitong Lihua) into the right flank. The tumor size was measured with a vernier caliper. The tumor volume (mm 3 ) According to length × width 2 ×0.5, and wait until the tumor grows to 250-500 mm 3 It can be used for in vivo imaging and successful model construction.
[0112] (2) The SHP77 tumor-bearing mouse model successfully constructed above was used to conduct small animal fluorescence in vivo imaging and PET imaging experiments, which specifically included the following steps:
[0113] For in vivo fluorescence imaging, six SHP77 tumor-bearing mice were prepared and each mouse was injected with 1 nmol Cy5-labeled D3AT1 via the tail vein. 30 minutes after injection, the mice were completely anesthetized with isoflurane (concentration of 3%) and placed in a small animal in vivo fluorescence imager for imaging.
[0114] For PET imaging, three SHP77 tumor-bearing mice were prepared and each tumor-bearing mouse was injected with 150 uCi via the tail vein. 68 The radioactive D3A1T prepared was labeled with Ga; at specific time points 30 min, 60 min, and 150 min after injection, the tumor-bearing mice were anesthetized using isoflurane mixed with oxygen (concentration of 3%), and the deeply anesthetized nude mice were placed in a lateral position on a small animal PET / CT imager for imaging records at different time points.
[0115] Fluorescence imaging results Figure 14 As shown, compared with the Cy5-labeled random sequence control chain (Cy5-Lib, the Lib sequence used is the aforementioned random sequence), Cy5-labeled D3A1T was significantly targeted and enriched in the tumor site of SHP77 tumor-bearing mice. The in vitro organ distribution showed that Cy5-D3A1T was mainly metabolized through the liver and kidneys, and accumulated in other normal organs.
[0116] The PET imaging results of three SHP77 tumor-bearing mice (M1, M2, and M3) are as follows: Figure 15 As shown, short half-life nuclides 68 Ga-labeled D3A1T significantly accumulated in tumors, and most aptamers were cleared from the kidneys or liver, indicating that D3A1T can achieve specific targeting and recognition of DLL3-positive tumor cells in vivo.
[0117] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. A nucleic acid aptamer, characterized in that The nucleotide sequence is selected from any one of the following: i. nucleic acid aptamer D3A1, the nucleotide sequence of which is shown in SEQ ID NO: 1; ii. nucleic acid aptamer D3A2, the nucleotide sequence of which is shown in SEQ ID NO: 2; iii. nucleic acid aptamer D3A1T, the nucleotide sequence of which is shown in SEQ ID NO: 3; iv. Nucleic acid aptamer D3A2T, whose nucleotide sequence is shown in SEQ ID NO:
4.
2. A nucleic acid aptamer derivative, characterized in that: Obtained by modifying the nucleic acid aptamer according to any one of claims i-iv of claim 1; The modification includes labeling or chemical modification.
3. The nucleic acid aptamer derivative according to claim 2, wherein The label includes at least one of an isotope label, a fluorescent label, a biotin label, an enzyme label and a chemiluminescent label; The chemical modification includes at least one of methylation modification, amination modification, sulfhydration modification, phosphorylation modification, thiolation modification, carboxylation modification and isotope modification.
4. The nucleic acid aptamer derivative according to claim 2, wherein The nucleic acid aptamer derivative is a derivative of the nucleic acid aptamer obtained by labeling the 5' end of the nucleic acid aptamer according to any one of claims i to iv of claim 1 with a cyanine dye group.
5. A reagent for detecting Delta-like ligand 3, characterized in that The method comprises the nucleic acid aptamer according to claim 1 and / or the nucleic acid aptamer derivative according to any one of claims 2 to 4. 6 . Use of the nucleic acid aptamer according to claim 1 , the nucleic acid aptamer derivative according to any one of claims 2 to 4 , or the reagent according to claim 5 in preparing a product for detecting or purifying Delta-like ligand 3.
7. The use according to claim 6, characterized in that The product includes at least one of a test kit, a biosensor, and a detection chip.
8. Use of the nucleic acid aptamer according to claim 1, the nucleic acid aptamer derivative according to any one of claims 2 to 4, or the reagent according to claim 5 in identifying and binding to tumor cells for non-therapeutic or diagnostic purposes; the tumor cells are small cell lung cancer.
9. Use of the nucleic acid aptamer according to claim 1, the nucleic acid aptamer derivative according to any one of claims 2 to 4, and the reagent according to claim 5 in the preparation of a reagent for diagnosing small cell lung cancer.
Citation Information
Patent Citations
DLL3 modulators and methods of use
CN104520324A
Lipid-modified aptamer coupled drug and preparation method thereof
CN117925625A