Exosome efficient loading miRNA expression vector as well as preparation and application thereof

By modifying the pre-miR-423' skeleton complex with pcDNA6.2-EmGFP-mir9 vector and optimizing the stem loop structure, the problem of low delivery efficiency of miRNA expression vector in vivo was solved, and the efficient loading and therapeutic effect of exogenous miRNA in exosomes was achieved.

CN120361035APending Publication Date: 2025-07-25NANJING UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510507628.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-21
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

The existing miRNA expression vectors are inefficient in delivery in vivo, resulting in low efficiency of exogenous miRNA entering exosomes, affecting the therapeutic effect.

Method used

The modified pre-miR-423' backbone was used to complex with pcDNA6.2-EmGFP-mir9 vector. By optimizing the stem loop structure to shorten the inner loop, exosomes were formed to efficiently load the miRNA expression vector and replaced with the expression sequence of the target miRNA.

Benefits of technology

The efficiency of miRNA entering exosomes is significantly improved, and the loading rate and therapeutic effect of therapeutic miRNAs in exosomes are improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120361035A_ABST
    Figure CN120361035A_ABST
Patent Text Reader

Abstract

The invention discloses an exosome efficient loading miRNA expression vector as well as preparation and application thereof, and belongs to the technical field of miRNA expression vectors. According to the present invention, the expression vector for efficiently loading the miRNA on the exosome is provided, the expression vector is formed by compounding the modified pre-miR-423'skeleton and the pcDNA6.2-EmGFP-mir9 vector, and the expression vector can effectively improve the efficiency of the miR-423 entering the exosome; the expression sequence of miR-423 in the expression vector can be replaced by the expression sequences of other miRNAs, so that compared with the existing general miRNA expression vector, the effect of remarkably improving the exosome entering efficiency of other exogenous miRNAs can be achieved; according to the provided exosome efficient loading miRNA expression vector, the method for loading the exogenous miRNA is simple and easy to operate, and the exosome efficient loading miRNA expression vector is expected to be used for improving the loading efficiency of therapeutic miRNA in the exosome and improving the therapeutic effect of exosome mediated targeted drug delivery.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of miRNA expression vectors, and in particular to an exosome for efficiently loading miRNA expression vectors and its preparation and application. Background Art

[0002] miRNAs are a class of endogenous non-coding RNAs with a length of about 20-24 nucleotides, which play a key role in cell differentiation, proliferation, apoptosis, and metabolism by regulating gene expression. The abnormal expression of miRNAs is closely related to various diseases (such as cancer, cardiovascular diseases, neurodegenerative diseases, etc.). Therefore, miRNAs have become an important target for disease treatment research. Since miRNA precursors (pre-miRNAs) have a specific secondary structure (such as a stem-loop structure), which is crucial for miRNA processing and maturation, researchers have designed vectors capable of efficiently expressing exogenous miRNAs using the backbone sequences of natural miRNA precursors. Currently, the most commonly used ones are shRNAs designed based on miR-30 and miR-155 precursors. By constructing miRNA expression vectors, researchers can overexpress or inhibit specific miRNAs to study their functions in cell or animal models. However, the delivery efficiency of miRNA expression vectors in vivo remains a challenge. Researchers are developing delivery systems based on viral vectors, liposomes, or nanoparticles to improve the targeting and stability of miRNAs.

[0003] Exosomes are extracellular vesicles secreted by cells with a diameter between 30 and 1000 nm, which contain a variety of nucleic acids secreted by cells, including mRNA, miRNA, and other non-coding RNAs, and they can exist stably. When exosomes circulate, these exosomal RNAs can be absorbed by neighboring cells or distant cells, thereby regulating the functions of recipient cells. Due to the natural biocompatibility, low immunogenicity, and efficient intercellular communication ability of exosomes, they have become an ideal and efficient delivery tool for transporting therapeutic miRNAs. Moreover, exosomes can target specific sites or cells through specific proteins or artificially modified signal peptides on the membrane, enhancing the therapeutic effect and reducing the drug side effects. The recently developed in vivo self-assembly system can reconstruct the liver of mice into an organ that can produce and secrete exosomes containing siRNAs through gene circuit editing, realizing the stable, efficient, and safe transmission of siRNAs in vivo.

[0004] However, a large part of the existing miRNAs expressed by backbones such as miR-155 remain in cells, and the efficiency of entering exosomes is not high. Therefore, improving the efficiency of exogenous miRNA entering exosomes is of great significance for increasing the loading rate of small nucleic acid drugs in exosomes and obtaining better therapeutic effects. Summary of the Invention

[0005] The object of the present invention is to provide an exosome with high-efficiency loading of miRNA expression vector and its preparation and application, so as to solve the problems that the efficiency of exogenous expressed miRNA entering exosomes is low, the loading effect is poor, and thus the therapeutic effect of miRNA is affected.

[0006] To achieve the above object, the present invention provides the application of the modified pre-miR-423' backbone in the preparation of an exosome with high-efficiency loading of miRNA expression vector. The nucleotide sequence of natural pre-miR-423 is shown in SEQ ID NO.1, and the sequence of the modified pre-miR-423' backbone is shown in SEQ ID NO.2.

[0007] An exosome with high-efficiency loading of miRNA expression vector, which is a recombinant vector formed by connecting the above-mentioned modified pre-miR-423' backbone between the BamH I and Xho I restriction enzyme cleavage sites of the pcDNA6.2-EmGFP-mir9 vector.

[0008] Preferably, the modification is to cut the antisense strand of the natural pre-miR-423 expression sequence to shorten the internal loop.

[0009] The application of an exosome with high-efficiency loading of miRNA expression vector as described above in improving the efficiency of exogenous miRNA entering exosomes.

[0010] A method for improving the efficiency of exogenous miRNA entering exosomes, which uses the above-mentioned exosome with high-efficiency loading of miRNA expression vector, and replaces the expression sequence of miR-423 in the exosome with high-efficiency loading of miRNA expression vector with the expression sequence of the target miRNA.

[0011] Preferably, the expression sequence of miR-423 in the exosome with high-efficiency loading of miRNA expression vector is shown in SEQ ID NO.3.

[0012] The application of an exosome with high-efficiency loading of miRNA expression vector as described above in the preparation of miRNA-based targeted therapeutic drugs.

[0013] Therefore, an exosome with high-efficiency loading of miRNA expression vector and its preparation and application provided by the present invention have the following specific technical effects:

[0014] (1) The present invention provides an exosome with high-efficiency loading of miRNA expression vector, which is composed of a modified pre-miR-423' backbone complexed with the pcDNA6.2-EmGFP-mir9 vector. This expression vector can effectively improve the efficiency of miR-423 entering exosomes;

[0015] (2) The exosome with high-efficiency loading of miRNA expression vector provided by the present invention can also achieve the effect of significantly improving the efficiency of other exogenous miRNAs entering exosomes by replacing the expression sequence of miR-423 in the expression vector with the expression sequence of other miRNAs;

[0016] (3) The method for loading exogenous miRNAs by the exosome with high-efficiency loading of miRNA expression vector provided by the present invention is simple and easy to operate, and is expected to be used to improve the loading efficiency of therapeutic miRNAs in exosomes and enhance the therapeutic effect of exosome-mediated targeted drugs. Brief Description of the Drawings

[0017] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments of the present invention. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0018] Figure 1 It is the secondary structure of pre-miR-423 used in the present invention; where A is the secondary structure of natural pre-miR-423; B is the secondary structure of the modified pre-miR-423' backbone;

[0019] Figure 2 It is the vector structure diagram of the pcDNA6.2-EmGFP-mir9 vector used in Example 1 of the present invention;

[0020] Figure 3 It is the inspection result of the relative expression levels of transfected pre-miR-423 in 293T cells and exosomes in Example 2 of the present invention; where Pre-miRNAs is pre-miR-423', Control is the control group (transfected with NC, that is, a scrambled nonsense control), and **** represents P < 0.0001;

[0021] Figure 4 It is the engineered miR-155 backbone and the secondary structure of pre-miR-155backbone-miR-423 in Example 3 of the present invention;

[0022] Figure 5It is the investigation result of the relative expression levels of miR-423 expressed by the modified pre-miR-423′ backbone and engineered miR-155 backbone in cells and exosomes in Example 3 of the present invention; among them, Pre-miRNAs is the pre-miR-423′ backbone, Control is the control group (transfected with NC, that is, a nonsense control with scrambled sequence), Pre-miR-155backbone-miR-423 is miR-423 expressed by the miR-155 backbone, *** represents P<0.001, and **** represents P<0.0001;

[0023] Figure 6 It is the secondary structure diagram of pre-miR-423′backbone-miR-19b in Example 4 of the present invention;

[0024] Figure 7 It is the investigation result of the relative expression levels of miR-19b expressed by the natural pre-miR-19b backbone and the modified pre-miR-423′ backbone in cells and exosomes in Example 4 of the present invention; among them, Pre-miR-19b is miR-19b expressed by the natural pre-miR-19b backbone, Control is the control group, pre-miR-423′backbone-miR-19b is miR-19b expressed by the modified pre-miR-423′ backbone, ND means not detected, * represents P<0.05, and **** represents P<0.0001. Detailed implementation manners

[0025] The technical solution of the present invention will be further described below with reference to the drawings and examples.

[0026] In order to make the purpose, technical solution and advantages of the present application clearer, more thorough and complete, the technical solution of the present invention will be clearly and completely described below with reference to the drawings and examples. The following detailed descriptions are all descriptions of examples, aiming to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as commonly understood by those of ordinary skill in the art to which this application belongs.

[0027] The present invention provides an exosome highly efficient miRNA expression vector loading system, which can effectively improve the efficiency of exogenous expressed miRNA entering exosomes. The provided exosome highly efficient miRNA expression vector loading system is based on the natural backbone of pre-miR-423 (the nucleotide sequence is shown in SEQ ID NO.1) (natural pre-miR-423 is as Figure 1As shown, where the red font is the replaceable targeting sequence, the blue font is its complementary pairing sequence, and the black font is the backbone. The backbone sequence is as shown in SEQ ID NO.2. By optimizing the stem-loop structure (increasing or decreasing the antisense strand of the expression sequence to shorten the inner loop), a pre-miR-423' backbone expression vector was obtained. By replacing the expression sequence of the miRNA expression vector highly efficiently loaded into exosomes (as shown in SEQ ID NO.3) with the expression sequence of the miRNA (miR-19b) with low expression in exosomes ( Figure 6 the red and blue fonts in

[0028] SEQ ID NO.1:

[0029]

[0030] SEQ ID NO.2:

[0031]

[0032] SEQ ID NO.3: UGAGGGGCAGAGAGCGAGACUUU

[0033] The instruments, equipment, reagents, and materials used in the examples were all obtained through commercial channels;

[0034] The high-glucose DMEM medium with 10% fetal bovine serum was composed of the following components: 5 mL fetal bovine serum + 45 mL high-glucose DMEM medium;

[0035] The high-glucose DMEM medium was composed of the following components: 4.5 g / L D-glucose, L-glutamine, 110 mg / L sodium pyruvate;

[0036] Opti-MEM: Opti-MEM serum-free medium;

[0037] Exosome-free serum: Fetal bovine serum was centrifuged at 4°C and 120,000 G for 2 hours in a 70Ti ultracentrifugation tube to remove exosomes in the precipitate, and the supernatant was the exosome-free serum.

[0038] Example 1

[0039] Construct an expression vector for highly efficiently loading miRNA into exosomes. The specific steps are as follows:

[0040] S11. Send the information of the nucleotide sequence required for the synthesis of the natural precursor pre-miR-423 sequence of miR-423 (as shown in SEQ ID NO.1) (as shown in SEQ ID NO.4) to the company for synthesis.

[0041] SEQ ID NO.4:

[0042]

[0043] S12. Send the restriction enzyme site information to the company and entrust the company to insert the pre-miR-423' backbone into the bamH I and Xho I sites of the pcDNA6.2-EmGFP-mir9 vector (the vector structure is as Figure 2 shown). After sequencing verification, the insertion position and direction are consistent with the expectation, and an expression vector for efficient loading of miRNA into exosomes is obtained.

[0044] Example 2

[0045] Investigate the relative expression levels of the miRNA precursor miR-423 in cells and exosomes, as follows:

[0046] S21. Add DMEM high-glucose medium containing 10% fetal bovine serum and 293T cells to a T175 culture flask, and culture the 293T cells at 37°C and 5% CO2. When the cell density is visually estimated to reach about 80%, use liposome nucleic acid transfection reagent to transfect the expression vector (plasmid) for efficient loading of miRNA into exosomes constructed in Example 1 into the cells. The specific steps are as follows:

[0047] Dilute 70 μg of the plasmid constructed successfully in Example 1 with 1 mL of Opti-MEM and mix well; dilute 140 μL of liposome nucleic acid transfection reagent with 1 mL of Opti-MEM and mix well; incubate at room temperature for 5 minutes. Mix the diluted plasmid and the diluted liposome nucleic acid transfection reagent, mix gently, and incubate at room temperature for 20 minutes to form the DNA-liposome complex. Replace the culture medium of the 293T cells cultured to a cell density of about 80% with DMEM high-glucose medium. Add the complex to the cell culture medium, mix gently, and place it in the incubator for culture. After 5 hours of transfection, replace the medium with DMEM containing 2% exosome-free serum.

[0048] S22. After 24 hours of transfection, collect the culture medium in a 50 mL centrifuge tube, and use a cell scraper to collect the cells in the culture flask for standby. Centrifuge the culture medium collected in the 50 mL centrifuge tube at 3000G for 30 minutes, take the supernatant and centrifuge it at 10000G for 1 hour, then take the supernatant and centrifuge it in a 70Ti ultracentrifuge tube at 4°C and 120000G for 2 hours. The precipitate is exosomes. Collect the exosomes and add 20 μL of PBS to dissolve the exosomes.

[0049] Total RNA was extracted from the collected 293T cells and exosomes using the Trizol method. qPCR was performed according to the instructions attached to the kit. For 293T cells, snRNA U6 was used as an internal reference for calibration, and for exosomes, miR-16 was used as an internal reference for calibration. The relative contents of miRNAs in 293T cells and exosomes were detected respectively. The qPCR program was as follows: 95°C for 300 s, 1 cycle; 95°C for 15 s, 60°C for 60 s, 40 cycles; 37°C for 30 s, 1 cycle. Using transfection of NC (i.e., a scrambled nonsense sequence) as a control (Control), the results were as Figure 3 shown, and the miRNA precursor miR-423 was highly expressed in exosomes.

[0050] Example 3

[0051] To investigate whether the exosome-based miRNA expression vector constructed in Example 1 can improve the efficiency of miR-423 entering exosomes compared with the existing miR-155 backbone, the specific steps are as follows:

[0052] 1) Replace the expression sequence of the engineered miR-155 backbone with the expression sequence of miR-423, that is, miR-423 with the miR-155 backbone in the skeleton part was obtained (as shown in SEQ ID NO.5). The complete synthetic sequence required (as shown in SEQ ID NO.6) was commissioned to be synthesized by a company and inserted into the bamH I and Xho I sites of the pcDNA6.2-EmGFP-mir9 vector. After sequencing confirmation was correct, the miR-423 expression vector with the backbone replaced by the miR-155 backbone was obtained.

[0053] SEQ ID NO.5:

[0054] UGCUGUGAGGGGCAGAGAGCGAGACUUUUUUUGGCCUCUGACUGAAAA

[0055] GUCUCGCUCUGCCCCUCACAGG

[0056] SEQ ID NO.6:

[0057] GGATCCTGGAGGCTTGCTGAAGGCTGTATGCTGTGCTGTGAGGGGCAGAG

[0058] AGCGAGACTTTTTTTGGCCTCTGACTGAAAAGTCTCGCTCTGCCCCTCACA

[0059] GGCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAG

[0060] ATCTGGCCGCACTCGAG

[0061] 2) The constructed expression vector was transfected into 293T cells by the method in Example 2. Cells and exosomes were collected, and qPCR was performed using the system configured according to the instructions attached to the kit in Example 2. Among them, snRNA U6 was used as an internal reference for calibration of 293T cells, and miR-16 was used as an internal reference for calibration of exosomes. The relative content of miRNA was detected and denoted as 155backbone-miR-423.

[0062] The expression vector constructed in Example 1 was denoted as pre-miRNA. The miR-155 backbone was used as a control.

[0063] The results were as Figure 5 shown. Compared with the existing miR-155 backbone expression vector, the exosome highly efficient miRNA-loading expression vector provided by the present invention can significantly improve the efficiency of miR-423 entering exosomes.

[0064] Example 4

[0065] To investigate whether the exosome highly efficient miRNA-loading expression vector constructed in Example 1 can improve the efficiency of miR-19b entering exosomes, the specific steps are as follows:

[0066] 1) By the method in Example 1, the complete sequence required for the synthesis containing the pre-miR-19b sequence (as shown in SEQ ID NO.7) was inserted between the bamH I and Xho I sites, and after sequencing confirmation was correct, the expression vector of pre-miR-19b was obtained. The constructed pre-miR-19b expression vector was transfected into 293T cells by the method in Example 2. Cells and exosomes were collected, and qPCR was performed using the system configured according to the instructions attached to the kit in Example 2. Among them, snRNA U6 was used as an internal reference for calibration of 293T cells, and miR-16 was used as an internal reference for calibration of exosomes. The relative content of miRNA was detected and denoted as Pre-miR19b.

[0067] SEQ ID NO.7:

[0068]

[0069] 2) Replace the expression sequence of miR-423 in the miRNA highly loaded expression vector of exosomes constructed in Example 1 with the expression sequence of miR-19b. Insert the complete synthetic sequence (as shown in SEQ ID NO.8) between the bamH I and Xho I sites. After sequencing and confirmation, the miRNA highly loaded expression vector of exosomes with miR-19b is obtained. Transfect the constructed miRNA highly loaded expression vector of miR-19b exosomes into 293T cells using the method in Example 2. Collect the cells and exosomes, and perform qPCR using the system configured according to the instruction manual attached to the kit in Example 2. For 293T cells, calibrate with snRNA U6 as the internal reference, and for exosomes, calibrate with miR-16 as the internal reference to detect the relative content of miRNA, denoted as pre-miR-423′ backbone-miR-19b. Use the natural precursor backbone of pre-miR-19b as the control, and transfect NC as the nonsense control, denoted as the Control group.

[0070] SEQ ID NO.8:

[0071]

[0072]

[0073] The results are as Figure 7 shown. Compared with the expression vector of the natural precursor backbone of miR-19b, the miRNA highly loaded expression vector of exosomes provided by the present invention can significantly improve the efficiency of miR-19b entering exosomes.

[0074] Therefore, the present invention provides a miRNA highly loaded expression vector of exosomes, which is composed of the modified pre-miR-423′ backbone and the pcDNA6.2-EmGFP-mir9 vector. This expression vector can effectively improve the efficiency of miR-423 entering exosomes; it can also replace the expression sequence of miR-423 in the expression vector with the expression sequences of other miRNAs to significantly improve the efficiency of other exogenous miRNAs entering exosomes; the method of loading exogenous miRNAs provided by the miRNA highly loaded expression vector of exosomes is simple and easy to operate, and is expected to be used to improve the loading efficiency of therapeutic miRNAs in exosomes and enhance the therapeutic effect of exosome-mediated targeted drugs.

[0075] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions of the present invention or make equivalent replacements, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. Application of the modified pre-miR-423' backbone in preparing an exosome with high-efficiency loading of miRNA expression vector, characterized in that: The nucleotide sequence of natural pre-miR-423 is shown in SEQ ID NO.1, and the modified pre-miR-423' backbone sequence is shown in SEQ ID NO.

2.

2. Use of the modified pre-miR-423' backbone according to claim 1 in the preparation of an exosome for highly efficiently loading a miRNA expression vector, characterized in that: The modification is to cut the antisense strand of the natural pre-miR-423 expression sequence to shorten the internal loop.

3. An exosome with high-efficiency loading of miRNA expression vector, characterized in that: The exosome highly efficient miRNA expression vector loading is a recombinant vector formed by connecting the modified pre-miR-423' backbone described in claim 1 between the BamH I and Xho I restriction enzyme cleavage sites of the pcDNA6.2-EmGFP-mir9 vector.

4. Use of an exosome highly efficient miRNA expression vector as described in claim 3 in improving the efficiency of exogenous miRNA entering exosomes.

5. A method for improving the efficiency of exogenous miRNA entering exosomes, characterized in that: Using the exosome highly efficient miRNA expression vector described in claim 3, replace the miR-423 expression sequence in the exosome highly efficient miRNA expression vector with the expression sequence in the target miRNA.

6. A method for improving the efficiency of exogenous miRNA entering exosomes according to claim 5, characterized in that: The miR-423 expression sequence in the exosome highly efficient miRNA expression vector is shown in SEQ ID NO.

3.

7. Use of an exosome highly efficient miRNA expression vector as described in claim 3 in the preparation of miRNA-based targeted therapeutic drugs.