Quality control label oligonucleotide, reagent or kit, preparation method and application thereof

By generating and screening specific oligonucleotide tag sequences, designing primers and probes, and constructing a detection system, the false positive problems caused by quality control products and the inconsistent detection efficiency of the test kits were solved, high-sensitivity and specificity quality control detection was achieved, and the accuracy and standardization of detection were improved.

CN120366432BActive Publication Date: 2025-10-03BEIJING HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510509580.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-22
Publication Date
2025-10-03
Estimated Expiration
2045-04-22

AI Technical Summary

Technical Problem

Existing quality control products are prone to cause false positive results in genetic testing, and different test kits have inconsistent detection efficiency for the same pathogen, and there is a lack of unified standardized methods.

Method used

By generating specific oligonucleotide tag sequences, designing primers and probes, and constructing a detection system, we can screen out tag oligonucleotides with high sensitivity and specificity to construct quality control tag oligonucleotides and kits, solve the false positive problem, and achieve standardization of different kits.

Benefits of technology

Effectively distinguish true positive samples from false positive results, achieve standardization of pathogen detection by different test kits, and improve detection accuracy and efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366432B_ABST
    Figure CN120366432B_ABST
Patent Text Reader

Abstract

The present invention discloses label oligonucleotides, reagents or kits for quality control, and their preparation methods and applications. By randomly generating oligonucleotide sequences and performing multiple screenings under specific screening conditions, the optimal oligonucleotide label sequence is finally obtained. Based on such sequences, specific primers and corresponding probes are further designed to construct a simple, rapid, and highly specific and sensitive detection system. The obtained label oligonucleotide sequence can be introduced as a unified label into different pathogen nucleic acid standard substances or quality control products, effectively solving the different detection efficiencies of different detection reagents for different pathogens, standardizing a series of products and improving the accuracy of quantitative results, and helping to optimize the pathogen detection system; at the same time, the label sequence is introduced into positive nucleic acid quality control products, which can also effectively solve the effective identification of false positive results of the test samples caused by positive quality control contamination.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of gene detection, and in particular to label oligonucleotides, reagents or kits for quality control, and preparation methods and applications thereof. Background Art

[0002] In the field of genetic diagnostics, the use of quality control products plays a crucial role in ensuring the reliability and reproducibility of experimental results. These quality control products typically contain known concentrations and types of target molecules and are used to monitor key steps in the experimental process, including sample processing, nucleic acid extraction, and amplification reactions. By comparing these products with quality control products, researchers can assess the stability of experimental conditions and whether there are any operational errors or reagent issues.

[0003] However, the use of quality control materials also presents some challenges. One major issue is the occurrence of false-positive results. Positive quality control materials are often used to verify the effectiveness of the test process. However, positive control materials derived from the test subjects may introduce potential contamination during operation and cause false-positive results, causing negative samples to be mistakenly diagnosed as positive. Therefore, more effective and precise methods are needed to distinguish true positive samples from false-positive results caused by positive quality control materials. This is of great significance for improving the accuracy of diagnosis and the effectiveness of patient treatment.

[0004] With technological advancements, a growing number of test kits for detecting common pathogens have emerged. However, because different test kits target different sequences for the same pathogen, the designed primers and probes are also different. Consequently, different test kits often have varying efficiencies when detecting the same pathogen. For example, a comparison of seven domestically produced novel coronavirus nucleic acid detection kits revealed that the mean CT values ​​for amplification of the ORF1ab target gene by test reagents produced by different manufacturers were not exactly the same. The same was true for the detection of the N target gene; the CT values ​​of the test results from different test reagents were not on the same level. Furthermore, some test kits can simultaneously detect multiple pathogens using multiplex PCR technology, but different primers and probes are designed for different pathogens, further leading to inconsistent detection efficiency.

[0005] To address the potential contamination of positive quality control samples, literature reports have reported the introduction of EcoRV and BamHI restriction sites into quality control samples for molecular diagnosis of Bacillus anthracis to identify false-positive amplifications caused by quality control contamination. Subsequently, synthetic quality control DNA (RNA) sequences containing T7 promoter primers, NotI restriction sites, detection primers and probe sequences, and viral gene sequences have been used as more sophisticated exogenous quality controls for various molecular detection methods. Both of these methods primarily contain nucleic acid sequences or one or two restriction sites that are identical or similar to the target sequence being tested.

[0006] To address the issue of varying detection efficiency, which leads to significant discrepancies in results between different reagents testing the same region, or between different regions using the same reagent, making standardization impossible, studies have shown that several nucleic acid amplification and fluorescence quantitative kits for hepatitis C virus in my country can be standardized using the second-generation standards developed by the WHO as a reference: a linear regression is performed on the standard concentration and the measured concentration. The detected values ​​(X) of reagents A, B, and C and the true values ​​(Y) of the samples can be mapped one-to-one within the linear range using the regression equation, and ultimately converted to the concentration of the standard. However, this method requires diluting the existing standards and performing multiple measurements of these standards at different concentrations, a cumbersome process. Moreover, standardization can only be performed on samples within the linear range of the regression equation. However, if no internationally accepted standard exists for the target, standardization remains a challenge.

[0007] The information in the background technology is only intended to illustrate the general background of the invention and should not be regarded as an admission or any form of suggestion that this information constitutes the prior art known to a person skilled in the art. Summary of the Invention

[0008] To effectively address the differences in detection efficiency between different primers and probes for different pathogens, standardize a series of products, make them comparable and traceable, and help optimize the pathogen detection system and effectively identify false positive results caused by positive quality control, the present invention obtains oligonucleotide tag sequences through specific screening conditions, and designs and screens corresponding primers and probes based on the tag sequences, constructs a detection system, and verifies the excellent performance of the system in terms of sensitivity, precision, and specificity. Specifically, the present invention includes the following contents.

[0009] In a first aspect of the present invention, a method for preparing a quality control label oligonucleotide is provided, comprising the following steps:

[0010] (1) generating candidate oligonucleotide sequences, and performing preliminary screening and shift alignment screening on the generated candidate oligonucleotide sequences to obtain tag sequences;

[0011] (2) obtaining a tag oligonucleotide having the tag sequence, and connecting it to a vector as a template, designing candidate primers and probes for the tag oligonucleotide, and constructing an amplification reaction system to further screen the primers and probes to obtain primers and probes for detection;

[0012] (3) Confirming the performance of the amplification reaction system to obtain a quality control label oligonucleotide.

[0013] In certain embodiments, according to the method for preparing quality control tag oligonucleotides of the present invention, the candidate oligonucleotide sequences generated in step (1) are 50-500 bp in length and 2-500 in number.

[0014] In certain embodiments, according to the method for preparing the quality control tag oligonucleotide of the present invention, the preliminary screening indicators of step (1) include GC content, the presence or absence of enzyme cleavage sites, and homology comparison results.

[0015] In certain embodiments, according to the method for preparing a quality control tag oligonucleotide of the present invention, the translocation comparison screening in step (1) comprises:

[0016] Selecting a fixed-length sequence from the starting base of the candidate oligonucleotide sequence obtained by the preliminary screening, stepping by an interval length, and selecting a fixed-length sequence again, and repeating this operation until the starting base cannot be moved further backward, thereby obtaining multiple fixed-length sequences;

[0017] Two rounds of screening were performed on the obtained multiple fixed-length sequences, and the screening indicators included GC content, Tm value, secondary structure score and BLAT check.

[0018] In certain embodiments, according to the method for preparing a quality control tag oligonucleotide of the present invention, the fixed length is 2%-50% of the length of the candidate oligonucleotide sequence, and the interval length is 2-20 bp.

[0019] In certain embodiments, according to the method for preparing a quality control label oligonucleotide according to the present invention, in step (2), the amplification reaction system includes a background signal reaction system containing a bovine serum albumin matrix and a simulation reaction system containing a negative plasma matrix, and step (2) includes a step of comparing the amplification results of the background signal reaction system and the simulation reaction system.

[0020] The second aspect of the present invention provides a quality control label oligonucleotide, which is prepared by the method described in the first aspect.

[0021] The third aspect of the present invention provides a detection reagent or kit, which comprises a template, primers and probes, and optionally a reaction solution and an enzyme mixture, wherein the template comprises the quality control label oligonucleotide described in the second aspect.

[0022] The fourth aspect of the present invention provides the use of the quality control label oligonucleotide described in the second aspect as a pathogen nucleic acid standard substance or quality control product.

[0023] In certain embodiments, the use comprises one of the following:

[0024] Used to standardize different products and make them comparable and traceable;

[0025] Used to compare the detection efficiency of the same detection reagent for different pathogens;

[0026] To compare the detection efficiency of different detection reagents for the same pathogen; or

[0027] Used to solve the contamination problem caused by positive quality control.

[0028] The present invention randomly generates oligonucleotide sequences and performs multiple screenings under strict screening conditions to ultimately obtain the optimal oligonucleotide tag sequence. Based on this type of sequence, specific primers and corresponding probes are further designed to construct a simple, rapid, and highly specific and sensitive detection system. The resulting tag oligonucleotide sequence can be introduced as a unified tag into different pathogen nucleic acid standard materials or quality control products, effectively solving the different detection efficiencies of different detection reagents for different pathogens, standardizing a series of products and improving the accuracy of quantitative results, helping to optimize the pathogen detection system; at the same time, the introduction of the tag sequence into the positive nucleic acid quality control product can also effectively solve the effective identification of false positive results of the test samples caused by positive quality control contamination. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Generation and screening of oligonucleotide tag sequences.

[0030] Figure 2 Tag sequence primers, probes, and annealing temperature screening process.

[0031] Figure 3 Melting curves of four pairs of candidate primers using the index sequence.

[0032] Figure 4 Primer pair 3 and its candidate probe.

[0033] Figure 5 Amplification results of different primer-probe combinations.

[0034] Figure 6 Probit curve of LOD analysis of tag sequence RNA detection method.

[0035] Figure 7 Detection of tag sequence RNA method-specific results.

[0036] Figure 8 Probit curve of LOD analysis of tag sequence DNA detection method.

[0037] Figure 9 Detection of tag sequence DNA method specific results.

[0038] Figure 10 Detection results of reagents 1, 2, 3 and tag sequences.

[0039] Figure 11 Detection results of ZIKV and tag sequences by reagents 1, 2, 3, and 4.

[0040] Figure 12 Different groups of tag sequences and ZIKV detection results. DETAILED DESCRIPTION

[0041] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0042] It should be understood that the terms described in the present invention are only for describing particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges in the present invention, it should be understood that the upper and lower limits of the ranges and each intermediate value therebetween are specifically disclosed. Each smaller range between any stated value or intermediate value within a stated range and any other stated value or intermediate value within the stated range is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0043] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the invention belongs. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In the event of any conflict with any incorporated document, the content of this specification shall prevail.

[0044] [Preparation method]

[0045] In a first aspect of the present invention, a method for preparing a quality control labeled oligonucleotide is provided, which comprises at least the following steps:

[0046] (1) generating candidate oligonucleotide sequences, and performing preliminary screening and shift alignment screening on the generated candidate oligonucleotide sequences to obtain tag sequences;

[0047] (2) obtaining a tag oligonucleotide having the tag sequence, and connecting it to a vector as a template, designing candidate primers and probes for the tag oligonucleotide, and constructing an amplification reaction system to further screen the primers and probes to obtain primers and probes for detection;

[0048] (3) Confirming the performance of the amplification reaction system to obtain a quality control label oligonucleotide.

[0049] Those skilled in the art will understand that the numbers (1), (2), and (3) are only used to distinguish different steps and do not indicate the order of the steps. As long as the purpose of the present invention can be achieved, the order of the above steps is not particularly limited. In addition, those skilled in the art will also understand that other steps or operations may be included before or after the above steps (1)-(3), or between these arbitrary steps, for example, to further optimize and / or improve the method of the present invention. Each step is described in detail below.

[0050] Step (1):

[0051] Step (1) of the present invention is a step of obtaining a tag sequence, which includes generating a candidate oligonucleotide sequence, performing preliminary screening and shift alignment screening on the generated candidate oligonucleotide sequence to obtain a tag sequence.

[0052] The generation of the candidate oligonucleotide sequence in step (1) of the present invention is not limited, and is generally randomly automatically generated. The specific random automatic generation method can be performed using any method or tool known in the art. The length of the candidate oligonucleotide sequence is not limited, and is generally the same as or longer than the length of the desired quality control label oligonucleotide finally obtained. Exemplarily, the length of the candidate oligonucleotide sequence is 50-500bp, for example, 60-550bp range, 70-500bp range, 80-450bp range, 90-400bp range, 100-350bp range, 105-300bp range, 110-250bp range, 115-200bp range, 120-150bp range. In the present invention, the number of candidate oligonucleotide sequences generated is not limited, and is generally a plurality, for example, 5 or more, 10 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 80 or more, 100 or more, 120 or more, 150 or more, 180 or more, 200 or more, 250 or more, 300 or more, 350 or more, 400 or more, 450 or more, etc. The specific number can be freely selected by the skilled person as needed.

[0053] In step (1) of the present invention, the candidate oligonucleotide sequence is screened in two steps to obtain a tag sequence. The first step of screening is a preliminary screening. Indicators known in the art can be used for the preliminary screening. Examples of such indicators include but are not limited to GC content, the presence or absence of enzyme cleavage sites, homology comparison results, etc. The present invention can use one or more of the above indicators. The threshold value or range of each indicator is not limited and can be selected according to the specific situation or the situation of the nucleic acid to be tested.

[0054] In the present invention, the GC content index is generally set at a threshold or range of 45% to 55%. Excessively high or low GC content can affect subsequent amplification, and the GC content within the above range is selected to minimize its impact on subsequent amplification.

[0055] In the present invention, for the restriction enzyme cleavage site indicator, a candidate oligonucleotide sequence without a restriction enzyme cleavage site is generally selected. In certain specific embodiments, when nucleic acid testing does not involve restriction enzyme cleavage or when the obtained quality control tag oligonucleotide sequence is directly connected to a carrier without restriction enzyme cleavage, a candidate oligonucleotide sequence with a restriction enzyme cleavage site or without a specific restriction enzyme cleavage site may also be selected. In certain specific embodiments, when nucleic acid testing or the obtained quality control tag oligonucleotide sequence needs to be connected to a carrier by restriction enzyme cleavage, a candidate oligonucleotide sequence without a restriction enzyme cleavage site is preferably selected.

[0056] In the present invention, the homology comparison index refers to the sequence homology or similarity between the candidate oligonucleotide sequence and the nucleic acid to be tested or the target nucleic acid. The higher the homology, the higher the noise, and the uniqueness or specificity of the tag sequence deteriorates. Therefore, it is preferred that there is no homology comparison result, or the homology comparison result is low, for example, less than 20%, less than 15%, less than 10%, less than 5%, less than 2%, etc. Homology comparison can be performed using methods known in the art. Exemplarily, it can be performed by, for example, the Nucleotide BLAST module, an online tool of NCBI. When the nucleic acid to be tested is a nucleic acid of a human infectious pathogen, it is preferred to compare the candidate oligonucleotide sequence with the sequences of all human infectious pathogen nucleic acids.

[0057] In step (1) of the present invention, after the candidate oligonucleotide sequences are initially screened, the remaining sequences are further subjected to secondary screening, i.e., shift alignment screening, which includes selecting a fixed-length sequence from the starting base of the candidate oligonucleotide sequence obtained in the initial screening, shifting the interval length, and selecting a fixed-length sequence again, and repeating this operation until the starting base cannot be moved any further backward, thereby obtaining multiple fixed-length sequences.

[0058] In the present invention, the position of the starting base is not limited and can be a base at any position of the candidate oligonucleotide sequence. Counted from the 5' end to the 3' end, the starting base can be any base on the 5' end side, for example, any one of the first 20 bases, any one of the first 10 bases, or any one of the first 5 bases on the 5' end side. In certain embodiments, the starting base is the first base at the 5' end. Similarly, when counting from the 3' end to the 5' end, similar processing can be performed. In certain embodiments, the starting base of the present invention can also be any base in the middle position.

[0059] In the present invention, the selected fixed length is not limited and is generally determined according to the length of the candidate oligonucleotide sequence, usually 2%-50% of its length, such as 3%, 4%, 5%, 6%, 8%, 10%, 12%, 14%, 16%, 18%, 20%, 25%, 30%, 35%, 40%, 45%, etc. Examples of fixed lengths include, but are not limited to, 10pb, 15pb, 20pb, 25pb, 30pb, 35pb, 40pb, 45pb, 50pb, 55pb, 60pb, or even longer.

[0060] In the present invention, the interval length refers to the distance between selections made after moving in a certain direction after the last selection. The interval length is generally less than the fixed length, for example, 1%-90% of the fixed length, such as 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, etc. The specific length is not limited, and exemplary lengths include but are not limited to 3pb, 5pb, 6pb, 8pb, 10pb, 12pb, 14pb, 16pb, 18pb, 20pb, 25pb, etc.

[0061] In the present invention, the direction of the step or movement is not limited, and is usually from one end to the other end of the candidate oligonucleotide sequence. In certain embodiments, the step or movement can also be from the middle position of the candidate oligonucleotide sequence to both sides.

[0062] In the present invention, multiple fixed-length fragments are obtained by shifting, and each fragment is subjected to secondary screening. The indicators during screening include but are not limited to GC content, Tm value, secondary structure score and BLAT check. Similar to the GC content indicator of step (1), the threshold value of the GC content in step (2) is also not limited, but usually, the upper limit of its range is greater than the upper limit of step (1). For example, it is less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, etc.

[0063] In the present invention, the Tm value used as the screening index in step (2) is not limited, and is generally in the range of 40-70°C, such as 45-70°C, 50-65°C, 40-65°C, 45-65°C, 50-60°C, etc.

[0064] In the present invention, the secondary structure score as the screening index of step (2) refers to the index of the secondary structure and the stability of the secondary structure in the fixed-length fragment. Among them, the number of secondary structures can be reflected by assigning 1 point for each occurrence of a hairpin structure or a dimer structure in the fixed-length fragment; the stability of the secondary structure is measured by using the free energy ΔG value. The smaller the free energy, the more stable the structure. For example, when the free energy of the inevitable secondary structure of the candidate oligonucleotide shift comparison fragment, including the hairpin structure and the dimer structure, is below the threshold (ΔG<-4.5kcals / mol), it indicates that the secondary structure formed by the fragment is very stable, which is not conducive to the realization of the purpose of the present invention. Therefore, the sequence below the threshold is additionally assigned, for example, 2 points. In certain embodiments, the secondary structure score of the present invention is the sum of the number of secondary structures and the stability score as a total score. The lower the total score, the more favorable it is.

[0065] In the present invention, the BLAT check as a screening indicator in step (2) refers to performing homology comparison between a fixed-length fragment and a nucleic acid to be tested or a target nucleic acid, such as a nucleic acid sequence of a common human infectious pathogen, and treating sequences with a comparison score (score value) below a threshold as sequences with no homology. Conversely, homology exists and thus needs to be deleted.

[0066] Step (2):

[0067] Step (2) of the present invention includes obtaining a tag oligonucleotide having the tag sequence, connecting it to a vector as a template, designing candidate primers and probes for the tag oligonucleotide, constructing an amplification reaction system to further screen the primers and probes, and obtaining primers and probes for detection.

[0068] In the present invention, the tag oligonucleotide refers to a short nucleic acid molecule or fragment having the tag sequence shown in step (2) obtained by known means such as artificial synthesis. The tag oligonucleotide is connected to a vector and used as an amplification template. The specific connection method is not limited and can be connected using any method known in the art. Candidate primers and probes for the tag oligonucleotide are designed using known means. The candidate primers and probes are usually in multiple groups, so that the optimal combination is screened by the following amplification reaction. The design of the candidate primers or probes here is carried out in a conventional manner.

[0069] In the present invention, the amplification reaction system refers to a system for verifying the amplification effect, which generally includes a background signal reaction system and a simulation reaction system. In the present invention, the background signal reaction system uses a reaction system containing a bovine serum albumin (BSA) matrix, wherein the concentration of bovine serum albumin is not limited, as long as it is an appropriate concentration that can effectively reduce non-specific background signals. Its exemplary concentration is 10% or less, such as 8%, 6%, 5%, 4%, 3%, 2%, etc. 5% BSA can reduce the interference of non-specific background signals and is therefore preferred. The simulation reaction system of the present invention comprises negative plasma (i.e., plasma does not contain nucleic acids of common blood-borne pathogens) as a matrix to better simulate the complex environment of clinical or real samples. The matrices in the background signal reaction system and the simulation reaction system of the present invention can be used to perform gradient dilution of the template. The background signal reaction system and the simulation reaction system of the present invention may further comprise a template, a primer and a probe.

[0070] In the present invention, the performance of the method or the tag oligonucleotide and its primers and probes is verified by comparing the amplification effects obtained by the background signal reaction system and the simulation reaction system.

[0071] Step (3):

[0072] Step (3) of the present invention is to obtain a quality control label oligonucleotide based on the performance of the amplification reaction system. The performance of the amplification reaction system includes comprehensive evaluation of amplification efficiency, comparison of BSA and plasma matrices, and product specificity.

[0073] The performance of the amplification reaction system of the present invention is achieved through the combined efforts of the quality control tag oligonucleotide, its primers, and its probe. Therefore, the performance of the amplification reaction system not only enables the screening of optimal quality control tag oligonucleotides, but also allows the generation of an optimal reaction system based on these quality control tag oligonucleotides, which in turn serves as the optimal system for subsequent testing. From this perspective, the method for preparing the quality control tag oligonucleotide of the present invention can also be understood as a method for establishing a quality control testing system.

[0074] [Quality Control Labeled Oligonucleotides]

[0075] The second aspect of the present invention provides a quality control label oligonucleotide, which is prepared by the method described in the first aspect.

[0076] In the present invention, the term "quality control tag oligonucleotide," sometimes referred to as the "tag oligonucleotide of the present invention," refers to a short nucleotide sequence that is introduced into a standard or quality control sample of a nucleic acid to be tested as a tag to distinguish the nucleic acid to be tested. The length of the tag oligonucleotide of the present invention is not limited, but is generally 50-500 bp, for example, in the range of 60-550 bp, 70-500 bp, 80-450 bp, 90-400 bp, 100-350 bp, 105-300 bp, 110-250 bp, 115-200 bp, or 120-150 bp.

[0077] [Detection reagents or kits]

[0078] The third aspect of the present invention provides a detection reagent or kit comprising a template, primers, and probes, and optionally a reaction solution and an enzyme mix, wherein the template comprises the quality control tag oligonucleotide described in the second aspect of the present invention.

[0079] In the present invention, the template refers to the substrate used to amplify the quality control tag oligonucleotide, which is generally a nucleic acid molecule comprising the quality control tag oligonucleotide and a vector. The specific form of the vector is not limited, and includes but is not limited to a plasmid. Any known plasmid can be used. The template is generally obtained by ligating the synthesized tag oligonucleotide obtained by screening to a vector. The means for ligating nucleic acid molecules are known in the art, and reference can be made to published publications such as the fourth edition of Cold Spring Harbor Laboratory Manual, Molecular Cloning.

[0080] In the present invention, primers and probes generally refer to the optimal primers and probes obtained after screening by the preparation method described in the first aspect.

[0081] The reagents or kits of the present invention may include, in addition to the labeling oligonucleotides and primers and probes therefor, precautions related to regulating the manufacture, use, or sale of diagnostic kits in a manner prescribed by governmental agencies. In addition, the kits of the present invention may be provided with detailed instructions for use, storage, and troubleshooting. The kits may also be optionally provided in an apparatus suitable for robotic manipulation, preferably in a high-throughput setting.

[0082] In certain embodiments, the components of the reagent or kit of the present invention (e.g., standard oligonucleotides and primers thereof, probes, etc.) can be provided as dry powders. When the reagent and / or component are provided as dry powders, the powder can be restored to its original state by adding a suitable solvent. It is expected that the solvent can also be arranged in another container. The container will typically include at least one vial, test tube, flask, bottle, syringe and / or other container means, in which the solvent is optionally placed in equal parts. The kit may also include a means for containing a second container of sterile, pharmaceutically acceptable buffer and / or other solvents.

[0083] In certain embodiments, the components of the reagents or kits of the present invention may be provided in solution form, such as an aqueous solution. In the case of aqueous solutions, the concentrations or amounts of these components can be readily determined by those skilled in the art based on individual needs. For example, for storage purposes, the concentration of an oligonucleotide, for example, may be higher, and when in working order or use, the concentration may be reduced to a working concentration by, for example, diluting the higher concentration solution.

[0084] The reagent or kit of the present invention may further comprise other reagents or components. For example, DNA polymerase, various dNTPs and ions such as Mg required for PCR 2+ These other reagents or components are known to those skilled in the art and can be easily obtained through publications such as the fourth edition of Molecular Cloning Laboratory Manual published by Cold Spring Harbor.

[0085] In the case where there is more than one component in the reagent or test kit of the present invention, the reagent or test kit will also typically comprise a second, third or other additional container that can be used to place additional components separately. Additionally, the combination of various components can be included in the container.

[0086] Reagent or test kit of the present invention can also include components that keep or maintain DNA, such as reagents that resist nucleic acid degradation. Such components can be, for example, nucleases that are free of RNase or have the protection of RNase resistance. Any composition or reagent described herein can be a component in the test kit.

[0087] [use]

[0088] A fourth aspect of the present invention provides the use of quality control labeled oligonucleotides as pathogen nucleic acid standard substances or quality control products.

[0089] In certain embodiments, the present invention is used to standardize different products. By incorporating the screened oligonucleotide tag sequences into nucleic acid standards or quality control materials for different pathogens, this approach effectively addresses the varying efficiency of different manufacturers' test reagents for different pathogens, enabling standardized, comparable, and traceable product lines and facilitating the optimization of pathogen detection systems. Furthermore, it effectively identifies false positive results caused by contamination of negative samples by positive quality control materials.

[0090] In certain embodiments, the application of the present invention is to solve the problem of different detection efficiencies of detection reagents for different pathogens. For example, a pseudovirus containing a tag sequence RNA, dengue virus (DENV), Zika virus (ZIKV), and chikungunya virus (CHIKV) (four nucleic acid fragments are constructed in an RNA sequence at a ratio of 1:1:1:1) is diluted with negative plasma and then nucleic acid is extracted. The collected eluate is used as a template for the final amplification. Three triple detection kits (capable of simultaneously detecting ZIKV, DENV, and CHIKV) and a tag sequence RNA detection method are used to detect ZIKV, DENV, CHIKV, and the tag sequence, respectively.

[0091] In certain embodiments, the present invention is used to address the problem of varying detection efficiencies of different detection reagents for the same pathogen. For example, a pseudovirus containing a tag sequence RNA and a Zika virus (ZIKV) sequence (two nucleic acid fragments constructed in a single RNA sequence at a 1:1 ratio) is diluted with negative plasma and then nucleic acid extracted. The collected eluate serves as the template for the final amplification. A ZIKV detection kit and the resulting tag sequence RNA detection method are then used to detect the ZIKV and tag sequences, respectively.

[0092] In certain embodiments, the application of the present invention is to solve the contamination problem caused by positive quality control. For example, the label oligonucleotide sequence of the present invention can be added as a unique contamination monitoring sequence to the pathogen sequence to be tested contained in the currently commonly used positive quality control product to form a new anti-contamination quality control product. When the test result of the sample to be tested is positive, if there is doubt about the result and a re-examination is required, the sample is tested again using the detection method of the present invention. When the label sequence result is negative, it indicates that the positive result of the sample to be tested is a true positive; when the label sequence result is positive, it indicates that the positive quality control product has been mixed into the sample to be tested, causing contamination, and the sample needs to be re-taken for testing.

[0093] Example 1

[0094] 1. Generation and screening of oligonucleotide tag sequences

[0095] 1. Automatically generate oligonucleotide sequences

[0096] First, use the online tool sequence to generate the website http: / / www.detaibio.com / sms2 / randomdna.html A total of 50 200 bp oligonucleotide sequences were randomly generated.

[0097] 2. Screening of randomly generated oligonucleotide sequences

[0098] 2.1 Preliminary screening

[0099] The 50 oligonucleotide sequences generated above were screened in a preliminary round, and the screening conditions were as follows:

[0100] (1) GC content screening: GC content is between 45% and 55%;

[0101] (2) Enzyme cleavage site check: No enzyme cleavage site or few enzyme cleavage sites will not affect the subsequent insertion of the vector;

[0102] (3) Pathogen homology comparison: The obtained oligonucleotide sequences were BLAST compared using the Nucleotide BLAST module of the NCBI online tool https: / / blast.ncbi.nlm.nih.gov / Blast.cgi and screened based on the output. The comparison results were required to show no homology with the nucleic acid sequences of common human infectious pathogens.

[0103] Results of one round of screening: After the first round of screening, the following four sequences are left to be selected, which are recorded as tag sequences A, B, C, and D respectively.

[0104] Tag sequence A.>random sequence 44consisting of 200 bases.(no enzyme cutting site)

[0105] ggactctacttgtaaactcaataacgtctttcctacagggtctgtcgcgctttatcgttat

[0106] ccatagtcttcgcggagtcggctgagctactggctttgactaaaccagttagacttggct

[0107] aaccacccgtcaacacttcggatgaactctttatgagagatagttaatgaacgcacggag

[0108] gacttgtcttccggtgtata(SEQ ID NO.1)

[0109] Tag sequence B.>random sequence 45consisting of 200 bases. (no enzyme cutting site)

[0110] cttatagcgtaagcacatcgtagttctacccggtctgaaaaagccagcaattcgtagatt

[0111] cgagagcaaccctaaacaagccatgccgctggagggcatcttagaacctaatgggggctt

[0112] atggacgccactacgcgaagtctaccctgggcaaggggtcaactcgaagcctgcttcgag

[0113] ctggtcacactcaccacgac(SEQ ID NO.2)

[0114] Tag sequence C.>random sequence 35 consisting of 200 bases.(Apal1)

[0115] gctcacgtctgcgagacacctacatccgtgtgagcgtatgtgagtcggcctacgaaccct

[0116] attacgctgatctaagcactgctagatcactagggtaacccgttgggacttgggatttat

[0117] [[ID=十八]]tataatacttgcgtgcacgagcatttactcctaaaaagtgggtcttcttagatgtgcagg

[0118] ttagacaggctgtctgcgat(SEQ ID NO.3)

[0119] Tag sequence D.>random sequence 36 consisting of 200 bases.(Bal1)

[0120] ctttgcctcaccgcaatctaaatgtcgggaaaggacgacctgcgcctcaccaggcgctaa

[0121] attcaacaaggcatccgcttactggggatatatggccacaatttgatggactcagtcggg

[0122] cttttaggctctcatccattctgtggtaaactgcgtatttagaggcttaccttccttcta

[0123] aggagtcgtcacgcattcgc(SEQ ID NO.4) It should be noted that there is an error in the "[[ID"十八" in your original text, which should be "". I have corrected it in the translation.

[0124] 2.2 Shift Alignment

[0125] To further screen for the optimal tag sequence, a second round of screening was performed using shift alignment: 20-bp fragments of each tag sequence were selected from the first base for further screening. Each time a 20-bp fragment was selected, the starting base position was shifted back 5 bp, and this process was repeated until the starting base could not be moved further back.

[0126] The second round of screening conditions are as follows: for each 20 bp fragment

[0127] (1) GC content screening: GC content ≤ 70%;

[0128] (2) Tm value screening: Tm value is between 40℃-70℃;

[0129] (3) Secondary structure scoring screening: When an oligonucleotide has an internal complementary sequence, it is possible to form an intramolecular secondary structure or an intermolecular secondary structure according to the principle of base complementary pairing. Common secondary structures include stem-loop structures (or hairpin structures) and dimer structures. The simpler the secondary structure, the more conducive it is to the hybridization of the oligonucleotide. Therefore, in order to screen for those with simpler secondary structures, all 20bp fragments obtained by shift alignment of each candidate sequence were analyzed using Primer Premier5 software. In order to make the screening more intuitive, the present invention introduces a scoring system: each time a hairpin structure or dimer structure appears, a point is manually assigned.

[0130] The stability of the secondary structure is also very important. There are many factors that affect the stability of the secondary structure, and the free energy ΔG value is usually used to measure it. This value reflects the relative stability of the base pairs inside the double-stranded structure. The smaller the free energy, the more stable the structure, especially the secondary structure, and the less conducive it is to hybridization. The present invention limits the free energy of the inevitable secondary structure to above -4.5kcal / mol. If the free energy ΔG of the secondary structure of the shift comparison fragment, including the hairpin structure and the dimer structure, is negative and the absolute value is >4.5, it indicates that the secondary structure formed by the fragment is very stable and not conducive to hybridization, and an additional 2 points are assigned.

[0131] Finally, the scores are added together and the total score is calculated. The lower the score, the simpler the secondary structure.

[0132] (4) BLAT check: Check whether there is homology with the nucleic acid sequences of common human infectious pathogens: Use the online tool https: / / genome.ucsc.edu / cgi-bin / hgBlat to perform BLAT comparison, and select score 20 as the threshold. When the score is above 20, it is considered that there is homology, and when the score is less than 20, it is considered that there is no homology with the genome to be compared.

[0133] Results of the second-round screening:

[0134] (1) GC content screening: There is a 20-bp fragment in Sequence D with a GC content > 70% (cgacctgcgcctcaccaggc, GC content is 75%), so it is excluded first.

[0135] (2) Tm value screening: The Tm value range of all 20-bp fragments of Sequence A is 40°C - 66°C; the Tm value range of all 20-bp fragments of Sequence B is 50°C - 70°C; the Tm value range of all 20-bp fragments of Sequence C is 42°C - 61°C. Therefore, the Tm values of all 20-bp fragments of the three candidate tag sequences A, B, and C all meet the conditions, and no candidate sequence is excluded based on the Tm value.

[0136] (3) Secondary structure scoring screening: As shown in Table 1, among the 37 20-bp fragments of Sequence A, 16 have hairpin structures, and among them, 1 has a negative ΔG value with an absolute value > 4.5; 28 have dimer structures, and among them, 23 have negative ΔG values with an absolute value > 4.5. Finally, the score of candidate sequence A is 92 points; among the 37 20-bp fragments of Sequence B, 21 have hairpin structures, and among them, 2 have negative ΔG values with an absolute value > 4.5; 32 have dimer structures, and among them, 25 have negative ΔG values with an absolute value > 4.5. Finally, the score of candidate sequence B is 107 points; among the 37 20-bp fragments of Sequence C, 27 have hairpin structures, and among them, 0 have negative ΔG values with an absolute value > 4.5; 34 have dimer structures, and among them, 28 have negative ΔG values with an absolute value > 4.5. Finally, the score of candidate sequence C is 117 points; thus, the order of scores from low to high is A < B < C. Therefore, first further exclude candidate sequences B and C with a relatively large number of sequences with complex secondary structures.

[0137] Table 1: Secondary structure scoring table for candidate tag sequences A, B, and C

[0138]

[0139] (4) BLAT check: After aligning the 37 20-bp fragments of Sequence A, it is found that each 20-bp fragment has no cross with the nucleic acids of common human infectious pathogens (scores are all < 20), meeting the requirements, so there is no need to return to the previous level to select the sequence with the second-lowest score.

[0140] Therefore, finally, tag sequence A is selected as the oligonucleotide sequence finally adopted in the present invention, and the full length of the sequence is as follows:

[0141] ggactctacttgtaaactcaataacgtctttcctacagggtctgtcgcgcttatcgttatccatagtcttcgcggagtcggctgagctactggctttgac taaaccagttagacttggctaaccacccgtcaacacttcggatgaactctttatgagagatagttaatgaacgcacggaggacttgtcttccggtgtata

[0142] 2. Establishment and Optimization of Tag Sequence Amplification Reaction System

[0143] 1. Screening of tag sequence primers and probes

[0144] Based on the tag sequences obtained through multiple screenings using the above stringent screening conditions, four pairs of upstream and downstream primers and six corresponding probes were designed using Oligo7 software and screened from both Tm values ​​and scores automatically calculated by the software, as shown in Tables 2 and 3.

[0145] Table 2: Primers to be selected for the tag sequence detection system

[0146]

[0147] Table 3: Probes for tag sequence detection system

[0148]

[0149] The final selected tag sequence was ligated into the MMLV-based pQCXIG plasmid, with the tag sequence designated "Label" to create the pQCXIG-Label plasmid. Using this plasmid as a template, amplification and screening were performed using the aforementioned primer and probe combinations.

[0150] (1) Screening primers

[0151] Initially, the pQCXIG-Label plasmid was quantified spectrophotometrically. Using a matrix similar to that used for detecting blood-borne pathogens, the template was serially diluted using 5% bovine serum albumin (BSA) and negative plasma, respectively. 5% BSA was used because it reduces nonspecific background signal interference and serves as a relatively simple and stable matrix for evaluating the detection performance of the pure template under ideal conditions. Dilutions using negative plasma better simulate the complex environment of clinical or real-world samples, allowing evaluation of the detection system's performance under conditions close to those of actual samples. Consistent amplification results after serial dilutions using these two matrices indicate a robust detection method. Except for the primer screening assay, where primers were diluted and compared using both 5% BSA and negative plasma, all other template dilutions were performed using negative plasma to better simulate the real-world environment of samples containing blood-borne pathogens.

[0152] Use highly specific qPCR reagents for TB Premix Ex Taq TM II (Tli RNaseH Plus) (Manufacturer: Takara, Catalog No.: RR820B) was used to perform amplification using the dye method with each of the four primer pairs. A comprehensive evaluation was conducted based on amplification efficiency, comparison between BSA and plasma matrices, and product specificity.

[0153] The results are shown in Tables 4 and 5. First, in terms of amplification efficiency, primer pair 1 and primer pair 3 achieved amplification efficiencies within the recommended range of 90%-110%, regardless of whether they were diluted with BSA or negative plasma, indicating relatively good results. Second, in terms of comparison between BSA and plasma matrices, primer pair 1 and primer pair 3 achieved relatively small differences in CT values ​​after amplification of the same template diluted with BSA or negative plasma, respectively, indicating relatively good results. Finally, in terms of product specificity, primer pair 3 achieved the best results, with uniform melting curves and identical Tm values ​​for products amplified with different template concentrations.

[0154] Overall, only primer pair 3 showed completely overlapping melting curves and identical Tm values ​​for products amplified at different template concentrations, indicating homogeneous products. Furthermore, there was no significant difference in Ct values ​​between the BSA and plasma groups, with amplification efficiencies ranging from 90% to 110%. Therefore, primer pair 3 was selected for inclusion in the final system.

[0155] Table 4: CT value results and amplification efficiency of the selected primers for the tag sequence 4

[0156]

[0157] Table 5: Tm values ​​(°C) of the amplification products of the four tag sequences for the selected primers

[0158]

[0159] (2) Screening probes

[0160] Since the most suitable primer pair 3 has been screened in the previous step, the final product size is 109 bp, and the range of probes to be selected is also limited to P1, P2 and P3. Figure 4 Primer pair 3 and its candidate probe are shown.

[0161] After gradient dilution of the template using negative plasma, the system primer pair 3 was combined with probes P1, P2, and P3 respectively, and the probe method qPCR reagent Premix Ex Taq TM Amplification was performed using Probe qPCR (Manufacturer: Takara, Catalog No.: RR390B). The results are shown in Table 6. Probe P2 had the lowest CT value and the best performance. Therefore, Probe P2 was selected for inclusion in the final system.

[0162] Table 6: CT value results of the selected probe amplification of the tag sequence

[0163]

[0164] (3) Final concentration of screening primers and probes

[0165] After gradient dilution of the template using negative plasma, final primer concentrations of 0.2μM, 0.4μM, and 0.6μM and probe concentrations of 0.1μM, 0.3μM, and 0.6μM were selected for permutation and amplification using 2× Eagle Premix (PCR) reaction solution (Brand: Beijing Jinnuomei, Catalog No.: SJ-PCR002). A comprehensive evaluation was conducted based on amplification results, curve fitting, and amplification efficiency.

[0166] The results are as follows Figure 5 As shown in Table 7. Based on the height of the amplification curve, the combination of a final primer concentration of 0.6 μM and a final probe concentration of 0.3 μM has an appropriate signal value, a relatively high CT value, a high amplification efficiency (99.38%, within the range of 90%-110%), and a good linearity of the fitting curve (R 2 =0.9983), so a combination of a primer final concentration of 0.6 μM and a probe final concentration of 0.3 μM was selected and added to the final system.

[0167] Table 7: Fitting curve coefficients and R for different primer-probe combinations 2 , amplification efficiency

[0168]

[0169] (4) Screening annealing temperature

[0170] After fixing the concentrations of primers and probes, the annealing temperature was further screened: a temperature gradient was set between 56°C and 64°C: 56°C, 58°C, 60°C, 62°C, and 64°C as the annealing temperature to be screened. According to the final concentrations of the primers and probes fixed above, the template that had been gradient diluted with negative plasma was amplified using 2×Eagle Premix (PCR) reaction solution (brand: Beijing Jinnuomei, item number: SJ-PCR002). The results are shown in Table 8. From the perspective of the fitting curve and amplification efficiency, when the system annealing temperature was 62°C, the linearity of the fitting curve and the amplification efficiency were both good (R 2 =0.987, the amplification efficiency is 105.076%, between 90% and 110%). Therefore, the final annealing temperature of the system is selected to be 62°C.

[0171] Table 8: Fitting curve coefficients and R at different annealing temperatures 2 , amplification efficiency

[0172]

[0173]

[0174] After a series of screening, primer pair 3 and probe P2 were finally selected and added to the final amplification reaction system with an annealing temperature of 62°C.

[0175] 2. Establishment of the tag sequence detection system

[0176] After screening the primer and probe concentrations and annealing temperature of the detection system as described above, in order to improve the sensitivity of the final reaction system, the final optimized tag sequence detection system uses 5×Eagle Buffer reaction solution and 5×Eagle enzyme mix solution (Brand: Beijing Jinnuomei, Catalog Number: SJ-PCR026), which contains all the components required for the amplification reaction except primers, Taqman probes, and templates. According to the 50uL system, the primers, probes, 5×Eagle Buffer reaction solution, and 5×Eagle enzyme mix solution of the tag sequence are added to the same tube PCR system as shown in Table 9, and the sample to be tested is amplified. (The detection system and amplification reaction conditions used for DNA and RNA are the same).

[0177] Table 9: Tag sequence detection system (for one person)

[0178]

[0179] The experimental reaction conditions are:

[0180]

[0181] 3. Performance Verification of the Tag Sequence Amplification Reaction System

[0182] After connecting different pathogen sequences to an expression vector containing a tag sequence through methods such as homologous recombination, pseudovirus particles containing RNA tag sequences and pseudovirus particles containing DNA tag sequences can be obtained through cell culture or in vitro preparation, which can be used for standardization and contamination monitoring of nucleic acid detection of pathogens with RNA as the genome and nucleic acid detection of pathogens with DNA as the genome, respectively.

[0183] This example validated the sensitivity (LOD), precision, and specificity of the detection methods for both tagged RNA and tagged DNA. The results showed that both the tagged RNA and tagged DNA detection methods had good sensitivity (LOD of 8.268 copies / mL, 95% CI (6.265, 13.117) and 4.991 copies / mL, 95% CI (3.267, 10.578), respectively) and precision (within-laboratory and inter-assay coefficients of variation less than 2%), and showed no cross-reactivity with common pathogens.

[0184] 1. Nucleic Acid Extraction

[0185] This example uses blood-borne pathogens as an example. To simulate the situation of real samples of blood-borne pathogens, negative plasma was used to dilute pseudovirions containing tag sequence RNA and pseudovirions containing tag sequence DNA. After nucleic acid extraction, amplification detection was performed. Extraction was performed using a nucleic acid extraction kit (manufacturer: Suzhou Xinbo Biotechnology Co., Ltd.): 1.2mL of sample was pretreated in a 2mL centrifuge tube, 15μL of proteinase K and 10μL of polyA were added in sequence, and the mixture was shaken and extracted using an EZbead System-32 nucleic acid extraction instrument. After processing with extraction solution, wash solution A, and wash solution B, 100uL of nucleic acid template was finally eluted.

[0186] 2. Performance Verification of Tag Sequence RNA Detection Method

[0187] (1) Sensitivity (LOD)

[0188] Pseudovirus particles containing tag sequence RNA were collected and quantified using digital PCR (stock concentration: 1.5×10 5Serial dilutions were performed using negative plasma, ultimately yielding pseudovirion samples with concentrations ranging from 1.5 copies / mL to 18.75 copies / mL. The eluate obtained after nucleic acid extraction served as the final template for testing. Testing was repeated 7-8 times daily for three consecutive days. The specific test results are shown in Table 10. The test results were analyzed using the probit method to determine the specific LoD value.

[0189] Table 10: Original results of the lowest detection limit (LOD) of the tag sequence RNA detection method

[0190]

[0191] After calculating the number of detections and the total number at the corresponding concentration, the data were imported into SPSS and analyzed using SPSS. The final analysis showed that the LoD of the tag sequence RNA was 8.268 copies / mL, with a 95% CI of (6.265, 13.117). The corresponding Probit curve is shown as follows: Figure 6 shown.

[0192] (2) Precision

[0193] Pseudoviral particles containing RNA with tag sequence that had been quantified by digital PCR (stock concentration: 1.5×10 5 Precision was verified using negative plasma diluted to 300 copies / mL and 30 copies / mL as high- and low-concentration samples, respectively. All samples were tested for three consecutive days, with five experiments performed daily. Intra- and inter-assay precision was calculated within the laboratory. The results showed that both intra- and inter-assay precision were less than 2% for both high and low concentrations.

[0194] Table 11: Precision results of tag sequence RNA detection method

[0195]

[0196] (3) Specificity

[0197] Using pseudovirus particles containing tag sequence RNA as samples, negative plasma was diluted and extracted, and then amplified using other common pathogen kits and tag sequence RNA detection systems. The results are as follows Figure 7 The results show that except Figure 7 Aside from the specific amplification of the F tag sequence, all other pathogens, including hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), dengue virus (DENV), and chikungunya virus (CHIKV), showed negative results. This demonstrates that the tag sequence RNA detection method has high specificity and no cross-reactivity with other common pathogens.

[0198] 3. Performance Verification of Tag Sequence DNA Detection Method

[0199] (1) Sensitivity (LOD)

[0200] Pseudovirus particles containing tag sequence DNA were collected and quantified using digital PCR (stock concentration: 2×10 8 Serial dilutions were performed using negative plasma, ultimately yielding pseudovirus samples with concentrations ranging from 0.50 copies / mL to 12.50 copies / mL. The eluate obtained after nucleic acid extraction served as the final template for testing. Testing was repeated 6-7 times daily for three consecutive days. The specific test results are shown in Table 12. The test results were analyzed using the probit method to determine the specific LoD value.

[0201] Table 12: Original results of the lowest detection limit (LOD) of the tag sequence DNA detection method

[0202]

[0203]

[0204] After calculating the number of detections and the total number at the corresponding concentration, the data were imported into SPSS and analyzed using SPSS. The final analysis showed that the LoD of the tag sequence DNA was 4.991 copies / mL, with a 95% CI of (3.267, 10.578). The corresponding Probit curve is shown as follows: Figure 8 shown.

[0205] (2) Precision

[0206] Pseudoviral particles containing tag sequence DNA (stock concentration: 2×10 8 Precision was verified using negative plasma diluted to 500 copies / mL and 50 copies / mL as high- and low-concentration samples, respectively. All samples were tested for three consecutive days, with five experiments performed daily. Intra- and inter-assay precision was calculated within the laboratory. The results showed that both intra- and inter-assay precision were less than 2% for both high and low concentrations.

[0207] Table 13: LOD analysis precision results of the tag sequence DNA detection method

[0208]

[0209] (3) Specificity

[0210] Using pseudovirus particles containing tag sequence DNA as samples, negative plasma was diluted and extracted, and then amplified simultaneously using other common pathogen kits and tag sequence DNA detection systems. The results are as follows Figure 9 The results show that except Figure 9 Aside from the F tag sequence, which produced specific amplification, other pathogens, including hepatitis B virus (HBV), hepatitis D virus (HDV), human T-lymphotropic virus (HTLV), Anaplasma, and Babesia, all showed negative results. This demonstrates that the tag sequence DNA detection method has high specificity and no cross-reactivity with other common pathogens.

[0211] Example 2

[0212] This embodiment provides an example of the application of randomly generated oligonucleotide tag sequences and detection methods thereof.

[0213] The introduction of randomly generated oligonucleotide tag sequences into nucleic acid standard substances or quality control products of different pathogens can effectively solve the problem of different detection efficiencies of detection reagents from different manufacturers for different pathogens, making the product series standardized, comparable and traceable, and helping to optimize the pathogen detection system; at the same time, it can effectively solve the problem of false positive results caused by contamination of negative samples by positive quality control products and effectively identify them.

[0214] 1. Randomly generated oligonucleotide tag sequences can be used to address the problem of different detection efficiencies of detection reagents for different pathogens

[0215] Pseudoviruses containing the tag sequence RNA, dengue virus (DENV), Zika virus (ZIKV), and chikungunya virus (CHIKV) (four nucleic acid fragments constructed in a single RNA sequence at a ratio of 1:1:1:1) were diluted with negative plasma and then subjected to nucleic acid extraction. The collected eluate served as the template for the final amplification. Three triple-test kits (capable of simultaneously detecting ZIKV, DENV, and CHIKV) and the tag sequence RNA detection method established in this example were used to detect ZIKV, DENV, CHIKV, and the tag sequence, respectively. The experiment was repeated three times.

[0216] The specific test results are shown in Table 14 and Figure 10As shown. Theoretically, when the four fragments are connected together at a ratio of 1:1:1:1, the concentrations of the different fragments in the same sample are exactly the same, and the CT values ​​should also be the same. However, it was found that when the three different pathogens, ZIKV, DENV, and CHIKV, were detected using the same test kit, the CT values ​​were all different, indicating that the test kit's detection efficiency for these three pathogens was not completely consistent. The introduction of the tag sequence in this embodiment can help optimize the reagent to have the same detection efficiency when detecting different pathogens (such as the difference between the CT values ​​detected by the tag sequence is basically the same), thereby effectively solving this problem. In addition, when using primers and probes in different detection methods to perform digital PCR absolute quantitative detection on different pathogens, the difference in absolute quantitative results will also be caused by the difference in amplification efficiency, thereby making the authenticity and reliability of the quantitative results questionable. After the tag sequence obtained in Example 1 is inserted into the target sequence and connected 1:1, when the pseudovirus containing nucleic acids of different pathogens is quantified, only the primers and probes in the tag sequence detection method are used for absolute quantitative detection, ultimately making the quantitative results of different pathogens more accurate and more comparable.

[0217] Table 14: Detection results of reagents 1, 2, 3 and tag sequences

[0218]

[0219] 2. Randomly generated oligonucleotide tag sequences are used to address the differences in detection efficiency of different detection reagents for the same pathogen

[0220] A pseudovirus containing both the tag sequence RNA and the Zika virus (ZIKV) sequence (the two nucleic acid fragments were constructed in a single RNA sequence at a 1:1 ratio) was diluted with negative plasma and then subjected to nucleic acid extraction. The collected eluate served as the template for the final amplification. ZIKV and tag sequence detection were performed using a ZIKV detection kit and the tag sequence RNA detection method established in Example 1, respectively.

[0221] The specific test results are shown in Table 15 and the scatter plot Figure 11 As shown. Theoretically, different reagents should produce similar results when testing the same sample. However, when using reagents 1, 2, 3, and 4 to test equal amounts of ZIKV, the CT values ​​obtained by each reagent varied significantly. The introduction of a tag sequence in Example 1 can help identify differences in detection efficiency between different reagents for the same pathogen, thereby facilitating better reagent optimization.

[0222] Table 15: Results of ZIKV and tag sequence detection by reagents 1, 2, 3, and 4

[0223]

[0224] 3. Randomly generated oligonucleotide tag sequences can be used to resolve contamination issues caused by positive quality control

[0225] In order to specifically illustrate the feasibility of applying the tag sequence and its detection method of Example 1 in the field of anti-contamination quality control products, three different groups of samples were set up: Group 1 mixed a pseudovirus containing only Zika virus RNA into negative plasma to simulate a true ZIKV nucleic acid-positive sample; Group 2 mixed a pseudovirus containing tag sequence RNA and Zika virus (ZIKV) RNA into negative plasma to simulate the situation where the positive quality control product contaminated the negative sample when it was used as a positive quality control product; Group 3 was diluted negative plasma to simulate a true negative sample.

[0226] Nucleic acid extraction was performed simultaneously on all three groups of samples. The collected eluate served as the template for the final amplification, and both the tag sequence RNA and ZIKV RNA were tested simultaneously. The results showed that both groups 1 and 2 tested positive for ZIKV, while group 3 tested negative. However, testing for the tag sequence revealed that only the group 2 tag sequence tested positive.

[0227] It can be seen from this that the tag sequence of Example 1 can be added as a unique contamination monitoring sequence to the pathogen sequence to be tested contained in the currently commonly used positive quality control product to form a new anti-contamination quality control product. When the test result of the sample to be tested is positive, if there is doubt about the result and a re-test is required, the sample is tested again using the tag sequence detection method established in Example 1. When the tag sequence result is negative, it indicates that the positive result of the sample to be tested is a true positive; when the tag sequence result is positive, it indicates that the positive quality control product has been mixed into the sample to be tested, causing contamination, and a new sample needs to be taken for testing.

[0228] Table 16: Different groups of tag sequences and ZIKV detection results

[0229]

[0230] Although the present invention has been described with reference to exemplary embodiments, it should be understood that the invention is not limited to the disclosed exemplary embodiments. Various modifications and variations may be made to the exemplary embodiments of the present specification without departing from the scope or spirit of the present invention. The scope of the claims is to be given the broadest interpretation so as to encompass all such modifications and equivalent structures and functions.

Claims

1. Use of a quality control labeled oligonucleotide in the preparation of a pathogen nucleic acid standard substance or a quality control product, characterized in that: The sequence of the quality control tag oligonucleotide is as follows: ggactctacttgtaaactcaataacgtctttcctacagggtctgtcgcgcttatcgttatccatagtcttcgcggagtcggctgagctactggctttgactaaaccagttagacttggctaaccacccgtcaacacttcggatgaactctttatgagagatagttaatgaacgcacggaggacttgtcttccggtgtata.

2. The use according to claim 1, characterized in that The pathogen nucleic acid standard substance or quality control product is used for: Used to standardize different products and make them comparable and traceable; Used to compare the detection efficiency of the same detection reagent for different pathogens; To compare the detection efficiency of different detection reagents for the same pathogen; or Used to detect whether the sample to be tested is mixed with the positive quality control material.

3. A detection reagent or kit, characterized in that: The detection reagent or kit comprises a template, a primer and a probe, and the template comprises the quality control label oligonucleotide according to claim 1.

4. The detection reagent or kit according to claim 3, characterized in that The detection reagent or kit further comprises a reaction solution and an enzyme mixture solution.

Citation Information

Patent Citations

  • Quality control method of library tag primer and application thereof

    CN114807309A

  • Quality control product and kit for parallel detection of tag primer sequences

    CN116377046A