A primer and probe set, kit, and detection method for detecting gray mold pathogen in leeks based on real-time quantitative PCR.

Abstract

This invention relates to gene detection technology and provides a primer and probe set for detecting the pathogenic microorganism of gray mold in leeks based on quantitative real-time PCR, including primer HMB-F, primer HMB-R, and probe P; wherein the sequence of primer HMB-F is: 5'AAACTCGACCGCAGACATATT3'; the sequence of primer HMB-R is: 5'ACCTTGTTAGCTGGCATGAG 3'; and the sequence of probe P is: 5'FAM-CATGAAGACTCGGGTGCGGATAATGG-BHQ 3'. This invention also provides a detection method for the pathogenic microorganism of gray mold in leeks based on quantitative real-time PCR. The advantage of this invention is that it can detect the presence and quantity of the pathogen at an early stage of gray mold in leeks, facilitating early intervention and early warning of gray mold.

Description

Technical Field

[0001] This invention relates to gene detection technology, and more particularly to a primer and probe set, kit, and detection method for detecting gray mold pathogens in leeks based on quantitative real-time PCR. Background Technology

[0002] Leeks (Allium tuberosum Rottl. ex Spreng.) are perennial herbaceous plants belonging to the Liliaceae family, possessing a distinctive and strong aroma. Their rhizomes are horizontal, and their bulbs are narrowly conical and clustered; the outer skin of the bulbs is yellowish-brown and reticulate-fibrous; the leaves are basal, linear, and flat; the inflorescence is an umbel, terminal. Leeks are a high-yield vegetable, with my country producing approximately 20 million tons annually, generating substantial economic value.

[0003] However, chives are susceptible to fungal infections, leading to gray mold. Gray mold, also known as white spot disease or white leaf blight, is caused by *Botrytis squamosa* Walker. It primarily affects the leaves and is a major disease affecting chives grown in greenhouses. Once infected, it often causes the chive leaves to wither, rot, and become moldy, resulting in yield losses of over 30% in severe cases.

[0004] Currently, the main method for treating gray mold in chives relies on visual observation. While experienced growers can easily detect gray mold with the naked eye, there are no effective methods for identifying the pathogen at the molecular level or for early intervention and warning during plant protection. Often, the disease can only be detected after a large-scale outbreak caused by *Scallion gray mold*. This not only leads to a significant reduction in chive yield but also affects the quality of the chives. When gray mold is severe, only more drastic plant protection measures like pesticides can be used, resulting in excessive pesticide residues and a significant decrease in quality. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a primer and probe set, kit and detection method for detecting gray mold pathogens of leeks based on real-time PCR, which can detect the presence and quantity of the pathogen in the early stage of gray mold (before the outbreak of gray mold), so as to facilitate early intervention and early warning of gray mold.

[0006] The present invention solves the above-mentioned technical problems by adopting the following technical solutions:

[0007] A primer and probe set for detecting gray mold pathogens in leeks based on quantitative real-time PCR (qPCR) includes primer HMB-F, primer HMB-R, and probe P;

[0008] The sequence of primer HMB-F is: 5'AAACTCGACCGCAGACATATT 3'; the sequence of primer HMB-R is: 5'ACCTTGTTAGCTGGCATGAG 3'; and the sequence of probe P is: 5'FAM-CATGAAGACTCGGGTGCGGATAATGG-BHQ3'.

[0009] As one of the preferred embodiments of the present invention, the primers HMB-F and HMB-R are used to amplify the specific gene sequence of *Botrytis squamosa* Walker, the main pathogen of gray mold in leeks; the specific gene sequence of *Botrytis squamosa* Walker is shown in SEQ ID NO.1.

[0010] A detection kit for gray mold pathogens in leeks based on real-time quantitative PCR, comprising the aforementioned primer and probe set.

[0011] As one of the preferred embodiments of the present invention, a fluorescent quantitative reaction solution is also included.

[0012] As one of the preferred embodiments of the present invention, the fluorescent quantitative reaction solution includes DNA polymerase, dNTPs, and Mg. 2+ Buffer solution, ROX.

[0013] As one of the preferred embodiments of the present invention, plasmid standards are also included.

[0014] As one of the preferred embodiments of the present invention, the plasmid standard is constructed by inserting a Feature 11 containing the target gene into the PUC57 plasmid using genetic engineering methods; the nucleotide sequence of the Feature 11 containing the target gene is shown in SEQ ID NO.2.

[0015] A method for detecting the pathogenic microorganism of gray mold in leeks based on real-time quantitative PCR, using the above-mentioned primer and probe set or kit, includes the following steps:

[0016] (1) Take leaves from the leek plants to be identified, grind them and extract DNA;

[0017] (2) Using the extracted DNA as a template, quantitative real-time PCR was performed using primers HMB-F, primers HMB-R and fluorescent probes;

[0018] (3) Observe and analyze the Ct value of gray mold detection in the fluorescence quantitative PCR process; when the Ct value is <37.20, it indicates that the leeks are infected with gray mold.

[0019] As one of the preferred embodiments of the present invention, in step (2), the reaction system for real-time PCR is as follows: 1 μL HotStart Taq DNA polymerase (final concentration 0.8 U / reaction), 1 μL dNTPs (final concentration 300 μM each), 0.5 μL MgCl2 / MgSO4 (final concentration 3 mM), 2.5 μL pH 8.0 buffer, 0.5 μL ROX, 1 μL primer HMB-F (final concentration 400 nM), 1 μL primer HMB-R (final concentration 400 nM), 0.5 μL probe P (final concentration 200 nM), 1 μL template, and 16 μL H2O.

[0020] As one of the preferred embodiments of the present invention, in step (2), the reaction procedure for real-time PCR is as follows: incubation at 50°C for 2 min; pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s; annealing / extension at 60°C for 30 s; 40 cycles.

[0021] As one of the preferred embodiments of the present invention, in step (3), the specific correspondence between the Ct value of gray mold detection and gray mold infection is as follows:

[0022] When 34.55 ≤ Ct value < 37.20, it indicates that the chives have a "mild" gray mold infection;

[0023] When 29.39 ≤ Ct value < 34.55, it indicates that the chives are infected with "moderate" gray mold.

[0024] When the Ct value is <29.39, it indicates that the chives are infected with "severe" gray mold.

[0025] This invention is based on probe-based qPCR. The principle is as follows: While upstream and downstream primers (primer HMB-F and primer HMB-R) guide the amplification of target DNA, a fluorescently labeled probe (probe P) binds to the middle region of the target sequence through strict complementarity. The probe is labeled with a fluorescent reporter group (FAM) and a quencher group (BHQ) at both ends, respectively. During the PCR extension phase, the 5'→3' exonuclease activity of DNA polymerase hydrolyzes the probe, causing the reporter and quencher groups to separate and release a fluorescent signal. By monitoring the fluorescence intensity changes in each round of amplification in real time, combined with the Ct value (cycle threshold), precise quantification of the target nucleic acid is achieved. Specifically, the higher the content (copy number) of the target sequence in the test sample, the smaller the Ct value corresponding to reaching the threshold; conversely, the lower the copy number of the target sequence in the test sample, the larger the Ct value corresponding to reaching the threshold.

[0026] The advantages of this invention compared to the prior art are:

[0027] (1) This invention is based on probe-based qPCR. The primer and probe set designed in this invention is used to amplify the sample to be tested, which can realize the detection of low copy molecules, thereby greatly advancing the detection of gray mold in leeks (detecting the presence and quantity of the pathogen in the early stage of gray mold disease), which facilitates early intervention and early warning of gray mold disease.

[0028] (2) This method can identify and quantify the pathogenic microorganism of gray mold in leeks simply and directly. It has the advantages of high sensitivity and strong specificity. The detection results (Ct value) can correspond to the degree of gray mold infection in leeks, which has important guiding significance for the prevention and control of gray mold in leeks. Attached Figure Description

[0029] Figure 1 This is a schematic diagram of the structure of the plasmid standard in Example 2;

[0030] Figure 2 These are actual photos of the leaves and roots of the "severely" infected plant in Experiment Example 1.

[0031] Figure 3 These are actual photos of the leaves and roots of the "moderately" infected plant in Experiment Example 1.

[0032] Figure 4 These are actual photos of the leaves and roots of the "slightly" infected plant in Experiment Example 1.

[0033] Figure 5 This is a comparison of the amplification curves of the leaf group, root group, leaf group, root group, mildly infected plant group, and negative and positive control groups of the plant in Experiment Example 1.

[0034] Figure 6 This is a comparison of the amplification curves of the nutrient solution group at the outlet, the nutrient solution group at the return outlet, the negative control group, and the positive control group in Experiment Example 1 (in the figure, CSK, HSK, NTC, and PTC represent the nutrient solution group at the outlet, the nutrient solution group at the return outlet, the negative control group, and the positive control group, respectively).

[0035] Figure 7 These are the Ct values ​​for each group in Experiment Example 1. Detailed Implementation

[0036] The embodiments of the present invention are described in detail below. These embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments. Furthermore, unless otherwise specified, the carriers, reagents, and instruments used in the following embodiments and experimental examples are all conventional carriers, reagents, and instruments in the art; the experimental methods used, unless otherwise specified, are all conventional methods in the art and will not be described further.

[0037] Example 1

[0038] This embodiment presents a primer and probe set for detecting gray mold pathogens in leeks based on real-time PCR, including primer HMB-F, primer HMB-R, and probe P.

[0039] The sequence of primer HMB-F is: 5'AAACTCGACCGCAGACATATT 3'; the sequence of primer HMB-R is: 5'ACCTTGTTAGCTGGCATGAG 3'; and the sequence of probe P is: 5'FAM-CATGAAGACTCGGGTGCGGATAATGG-BHQ3'.

[0040] The primers HMB-F and HMB-R were used to amplify the specific gene sequence (SEQ ID NO.1) of Botrytis squamosa Walker, the main pathogen of gray mold in leeks.

[0041] Example 2

[0042] This embodiment describes a detection kit for gray mold pathogens in leeks based on real-time PCR, comprising: primer HMB-F, primer HMB-R, probe P, Hot Start Taq DNA polymerase, dNTPs, MgCl2 / MgSO4, PCR buffer (pH 8.0), ROX (dye), and plasmid standards.

[0043] Primers HMB-F, HMB-R, and probe P are as shown in Example 1. Hot Start Taq DNA polymerase, dNTPs, MgCl2 / MgSO4, buffer, and ROX are commercially available products. Plasmid standards are self-made products with the following structure: Figure 1 As shown, it was constructed by inserting Feature 11 (sequence shown in SEQ ID NO.2) containing the target gene into the PUC57 plasmid as a vector through genetic engineering methods.

[0044] The specific method for constructing the plasmid standard is as follows:

[0045] Twenty-eight primers were designed based on the target nucleic acid sequence of the plasmid (see Table 1). In the first step of PCR, primers were paired to obtain PCR products containing the target nucleic acid sequence. Using these products as templates, the full-length target nucleic acid sequence (SEQ ID NO. 2) was amplified in the second step of PCR. The PCR products were recovered by gel extraction after 1% agarose gel electrophoresis. Then, the PCR products were ligated with ECORI-HINDIII-treated PUC57 plasmid (commercially available vector) using recombinase to construct a recombinant plasmid. After screening the recombinant plasmid by colony selection, the inserted fragment sequence was verified using first-generation sequencing. Successfully verified sequences became the target plasmid standard. This construction process can be outsourced to a biotechnology company.

[0046] Table 1. Primers used for plasmid standard construction

[0047]

[0048]

[0049]

[0050] The first step of the PCR reaction system is as follows:

[0051] Primers 1–28 (Table 1) (50 pmol / μL) 0.5 μL each, polymerase (pv2) 0.5 μL, 5X PV2 buffer 10 μL, 10 mM dNTP 1 μL, ddH2O Add to 50 μL.

[0052] The reaction conditions were: 95℃ for 3 min; 95℃ for 25 s, 62℃ for 20 s, 72℃ for 40 s, for 25 cycles; 72℃ for 1 min; and held at 4℃.

[0053] The second step of the PCR reaction system is as follows: template (PCR first-round product) (100ng / μL) 0.3μL, primer NJ0204996-1_1 (50pmol / μL) 0.5μL, primer NJ0204996-1_28 (50pmol / μL) 0.5μL, polymerase pv2 0.5μL, 5X PV2 buffer 10μL, 10mM dNTP 1μL, ddH2O Add to 50μL.

[0054] The reaction conditions were: 95℃ for 3 min; 95℃ for 25 s, 62℃ for 20 s, 72℃ for 40 s, for 25 cycles; 72℃ for 1 min; and held at 4℃.

[0055] Example 3

[0056] This embodiment presents a method for detecting the pathogenic microorganism of gray mold in leeks based on real-time quantitative PCR, using the gray mold pathogenic microorganism detection kit of leeks from Example 2, and includes the following steps:

[0057] (1) Take leaves from the leek plants to be identified, grind them with liquid nitrogen, and then extract their DNA using a DNA extraction kit (Yisheng Bio Bacterial / Fungal DNA Kit Magnetic Bead Method Bacterial / Fungal DNA Extraction Kit).

[0058] (2) Construct the reaction system shown in Table 2, and use the extracted DNA as a template for real-time PCR amplification. The qPCR reaction program is shown in Table 3.

[0059] Table 2. qPCR reaction system

[0060]

[0061]

[0062] Table 3. qPCR reaction procedure

[0063]

[0064] (3) Observe and analyze the Ct value of Botrytis cinerea detection during the quantitative real-time PCR process:

[0065] When 34.55 ≤ Ct value < 37.20, it indicates that the chives have a "mild" gray mold infection;

[0066] When 29.39 ≤ Ct value < 34.55, it indicates that the chives are infected with "moderate" gray mold.

[0067] When the Ct value is <29.39, it indicates that the chives are infected with "severe" gray mold.

[0068] Example 4

[0069] The method for detecting gray mold pathogens in leeks based on quantitative real-time PCR in this embodiment is basically the same as that in Example 3, except that “MgCl2” in the qPCR reaction system is replaced by “MgSO4”.

[0070] Experimental Example 1

[0071] This experiment was conducted to investigate the transmission pathways and infection cycle of Botrytis cinerea in a hydroponic leek greenhouse, and to verify the feasibility of the method of this invention.

[0072] I. Experimental Methods

[0073] First, samples were selected from the leek greenhouse. Based on the severity of gray mold lesions on the leek leaves, the samples were divided into three categories: "mild" infection, "moderate" infection, and "severe" infection. The classification criteria were as follows: a leek plant generally has 5 leaves. When sporadic gray mold spots appear on the leaves, it is considered "mild" infection; when 2-3 leaves show clustered spots or 1-2 leaves show dry tips, it is considered "moderate" infection; when 4-5 leaves show a large cluster of spots or more than 3 leaves show dry tips or some leaves show wet rot, it is considered "severe" infection. Whole plant samples (including leaves and roots) were taken for each category and grouped according to Table 4.

[0074] Table 4. Sample Grouping

[0075]

[0076] Subsequently, the leaves and roots of each group were ground, and the nucleic acids of the symbiotic microorganisms were extracted using a DNA extraction kit (Yisheng Biotechnology Bacterial / Fungal DNA Kit Magnetic Bead Method Bacterial / Fungal DNA Extraction Kit). Simultaneously, samples of each nutrient solution were also taken, and their nucleic acids were extracted (using the same DNA extraction kit).

[0077] Finally, using the extracted DNA as a template, the kit of this invention was used to perform a real-time PCR amplification reaction (using a real-time PCR instrument) to detect the content of gray mold in leaves, roots and nutrient solution (the reaction system and reaction procedure are specifically referred to in Example 3).

[0078] II. Test Results

[0079] Figure 5 Comparison of amplification curves for the leaf group of "severely" infected plants, the root group of "severely" infected plants, the leaf group of "moderately" infected plants, the root group of "moderately" infected plants, the leaf group of "slightly" infected plants, the root group of "slightly" infected plants, the negative control group, and the positive control group.

[0080] Figure 6 Comparison of amplification curves for the nutrient solution group at the outlet, the nutrient solution group at the return outlet, the negative control group, and the positive control group (in the figure, CSK, HSK, NTC, and PTC represent the nutrient solution group at the outlet, the nutrient solution group at the return outlet, the negative control group, and the positive control group, respectively).

[0081] Figure 7 The results are the Ct values ​​for each group.

[0082] III. Statistical Analysis of Results

[0083] The statistical analysis of the results is shown in Table 5.

[0084] Table 5. Results Analysis and Statistics

[0085]

[0086]

[0087] From the above results, we can conclude that:

[0088] (1) When the Ct value of gray mold on chive leaves is less than 37.20, the chives are infected with gray mold, and the leaves show obvious characteristics of gray mold infection. When the same chive is heavily infected with gray mold (the Ct value of gray mold in the leaves is 29.39), the gray mold content in the roots does not increase significantly (the Ct value of gray mold in the roots is 39.76). At the same time, the gray mold content in the circulating hydroponic nutrient solution is not detected. These results indicate that the circulating nutrient solution in hydroponic chives is not the main route of gray mold transmission, the roots are not the main parasitic site of gray mold, and the leaves are the main parasitic site of gray mold. The transmission route of gray mold among chives is mainly through the airborne transmission of bacterial spores, which causes infection of chive leaves. Therefore, when detecting gray mold in chives, chive leaves should be used as test samples.

[0089] (2) When the Ct value of gray mold on leek leaves is less than 37.20, the leek is infected with gray mold and needs to be noticed by plant protection personnel. When the Ct value of gray mold on leek leaves is less than 34.55, the degree of gray mold infection in leek is more severe and plant protection personnel need to take intervention measures, otherwise it will cause an outbreak of gray mold disease. When the Ct value of gray mold on leek leaves is less than 29.39, the gray mold infection in leek has already broken out and will affect the growth of leek. Plant protection personnel need to take immediate measures to treat it in order to avoid greater losses.

[0090] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A primer and probe set for detecting gray mold pathogens in leeks based on quantitative real-time PCR, characterized in that, Includes primer HMB-F, primer HMB-R, and probe P; The sequence of primer HMB-F is: 5'AAACTCGACCGCAGACATATT 3'; the sequence of primer HMB-R is: 5'ACCTTGTTAGCTGGCATGAG 3'; and the sequence of probe P is: 5'FAM-CATGAAGACTCGGGTGCGGATAATGG- BHQ3'.

2. The primer and probe set for detecting gray mold pathogens in leeks based on real-time PCR according to claim 1, characterized in that, The primers HMB-F and HMB-R are used to amplify the first to 130 bases of the specific gene sequence of *Botrytis cinerea*, the pathogen of gray mold in leeks; the specific gene sequence of *Botrytis cinerea* is shown in SEQ ID NO.

1.

3. A detection kit for gray mold pathogens in leeks based on quantitative real-time PCR, characterized in that, It includes the primer and probe set and plasmid standard as described in claim 1 or 2; the plasmid standard is constructed by inserting a Feature 11 containing the target gene into the PUC57 plasmid as a vector through genetic engineering methods; the nucleotide sequence of the Feature 11 containing the target gene is shown in SEQ ID NO.

2.

4. The detection kit for gray mold pathogens of leeks based on real-time PCR according to claim 3, characterized in that, It also includes fluorescent quantitative reaction solution.

5. The detection kit for gray mold pathogens of leeks based on real-time PCR according to claim 4, characterized in that, The fluorescence quantitative reaction solution includes DNA polymerase, dNTPs, and Mg. 2+ Buffer solution, ROX.

6. A method for detecting the pathogenic microorganism of gray mold in leeks based on quantitative real-time PCR, characterized in that, Using the primer and probe set according to any one of claims 1-2, or the kit according to any one of claims 3-5, the method includes the following steps: (1) Take leaves from the leek plants to be identified, grind them and extract DNA; (2) Using the extracted DNA as a template, quantitative real-time PCR was performed using primers HMB-F, primers HMB-R, and fluorescent probes; (3) Observe and analyze the Ct value of gray mold detection in the fluorescence quantitative PCR process; when the Ct value is <37.20, it indicates that the leeks are infected with gray mold.

7. The method for detecting gray mold pathogens in leeks based on quantitative real-time PCR according to claim 6, characterized in that, In step (2), the reaction system for real-time PCR is as follows: Hot Start Taq DNA polymerase 1 μL, dNTPs 1 μL, MgCl2 / MgSO4 0.5 μL, pH 8.0 buffer 2.5 μL, ROX 0.5 μL, primer HMB-F 1 μL, primer HMB-R 1 μL, probe P 0.5 μL, template 1 μL, H2O 16 μL; The reaction procedure was as follows: incubation at 50℃ for 2 min; pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 15 s; annealing / extension at 60℃ for 30 s; 40 cycles.

8. The method for detecting gray mold pathogens in leeks based on quantitative real-time PCR according to claim 6, characterized in that, In step (3), the specific correspondence between the Ct value of gray mold detection and gray mold infection is as follows: When 34.55 ≤ Ct value < 37.20, it indicates that the chives have a "mild" gray mold infection; When 29.39 ≤ Ct value < 34.55, it indicates that the chives have a "moderate" gray mold infection; When the Ct value is <29.39, it indicates that the chives are infected with "severe" gray mold.

Images