Artemisia annua protoplast extraction and instantaneous conversion method
By optimizing the use of enzymatic solution and osmotic pressure regulator, the extraction and transformation process of Artemisia celadon protoplasts is simplified, the problems of complex operation and long cycle in the existing technology are solved, efficient protoplast extraction and transformation are achieved, and the positive rate is improved.
Patent Information
- Application Number
- CN202510520756.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-24
- Publication Date
- 2025-07-29
AI Technical Summary
The existing genetic transformation system of Artemisia atractylodes is difficult to operate, has a long cycle, and has a low positive rate, making it difficult to quickly and efficiently extract and transform Artemisia atractylodes protoplasts.
The leaves of Artemisia sago were enzymatically dissolved by enzymatic solution containing cellulase, pectinase, isolation enzyme and mannitol. Combined with the use of osmotic pressure regulators, the enzymatic lysis reaction system was optimized to achieve efficient extraction and isolation of protoplasts, and the foreign gene was introduced through PEG transformation.
The operation process is simplified, the extraction rate and transformation efficiency of protoplasts are significantly improved, the time is shortened, the positive rate is improved, and stable research tools are provided.
Smart Images

Figure CN120384038A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of plant biotechnology, and particularly to a method for extracting Artemisia annua protoplasts and introducing foreign genes into the same. Background Art
[0002] Artemisia annua Linn, belonging to the genus Artemisia of the Compositae family, is an annual herbaceous plant and is the original plant of the traditional Chinese medicine Artemisia annua. Glandular hairs are distributed on both the front and back of its leaves, and artemisinin rich in the glandular hairs is a specific medicine for treating malaria. Wild Artemisia annua is suitable for growing in warm and sunny areas, and is intolerant to waterlogging. It is more suitable to grow in slightly acidic soil and is widely distributed in China.
[0003] In the traditional genetic transformation system of Artemisia annua, it is necessary to first cultivate sterile seedlings of Artemisia annua on MS medium, and then infect the injured leaves with the agrobacterium liquid of the gene to be transformed. The operation is rather difficult. As the injured leaves grow and develop continuously on the medium containing antibiotics and hormones, they will gradually go through the processes of callus, bud, and small seedling. The whole process takes about 2 months, and the cycle is long. In addition, the small seedlings need to be transplanted into the soil to grow for a period of time before positive plants can be identified. Usually, the positive rate is about 20%, which severely limits the processes such as the verification and analysis of the gene function of Artemisia annua.
[0004] Protoplasts refer to the parts of plant, bacterial, and fungal cells from which the cell walls have been removed, only retaining the cell membrane and the internal cytoplasm, nucleus, and various cell organelles. Protoplasts have a wide range of applications in biological research and biotechnology, such as genetic engineering, cell fusion, and plant tissue culture. At present, stable extraction methods and transformation models have been established for plant protoplasts in model plants such as Arabidopsis thaliana, tomato, and tobacco, which can, to a certain extent, help researchers rapidly propagate plants in large quantities, cultivate hybrid crops, and study molecular marker techniques.
[0005] Artemisia annua contains precious secondary metabolites. By extracting its protoplasts, researchers can increase the yield of secondary metabolites, and even change its metabolic pathway through genetic modification to produce new compounds, which can not only promote the development of medicinal plants but also drive drug research and development. Summary of the Invention
[0006] One of the technical problems to be solved by the present invention is to provide a method for extracting Artemisia annua protoplasts, which method is simple in operation, high in efficiency and speed, and high in protoplast extraction rate.
[0007] To solve the above technical problem, the method for extracting Artemisia annua protoplasts of the present invention includes the following steps:
[0008] 1) Using Artemisia annua leaves as materials, enzymatically digest the Artemisia annua leaves with an enzymatic digestion solution containing cellulase, pectinase, macerozyme, and mannitol;
[0009] 2) Wash the suspension obtained from the enzymatic digestion in step 1) and isolate the protoplast suspension;
[0010] 3) Centrifuge and resuspend the protoplast suspension obtained in step 2) to obtain a pure Artemisia annua protoplast suspension.
[0011] In the said enzymatic digestion solution, the content of cellulase is preferably 3 wt%, the content of pectinase is preferably 1.5 wt%, the content of macerozyme is preferably 0.2 wt% - 1.0 wt%, and the concentration of mannitol is preferably 0.2 M - 0.4 M.
[0012] Furthermore, the formulation of the enzymatic digestion solution is further preferably including: 3 wt% cellulase, 1.5 wt% pectinase, 0.2 wt% macerozyme, 0.4 M mannitol, 0.2 wt% BSA, 10 mM MES, 15 mM CaCl2, and 15 mM KCl.
[0013] The second technical problem to be solved by the present invention is to provide a method for introducing an exogenous gene into the Artemisia annua protoplasts extracted by the above method.
[0014] To solve the above technical problem, the transient transformation method of the Artemisia annua protoplasts of the present invention includes the following steps:
[0015] 1) Extract Artemisia annua protoplasts by the above method for extracting Artemisia annua protoplasts;
[0016] 2) Construct the exogenous gene into a plasmid vector;
[0017] 3) Mix the plasmid solution obtained in step 2), the protoplast suspension obtained in step 1), and the PEG transformation solution to perform protoplast transformation and introduce the exogenous gene into the Artemisia annua protoplasts;
[0018] 4) Terminate the transformation reaction in step 3), centrifuge, remove the supernatant, resuspend, and culture the protoplasts in the dark and enrich them;
[0019] 5) Collect the DNA of the protoplasts, perform PCR amplification, and detect the target band by electrophoresis.
[0020] In step 2), the concentration of the plasmid vector is preferably above 200 ng / μL.
[0021] The third technical problem to be solved by the present invention is to provide an enzymatic hydrolysis solution for extracting Artemisia annua protoplasts, and the enzymatic hydrolysis solution contains the following components: 3 wt% cellulase, 1.5 wt% pectinase, 0.2 wt% - 1.0 wt% macerozyme, 0.2 M - 0.4 M mannitol, 0.2 wt% BSA, 10 mM MES, 15 mM CaCl2 and 15 mM KCl.
[0022] Further, the formulation of the enzymatic hydrolysis solution preferably contains: 3 wt% cellulase, 1.5 wt% pectinase, 0.2 wt% macerozyme, 0.4 M mannitol, 0.2 wt% BSA, 10 mM MES, 15 mM CaCl2 and 15 mM KCl.
[0023] The fourth technical problem to be solved by the present invention is to provide a kit for extracting Artemisia annua protoplasts, which contains the above-mentioned enzymatic hydrolysis solution.
[0024] Further, the kit may also contain W5 solution and MMG solution. The formulation of the W5 solution is: 1 mM MES, 100 mM sodium chloride, 50 mM calcium chloride and 2 mM potassium chloride; the formulation of the MMG solution is: 2 mM MES, 0.1 M mannitol and 10 mM magnesium chloride.
[0025] Using Artemisia annua leaves as materials, by optimizing the types and concentration combinations of enzymes in the enzymatic hydrolysis solution, adding an appropriate amount of osmotic pressure regulator (mannitol) to the enzymatic hydrolysis solution, and adjusting the concentration of the osmotic pressure regulator according to the osmotic tolerance of Artemisia annua cells, the present invention has established a stable reaction system for extracting Artemisia annua protoplasts, achieving efficient extraction and separation of Artemisia annua leaf protoplasts. Compared with the existing Artemisia annua genetic transformation system, the method for extracting and transiently transforming Artemisia annua leaf protoplasts of the present invention has the following advantages and beneficial effects:
[0026] 1. Simple and efficient operation, without the need for operations such as preparing seedlings through aseptic tissue culture in the early stage, which can save a large amount of time;
[0027] 2. During the lysis process of Artemisia annua leaves, adding macerozyme into the enzymatic hydrolysis solution in a suitable proportion enhances the lysis effect of the cell wall, and the obtained protoplasts increase by 20% compared to the addition amount of the two enzymes alone;
[0028] 3. Adding a suitable concentration of mannitol osmotic pressure regulator to the extraction solution makes the osmotic pressure concentration about 400 mOsm / L. The extracted protoplasts have a stable morphology, good integrity, and no obvious rupture or shrinkage;
[0029] 4. The extraction rate of protoplasts is high (more than 85%), the obtained sample amount is 10 7 / g, and the cell viability rate reaches more than 95%;
[0030] 5. The transient transformation system and method of the protoplasts of the present invention have high transformation efficiency, stable transformation effect, and the plasmids will not be lost, which can provide important research tools for the research on Artemisia annua metabolic engineering, various signal transduction pathways in cells, gene expression regulation, gene function exploration and verification, research on physiological and biochemical processes, analysis of molecular mechanisms, drug screening, research on plant viruses and diseases, and screening of germplasm resources, etc. Description of the Drawings
[0031] Figure 1 It is the protoplasts of Artemisia annua leaves extracted in Example 1.
[0032] Figure 2 It is the PCR amplification electrophoresis diagram after plasmid transformation in Example 2. In the figure, the first column from the left is the DNA Marker, and the second and third columns from the left are the protoplast samples after plasmid transformation.
[0033] Figure 3 It is a comparison diagram of protoplasts extracted under enzymolysis systems containing different concentrations of macerozyme. Among them, in Figure a, no macerozyme is added, and in Figure b (the same as Figure 1 ), the concentration of macerozyme is 0.2 wt%, in Figure c, the concentration of macerozyme is 0.4 wt%, and in Figure d, the concentration of macerozyme is 1 wt%.
[0034] Figure 4 It is a diagram of the state of protoplasts after staining with trypan blue dye solution. Detailed Embodiments
[0035] For a more specific understanding of the technical content, features and effects of the present invention, the technical content of the present invention will be described in detail below in combination with the accompanying drawings and specific embodiments.
[0036] The enzyme products used in the examples and comparative examples of the present invention were purchased from Shanghai Bioshine Biotechnology Co., Ltd., and the compounds were purchased from Shanghai Macklin Biochemical Co., Ltd. The formulations of W5, MMG, PEG, and WI solutions are as follows:
[0037] Formulation of W5 solution (resuspension solution): 1 mM MES (2-(N-morpholino)ethanesulfonic acid), 100 mM sodium chloride, 50 mM calcium chloride, 2 mM potassium chloride, pH = 6.0.
[0038] Formulation of MMG solution (resuspension solution): 2 mM MES, 0.1 M mannitol, 10 mM magnesium chloride, pH = 6.0.
[0039] Formulation of PEG (polyethylene glycol) transformation solution: 35 wt% PEG4000, 0.1 M mannitol, 200 mM calcium chloride, pH = 6.0;
[0040] WI solution (culture medium) formula: 0.3 M mannitol, 2 mM MES, 20 mM potassium chloride, pH = 6.0.
[0041] The concentration of each component in the above formula is the final concentration of the component in the solution.
[0042] Example 1 Isolation and extraction of Artemisia annua leaf protoplasts
[0043] The method for isolating and extracting protoplasts from Artemisia annua leaves in this example is as follows:
[0044] I. Preparation of enzymatic hydrolysis solution
[0045] The enzymatic hydrolysis solution system for Artemisia annua leaves includes (final concentration): 3 wt% cellulase, 1.5 wt% pectinase, 0.2 wt% macerozyme, 0.4 M mannitol solution, 0.2 wt% BSA (bovine serum albumin), 10 mM MES solution, 15 mM CaCl2 solution, 15 mM KCl solution, pH = 5.8. Among them, cellulase is derived from Trichoderma viride and can decompose cellulose in the plant cell wall; pectinase is derived from Aspergillus niger and can decompose pectin, thus effectively loosening the cell wall structure and enabling protoplasts to be released from cells; macerozyme is derived from Rhizopus and has high pectinase and hemicellulase activities. During the lysis of Artemisia annua leaves, adding an appropriate proportion of macerozyme to the enzymatic hydrolysis solution can enhance the lysis effect of the cell wall.
[0046] When preparing, first treat the MES solution at 65 °C for 3 min, then add the reagents in the above enzymatic hydrolysis solution system except for CaCl2 and BSA, and inactivate the residual protease and DNase in the reagent by water bath at 55 °C for 10 min. After the solution is cooled to room temperature, add CaCl2 and BSA and shake to dissolve to obtain the enzymatic hydrolysis solution for Artemisia annua leaves.
[0047] II. Enzymatic hydrolysis
[0048] Select authentic Artemisia annua plants grown in Youyang, Chongqing. Select 20 leaves of mature Artemisia annua plants (both young and old leaves are acceptable) that have grown vigorously for 3 - 5 months, cut the leaves crosswise into thin strips about 2 mm with a blade, fully immerse them in the enzymatic hydrolysis solution, and then place the above solution in a vacuum machine and perform vacuum treatment for half an hour to make the enzymatic hydrolysis solution better penetrate into the tissue through the incision; then enzymatically hydrolyze at room temperature in a horizontal shaker (40 rpm) in the dark for 3 h. At this time, the solution turns dark green and is in a suspension state.
[0049] III. Protoplast separation and inspection
[0050] Add an equal volume of W5 solution to the suspension obtained from the second step of enzymatic hydrolysis to wash it, and pass it through a 100μm cell sieve to remove the leaves that are not completely hydrolyzed. Filter to obtain suspended protoplasts. Take 5μL of the solution and observe it under a microscope. Figure 1 As shown, normal protoplasts appear round and translucent, with a diameter of 8-60 μm.
[0051] 4. Resuspend
[0052] The protoplast suspension obtained in the third step was centrifuged at 100 g for 1 min, the protoplasts were resuspended at the bottom, and the supernatant was removed by aspiration. The protoplasts were resuspended in 2 mL of W5 solution and placed on ice for 10 min to allow the protoplasts to settle. The supernatant was removed again and the protoplasts were resuspended in 2 mL of MMG solution to obtain a pure protoplast suspension.
[0053] Example 2 Transient transformation of protoplasts and PCR verification
[0054] In this example, the protoplasts extracted in Example 1 were transformed with a DNA-PEG-Ca transformation method, and then PCR was used to detect whether the target gene was introduced into the protoplasts.
[0055] 1. Transient transformation of Artemisia annua leaf protoplasts
[0056] (1) PHB-YFP-AtMYB5 vector construction process
[0057] First, the single fragment recombination cloning kit (BR1398247, ), the exogenous gene AtMYB5 (sequence can be found on the TAIR website https: / / www.arabidopsis.org / results?mainType=gene&searchText=MYB5&category=genes) was constructed into the PHB-YFP linearized vector (linearized control vector), and the reaction system is shown in Table 1 (the recombination buffer, linearized vector, and recombinase in Table 1 are all reagents in the single-fragment recombination cloning kit):
[0058] Table 1 PHB-YFP-AtMYB5 vector construction reaction system
[0059] Material Name Addition Amount 5× Reconstitution Buffer 4 μL PHB-YFP Linearized Vector (400 ng / μL) 0.5 μL AtMYB5 Gene Fragment 1.5 μL Recombinase 2 μL <![CDATA[ddH2O]]> 12 μL
[0060] Prepare the reaction system in Table 1 above in a PCR tube, gently mix it with a pipette, and after a short centrifugation, collect the reaction solution at the bottom of the tube. React at 50 °C for 30 min, cool it immediately to 4 °C and place it on ice to obtain the PHB-YFP-AtMYB5 vector plasmid solution.
[0061] (2) Transformation
[0062] Mix the PHB-YFP-AtMYB5 plasmid solution to be transformed carrying the exogenous gene AtMYB5 obtained in the above step (1), the Artemisia annua leaf protoplast suspension resuspended in Example 1, and the PEG transformation solution in a ratio of 10 μg: 100 μL: 100 μL, and place it at room temperature for 5 min to complete the transformation step.
[0063] II. Protoplast verification
[0064] Add 2 volumes of W5 solution to the transformation solution obtained in the first step above, gently invert and mix to terminate the transformation reaction, centrifuge at 100 g for 1 min, remove the supernatant, add 1 mL of WI solution to the precipitate to resuspend the protoplasts, and culture them in the dark at room temperature on a horizontal shaker at 40 rpm for 12 h to complete the protoplast culture.
[0065] Centrifuge the above protoplasts at 100 g for 1 min, remove the supernatant; add 1 mL of W5 solution and wash twice, remove the supernatant to obtain a protoplast enrichment.
[0066] Use the tissue / cell direct amplification PCR lysis solution independently developed by the applicant (product number BR1338967, containing reagent A and reagent B, ) to collect the DNA of the protoplasts. The operation steps are as follows: Add 80 μL of reagent A in the tissue / cell direct amplification PCR lysis solution (the name in the product instruction manual of the tissue / cell direct amplification PCR lysis solution) to the above protoplast enrichment, and pipette and mix well; transfer the liquid to a PCR tube, place it in a PCR instrument, incubate at 55 °C for 5 min, and incubate at 95 °C for 2 min; take it out, add 20 μL of reagent B in the tissue / cell direct amplification PCR lysis solution (the name in the product instruction manual of the tissue / cell direct amplification PCR lysis solution) to the above solution, and pipette and mix well to obtain a lysis product, that is, the DNA of the transformed protoplasts. Take 3 μL of the lysis product for subsequent PCR amplification. The PCR amplification method is as follows:
[0067] (1) Design primers
[0068] First, import the constructed PHB-YFP-AtMYB5 vector sequence into the Snapgene software. According to the primer design principle, for the upstream primer, select the PHB-YFP vector primer plus the AtMYB5 gene primer, and for the downstream primer, select the PHB-YFP vector primer. The designed primer sequences are as follows:
[0069] Forward primer sequence: CAGTCTCTCTCTCCAAGCTTATGATGTCATGTGGTGGG(SEQ ID NO:1)
[0070] Reverse primer sequence: GCATTGAACTTGACGAACGTTGTCGA(SEQ ID NO:2)
[0071] (2) PCR amplification
[0072] Use the 2×Taq-AS PCR premix (containing dye) independently developed by the applicant (product number BR1343161, ) to amplify the above 3 μL of lysate (i.e., the transformed protoplast DNA). The PCR amplification reaction system and conditions are shown in Tables 2 and 3 respectively:
[0073] Table 2 PCR amplification reaction system
[0074] Reagent Usage Amount Final Concentration 2× Taq-AS PCR Premix (with Dye) 25 μL 1× Forward Primer (10 μM) 1 μL 0.2 μM Forward Primer (10 μM) 1 μL 0.2 μM DNA Template 2 μL - <![CDATA[ddH2O]]> 21 μL -
[0075] Table 3 PCR amplification reaction conditions
[0076] Step Temperature Time Pre-denaturation 94℃ 3 min Denaturation 94℃ 30s Annealing 55℃ 30s Extension 72℃ 30s Final Extension 72℃ 5 min
[0077] (3) Detection of PCR amplification products by 1% agarose gel electrophoresis
[0078] Weigh 0.5 g of agarose and dissolve it in 50 mL of TBE (Tris-borate) solution. After complete dissolution by microwave heating, pour it into a gel casting mold and let it solidify at room temperature. Add nucleic acid dye to the above PCR amplification products, load the samples for electrophoresis, and the electrophoresis conditions are: 120 V for 15 min. After electrophoresis, observe with a gel imaging system. The size of the target fragment band is 800 bp, and an obvious band can be seen at the 800 bp position (as Figure 2 shown), proving successful plasmid transformation.
[0079] Example 3 Effect of adding different concentrations of macerozyme on the extraction effect of Artemisia annua protoplasts
[0080] The method for isolating and extracting protoplasts from Artemisia annua leaves in this example is the same as that in Example 1. The difference from Example 1 is that in the enzyme digestion solution system of Artemisia annua leaves in this example, the concentrations of macerozyme are 0 (the extraction results are shown in Figure 3a), 0.4 wt% (The extraction results are shown in Figure 3 c), 1 wt% (The extraction results are shown in Figure 3 d). The other components in the enzymatic hydrolysate system are the same as those in Example 1.
[0081] For the extraction results of Artemisia annua protoplasts, see Figure 3 . For convenient comparison, the extraction results of Example 1 ( Figure 1 ) are also placed in Figure 3 as Figure 3 b. It can be seen from the same field of view in the Figure 3 photo that the number of protoplasts obtained from the enzymatic hydrolysis system of Example 1 ( Figure 3 b) is the largest, and at the same time, the protoplasts maintain good morphological characteristics. After counting by the hemocytometer method, the number of protoplasts that can be obtained from the enzymatic hydrolysis system of Example 1 is 10 7 / g, and the number of protoplasts obtained from the enzymatic hydrolysis system without adding macerozyme is 10 6 / g, showing a 10-fold difference in quantity. When the content of macerozyme is increased, due to the excessive addition of the enzyme, the cell wall is hydrolyzed excessively, and there is a risk of damaging the exposed cell membrane. It can be clearly seen from Figure 3 c, 3d that there is a phenomenon of protoplast rupture and the quantity decreases sharply.
[0082] The extracted protoplasts were stained with trypan blue staining reagent, and no or slightly visible cells were stained blue, indicating that most cells with intact structures were living cells. It was calculated that the cell survival rate reached 95%-100%.
[0083] From the results of this example, it can be seen that although living cells can be obtained without adding macerozyme in the enzymatic hydrolysate system, there are certain limitations in the degree of complete lysis. Adding 0.2 wt% macerozyme can better degrade the pectin substances in the cell wall. By targeting the hydrolysis of the α-1,4-glycosidic bond in pectin, the intercellular connection is destroyed, enabling the cells to separate from each other, and thus making the original tissue more fully enzymatically hydrolyzed.
[0084] Effect of the concentration of the osmotic pressure regulator mannitol in the enzymatic hydrolysate system of Example 4 on the extraction quantity of Artemisia annua protoplasts
[0085] The method for separating and extracting protoplasts from Artemisia annua leaves in this example is the same as that in Example 1. Different from Example 1, the concentrations of mannitol in the enzymatic hydrolysate system of Artemisia annua leaves in this example are 0.2 M, 0.6 M, and 0.8 M respectively, and the other components in the enzymatic hydrolysate system are the same as those in Example 1. For the extraction results of Artemisia annua protoplasts and the comparison with the extraction results of Example 1 (mannitol concentration is 0.4 M), see Table 4.
[0086] Table 4 Quantity of Artemisia annua protoplasts extracted with enzymatic hydrolysates containing different concentrations of mannitol
[0087] Mannitol Concentration Number of Protoplasts Obtained Osmotic Pressure 0.2M <![CDATA[10 5 / g]]> 200 mOsm / L 0.4M <![CDATA[10 7 / g]]> 400 mOsm / L 0.6M <![CDATA[10 6 / g]]> 600 mOsm / L 0.8M <![CDATA[2×10 5 / g]]> 800 mOsm / L
[0088] As can be seen from the results in Table 4, too high a concentration of mannitol causes the protoplasts of Artemisia annua to dehydrate and shrink, making it difficult to achieve normal physiological functions and reducing the quantity obtained by extraction; too low a concentration of mannitol causes the protoplasts to absorb water and swell, resulting in rupture, which also reduces the quantity obtained by extraction. During the extraction process of Artemisia annua protoplasts, the optimal mannitol concentration is 0.4 M, and the osmotic pressure is about 400 mOsm / L. At this time, the obtained protoplasts are round and plump in shape and have a normal physiological state.
[0089] The above-mentioned embodiments are only feasible or preferred embodiments of the present invention, which are used to illustrate the present invention and are not intended to limit the scope of the patent application of the present invention. Therefore, all equivalent changes and modifications made in accordance with the scope of the patent application of the present invention shall fall within the scope covered by the patent of the present invention.
Claims
1. A method for extracting Artemisia annua protoplasts, characterized in that, It includes the following steps: 1) Using Artemisia annua leaves as materials, enzymatically digest the Artemisia annua leaves with an enzymatic hydrolysis solution containing cellulase, pectinase, macerozyme, and mannitol; 2) Wash the suspension obtained from the enzymatic hydrolysis in step 1) and separate the protoplast suspension; 3) Centrifuge and resuspend the protoplast suspension obtained in step 2) to obtain a pure Artemisia annua protoplast suspension.
2. The method according to claim 1, wherein The Artemisia annua used is a mature Artemisia annua plant that has thrived for 3 - 5 months in Youyang, Chongqing, and the leaves are cut into thin strips.
3. The method according to claim 1, wherein In the enzymatic hydrolysis solution, the content of cellulase is 3 wt%, the content of pectinase is 1.5 wt%, the content of macerozyme is 0.2 wt% - 1.0 wt%, and the concentration of mannitol is 0.2 M - 0.4 M.
4. The method according to claim 3, characterized in that The enzymatic hydrolysis solution contains: 3 wt% cellulase, 1.5 wt% pectinase, 0.2 wt% macerozyme, 0.4 M mannitol, 0.2 wt% BSA, 10 mM MES, 15 mM CaCl2, and 15 mM KCl.
5. The method according to claim 4, wherein The preparation steps of the enzymatic hydrolysis solution include: treating the MES solution at 65 °C for 3 min, adding the reagents in the enzymatic hydrolysis solution except for CaCl2 and BSA, incubating in a water bath at 55 °C for 10 min to inactivate the residual protease and DNase in the reagents, and after the solution cools to room temperature, adding CaCl2 and BSA and shaking to dissolve to obtain the enzymatic hydrolysis solution.
6. The method according to claim 1, characterized in that, In step 1), the enzymatic hydrolysis method is to immerse the Artemisia annua leaves in the enzymatic hydrolysis solution, perform vacuum treatment for half an hour, and enzymatically hydrolyze at room temperature for 3 hours in a horizontal shaker at 40 rpm in the dark.
7. The method according to claim 1, characterized in that In step 2), add an equal volume of W5 solution to the suspension obtained from the enzymatic hydrolysis in step 1) for washing, remove the incompletely enzymatically digested leaves with a 100 μm cell sieve, and filter to obtain the protoplast suspension.
8. The method according to claim 1, wherein In step 3), centrifuge at a speed of 100 g for 1 min, resuspend the protoplasts at the bottom, and aspirate the supernatant; take 2 mL of W5 solution to resuspend the protoplasts, place them on ice for 10 min to precipitate the protoplasts, aspirate the supernatant again, and add 2 mL of MMG solution to resuspend the protoplasts to obtain a pure protoplast suspension.
9. The method according to claim 7 or 8, characterized in that The formula of the W5 solution is: 1 mM MES, 100 mM sodium chloride, 50 mM calcium chloride, and 2 mM potassium chloride.
10. The method according to claim 8, wherein The formula of the MMG solution is: 2 mM MES, 0.1 M mannitol, and 10 mM magnesium chloride.
11. A transient transformation method for Artemisia annua protoplasts, characterized in that, It includes the following steps: 1) Extract Artemisia annua protoplasts by the method of any one of claims 1 - 10; 2) Construct the foreign gene into a plasmid vector; 3) Mix the plasmid solution obtained in step 2), the protoplast suspension obtained in step 1), and the PEG transformation solution for protoplast transformation to introduce the foreign gene into the Artemisia annua protoplasts; 4) Terminate the transformation reaction in step 3), centrifuge, remove the supernatant, resuspend, and culture the protoplasts in the dark and enrich them; 5) Collect the DNA of the protoplasts, perform PCR amplification, and detect the target band by electrophoresis.
12. The method according to claim 11, characterized in that, In step 2), a single - fragment recombination cloning kit is used, and the plasmid vector is the PHB - YFP plasmid in the kit, with a concentration of 200 ng / μL or more.
13. The method according to claim 11, wherein Step 3): Mix the plasmid solution, protoplast suspension, and PEG transformation solution in a ratio of 10 μg: 100 μL: 100 μL, and let it stand at room temperature for 5 min to complete the transformation.
14. The method according to claim 11 or 13, characterized in that, Step 3): The formula of the PEG transformation solution is: 35 wt% PEG4000, 0.1 M mannitol, and 200 mM calcium chloride.
15. Enzymolysis solution for extracting Artemisia annua protoplasts, characterized in that, It contains the following components: 3 wt% cellulase, 1.5 wt% pectinase, 0.2 wt% - 1.0 wt% macerozyme, 0.2 M - 0.4 M mannitol, 0.2 wt% BSA, 10 mM MES, 15 mM CaCl2, and 15 mM KCl.
16. The enzymatic hydrolysate according to claim 15, characterized in that, The formula of the enzymatic hydrolysis solution is: 3 wt% cellulase, 1.5 wt% pectinase, 0.2 wt% macerozyme, 0.4 M mannitol, 0.2 wt% BSA, 10 mM MES, 15 mM CaCl2, and 15 mM KCl.
17. A kit for extracting Artemisia annua protoplasts, characterized in that, The kit contains the enzymatic hydrolysis solution according to any one of claims 15 - 16.
18. The kit according to claim 17, wherein It also contains W5 solution and MMG solution. The formula of the W5 solution is: 1 mM MES, 100 mM sodium chloride, 50 mM calcium chloride, and 2 mM potassium chloride; the formula of the MMG solution is: 2 mM MES, 0.1 M mannitol, and 10 mM magnesium chloride.