Nucleic acid molecule and application thereof

CN120390799APending Publication Date: 2025-07-29NANJING CUREGENE TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202380087923.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-12-22
Filing Date
2023-12-22
Publication Date
2025-07-29

AI Technical Summary

Technical Problem

The existing miR skeleton has low expression levels in cells and exosomes, resulting in poor therapeutic effect of RNA interference therapy and difficulty in effectively targeting diseased tissues.

Method used

A new miR skeleton was designed, including 5' flanking sequence, Loop sequence and 3' flanking sequence. By optimizing the base arrangement of these sequences, the complementarity of the coding sequence and the compensation sequence of the small RNA molecule was increased, thereby forming a neck loop. structure to increase the expression of small RNA molecules and enhance their expression in cells and exosomes through specific expression vectors and host cell technologies.

Benefits of technology

It significantly increases the expression of small RNA molecules in cells and exosomes, enhances its therapeutic effect in targeting diseased tissues, and improves the efficacy of RNA interference therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120390799A_ABST
    Figure CN120390799A_ABST
Patent Text Reader

Abstract

The invention provides a nucleic acid molecule and application thereof, the nucleic acid molecule comprises a miRNA skeleton nucleic acid molecule used for generating target small molecule RNA, and the invention also provides an expression vector comprising the nucleic acid molecule. When the miRNA skeleton nucleic acid molecule and the expression vector are used for expression of target small-molecule RNA, the expression quantity of the target small-molecule RNA in host cells and the expression quantity of the target small-molecule RNA in exosomes secreted by the host cells can be increased.
Need to check novelty before this filing date? Find Prior Art

Description

Nucleic acid molecules and their applications

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese patent application number CN202211658729.9, filed on December 22, 2022, which is incorporated herein by reference in its entirety. Technical Field

[0003] The present invention relates to the field of nucleic acid expression, and specifically to the field of small RNA expression. Background Art

[0004] In recent years, research in the field of RNA has been booming, particularly in gene and cell therapy, where RNA offers advantages such as high efficiency, good safety, and low cost. For example, RNA interference (RNAi), a phenomenon in which double-stranded RNA triggers the specific degradation of homologous mRNA, has been widely used in disease treatment. However, the intracellular instability and unsatisfactory expression of RNA within cells have greatly limited the application of RNA, particularly small RNAs.

[0005] Studies have shown that when small RNAs are expressed in cells through the miR backbone structure, they can cause degradation of the passenger strand, thereby greatly reducing the off-target effects caused by the passenger strand. Kwan-Ho Chung and his team showed that inserting siRNA into the mmu-miR-155 backbone for expression can produce fewer passenger strands compared to the shRNA backbone (Polycistronic RNA polymerase II expression vectors for RNA interference based on BIC / miR-155, Nucleic Acids Res. 2006; 34(7): e53). Based on this, Daniel K. Fowler's team further optimized it (Improved knockdown from artificial microRNAs in an enhanced miR-155 backbone: a designer's guide to potent multi-target RNAi, Nucleic Acids Res. 2016 Mar18; 44(5): e48). It was also found that the mmu-miR-155 backbone can express siRNA in vivo, such as in the liver.

[0006] Furthermore, studies have shown that siRNA expressed using a miR backbone can enter exosomes and, through these vesicles, exert its effects in other organs. Encapsulated siRNA within exosomes can avoid rapid degradation, and as exosomes are secreted, siRNA can enter the bloodstream and be delivered to a wider range of organs and tissues. Studies have shown that exosome-encapsulated siRNA in the bloodstream can enter target organs such as the lungs, kidneys, and colon, and has demonstrated therapeutic efficacy in animal models of non-small cell lung cancer.

[0007] Despite this, the currently used miR backbones still suffer from low expression levels and poor therapeutic effects. Therefore, it is necessary to develop a backbone and method that can increase the expression level of RNA in cells and exosomes.

[0008] Summary of the Invention

[0009] In one aspect, provided herein are isolated nucleic acid molecules comprising, in 5'-3' direction:

[0010] 1) a 5' flanking sequence comprising the sequence shown in SEQ ID NO: 1 or a sequence having at least 80% sequence identity thereto;

[0011] 2) a loop sequence comprising the sequence shown in SEQ ID NO: 3 or a sequence having at least 80% sequence identity thereto; and

[0012] 3) a 3' flanking sequence comprising the sequence shown in SEQ ID NO: 2 or a sequence having at least 80% sequence identity thereto,

[0013] The nucleic acid molecule further comprises a coding sequence for a small RNA molecule, and the coding sequence for the small RNA molecule is located between the 5' flanking sequence and the Loop sequence or between the Loop sequence and the 3' flanking sequence.

[0014] In some embodiments, the 5' flanking sequence does not include the sequence AATTCG at its 3' end, and / or the 3' flanking sequence does not include the sequence CACCGGT at its 5' end.

[0015] In some embodiments, the nucleic acid molecule further comprises a compensatory sequence, wherein when the coding sequence of the small RNA molecule is located between the 5' flanking sequence and the Loop sequence, the compensatory sequence is located between the Loop sequence and the 3' flanking sequence; when the coding sequence of the small RNA molecule is located between the Loop sequence and the 3' flanking sequence, the compensatory sequence is located between the 5' flanking sequence and the Loop sequence, and the compensatory sequence is at least partially reverse complementary to the coding sequence of the small RNA molecule.

[0016] In some embodiments, the compensatory sequence is complementary to at least 80% of the bases in the coding sequence of the small RNA molecule; preferably, compared with the sequence that is completely reverse complementary to the coding sequence of the small RNA molecule, the compensatory sequence lacks any consecutive 2-3 bases from the 7th to the 12th bases from its 5' end; more preferably, compared with the sequence that is completely reverse complementary to the coding sequence of the small RNA molecule, the compensatory sequence lacks the 9th and 10th bases from its 5' end.

[0017] In some embodiments, in the transcript RNA produced by transcription of the nucleic acid molecule, the transcription products of the coding sequence of the small RNA molecule, the Loop sequence and the compensatory sequence can form a neck-loop structure, the transcription product of the coding sequence of the small RNA molecule and the transcription product of the compensatory sequence form the neck of the neck-loop structure, and the transcription product of the Loop sequence forms the ring part of the neck-loop structure.

[0018] In some embodiments, the transcript RNA is a pre-miRNA.

[0019] In some embodiments, the small RNA molecule is a miRNA or siRNA molecule, preferably 20-24 nt in length.

[0020] In some embodiments, the small RNA molecule targets a disease-associated gene expressed in diseased tissue.

[0021] In some embodiments, the disease-associated gene is selected from ataxin-2, SLN, SOD1, ATXN3, C9ORF72, HTT, VEGF, VEGFR, ANG1, ANG2, SARS-CoV-2, HBV, HCV, HIV, HPV, HSV, COX-2, TGF-beta, GBAI, PCSK9, LDL, KRAS, NKRAS, HRAS, EGFR, ATL, MET, PIK3CA, SHP1, SOX2, PTEN, TP53, Yap1, HIF1a, CDK1, CDK4, CDK6, NRF2, beta-Catenin, STAT3, Aurora A, CDH17, CXCR4, IDO1, CSF-1, NF-kB, NOTCH, SOX9, PD-L1, PD1, CTLA4, LAG3, TIGIT, COX-2, TGF-beta, VEGF, VEFGR, BRAF, KRAS, and EGFR genes.

[0022] In some embodiments, the sequence of the small RNA molecule is as shown in any one of SEQ ID NO: 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48 or 50.

[0023] In some embodiments, 1) the sequence of the small RNA molecule is shown in SEQ ID NO: 6, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 7; 2) the sequence of the small RNA molecule is shown in SEQ ID NO: 8, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 9; 3) the sequence of the small RNA molecule is shown in SEQ ID NO: 10, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 11; 4) the sequence of the small RNA molecule is shown in SEQ ID NO: 12, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 13; 5) the sequence of the small RNA molecule is shown in SEQ ID NO: 14, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 15; 6) the sequence of the small RNA molecule is shown in SEQ ID NO: 16, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 17; 7) the sequence of the small RNA molecule is shown in SEQ ID NO: 18, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 19; 8) the sequence of the small RNA molecule is shown in SEQ ID NO: NO:20, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:21; 9) the sequence of the small RNA molecule is shown in SEQ ID NO:22, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:23; 10) the sequence of the small RNA molecule is shown in SEQ ID NO:24, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:25; 11) the sequence of the small RNA molecule is shown in SEQ ID NO:26, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:27; 12) the sequence of the small RNA molecule is shown in SEQ ID NO:28, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:29; 13) the sequence of the small RNA molecule is shown in SEQ ID NO:30, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:31; 14) the sequence of the small RNA molecule is shown in SEQ ID NO:32, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:33; 15) the sequence of the small RNA molecule is shown in SEQ ID NO: NO: 34, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 35; 16) the sequence of the small RNA molecule is shown in SEQ ID NO: 36, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 37;17) The sequence of the small RNA molecule is shown in SEQ ID NO:38, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:39; 18) The sequence of the small RNA molecule is shown in SEQ ID NO:40, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:41; 19) The sequence of the small RNA molecule is shown in SEQ ID NO:42, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:43; 20) The sequence of the small RNA molecule is shown in SEQ ID NO:44, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:45; 21) The sequence of the small RNA molecule is shown in SEQ ID NO:46, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:47; 22) The sequence of the small RNA molecule is shown in SEQ ID NO:48, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:49; or 23) The sequence of the small RNA molecule is shown in SEQ ID NO:50, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:51.

[0024] In another aspect, provided herein is an expression vector comprising the above-described nucleic acid molecule.

[0025] In some embodiments, the expression vector further comprises a promoter sequence operably linked to the nucleic acid molecule.

[0026] In some embodiments, the expression vector is selected from a plasmid vector, an adeno-associated viral vector, an adenoviral vector, a retroviral vector, or a lentiviral vector.

[0027] In another aspect, provided herein is a host cell comprising the above-mentioned nucleic acid molecule or expression vector.

[0028] In another aspect, provided herein is a method for producing a small RNA molecule, comprising culturing the above-described host cell and optionally isolating the small RNA molecule.

[0029] In another aspect, provided herein is a method for producing exosomes comprising small RNA molecules, comprising culturing the host cells described above and isolating the exosomes from the culture supernatant.

[0030] In another aspect, the present invention provides the use of the above-mentioned nucleic acid molecules, expression vectors or host cells in preparing small RNA molecules.

[0031] In another aspect, provided herein is a pharmaceutical composition comprising: 1) the above-mentioned expression vector or host cell; and 2) a pharmaceutically acceptable carrier.

[0032] In another aspect, the present invention provides a use of the above-mentioned expression vector or host cell in the preparation of a drug for treating a disease, wherein the disease is associated with abnormal gene expression or mutation.

[0033] In another aspect, provided herein is a method for treating a disease in a subject, comprising administering a therapeutically effective amount of the above-mentioned expression vector or host cell to the subject, wherein the disease is associated with abnormal gene expression or mutation.

[0034] When the nucleic acid molecules and expression vectors provided herein are used to express a small molecule RNA of interest, they can increase the expression level of the small molecule RNA of interest in host cells and the expression level of the small molecule RNA of interest in exosomes secreted by the host cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 demonstrates how the CG-miR-155 backbone promotes expression of the target nucleic acid si-mEGFR in cells and exosomes, according to some examples. The original and CG-miR-155 backbone systems express si-mEGFR (msiRE) intracellularly and extracellularly. Left panel: Relative levels of siRNA in 293FT cells. Right panel: Relative levels of secreted siRNA in exosomes. Mock: Untreated 293FT cells. ScrR: si-scramble expressing the miR-155 backbone (negative control for siRNA).

[0036] Figure 2 demonstrates how the CG-miR-155 backbone promotes expression of the target nucleic acid si-mKRAS in cells and exosomes, according to some examples. The original backbone system (ORIG) and the CG-miR-155 backbone system demonstrate intracellular and extracellular expression of si-mKRAS (msiRK). Left panel: Relative levels of siRNA in 293FT cells. Right panel: Relative levels of secreted siRNA in exosomes. Mock: Untreated 293FT cells. ScrR: si-scramble expression of the miR-155 backbone.

[0037] Figure 3 demonstrates how the CG-miR-155 backbone promotes expression of the target nucleic acid si-hEGFR in cells and exosomes, according to some examples. The original backbone system (ORIG) and the CG-miR-155 backbone system demonstrate intracellular and extracellular expression of si-hEGFR (hsiRE). Left panel: Relative levels of siRNA in 293FT cells. Right panel: Relative levels of secreted siRNA in exosomes. Mock: Untreated 293FT cells. ScrR: si-scramble expression using the miR-155 backbone.

[0038] Figure 4 shows that the CG-miR-155 backbone promotes in vivo expression of target nucleic acids in some embodiments. Serum levels of si-mEGFR (msiRE) produced by the original backbone system (ORIG) and the CG-miR-155 backbone system. Mock: serum from untreated mice. DETAILED DESCRIPTION

[0039] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0040] The term "or" refers to a single element of the listed alternative elements, unless the context clearly indicates otherwise. The term "and / or" refers to any one, any two, any three, any more or all of the listed alternative elements.

[0041] The term "comprising" or "including" means including the stated elements, integers, or steps, but does not exclude any other elements, integers, or steps. In this article, when the term "comprising" or "including" is used, unless otherwise indicated, it also covers the situation consisting of the stated elements, integers, or steps. For example, when referring to a nucleic acid molecule "comprising" certain specific sequences, it is also intended to cover nucleic acid molecules consisting of these specific sequences.

[0042] The term "about" generally refers to a variation within a range of 10% above or below the specified value, for example, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below the specified value.

[0043] As used herein, the terms "nucleic acid molecule," "nucleic acid," and "polynucleotide" are used interchangeably to refer to polymers of nucleotides. Such nucleotide polymers may contain natural and / or non-natural nucleotides and include, but are not limited to, DNA, RNA, and PNA. A "nucleic acid sequence" refers to a linear sequence of nucleotides contained in a nucleic acid molecule or polynucleotide, typically given in a 5' to 3' direction. An "isolated nucleic acid molecule" refers to a nucleic acid molecule that has been separated from its natural environment (e.g., the intracellular environment) and is substantially free of one or more substances normally associated with it in nature, such as proteins, nucleic acids, lipids, carbohydrates, cell membranes, etc., or is an artificially prepared (e.g., artificially synthesized) nucleic acid molecule. For DNA molecules, since the double strands are complementary, when referring to the sequence of one of the strands herein, those skilled in the art will recognize that a reference is made to its complementary strand or a double-stranded DNA molecule comprising its complementary strand.

[0044] As used herein, "small RNA molecule" refers to an RNA molecule having a length of less than about 100 bases, for example, about 10-50 bases, or 10-30 bases. Small RNA molecules can be single-stranded or double-stranded, and include, but are not limited to, siRNA, miRNA, hpRNA, piRNA, etc. In some cases, the length of a small RNA molecule may not be subject to the above restrictions and may include, for example, an mRNA molecule.

[0045] The term "siRNA" refers to a small RNA molecule that can cause the degradation of its target RNA molecule through the phenomenon of RNA interference (RNAi). Within the cell, siRNA can be generated by the cleavage of longer double-stranded RNA molecules by a nuclease called Dicer. Dicer nuclease cleaves double-stranded RNA molecules to generate shorter double-stranded siRNA molecules. This double-stranded siRNA molecule binds to a complex called pre-RISC. The Argonaute protein in this pre-RISC complex can cleave one strand of the siRNA molecule (called the passenger strand). The cleavage product leaves the complex, and the other strand of the siRNA molecule (called the guide strand) and the complex form an RNA-induced silencing complex (RISC). The guide strand in RISC can then bind to a target RNA molecule containing its complementary sequence in the molecule and, with the help of the Argonaute protein in RISC, cleave the target molecule at a specific site, leading to its degradation. The target molecule can be, for example, viral RNA, transposon transcripts, mRNA, etc. siRNA molecules and their target sequences are usually completely complementary, which is different from miRNA. RNAi caused by siRNA molecules is considered to be a defense mechanism that organisms use to prevent viruses from replicating in the body or to prevent transposons from moving within the genome.

[0046] "miRNA" refers to a small RNA molecule that can cause the degradation of its target RNA molecule (usually an mRNA molecule) or affect the translation of the mRNA molecule through the phenomenon of RNA interference (RNAi). Within the cell, miRNA molecules are typically products expressed by the cellular genome, such as miRNA-155. Within the cell nucleus, the transcribed single-stranded RNA molecule, called Pri-miRNA, forms a neck-loop structure with free ends by reverse complementing a portion of the intramolecular sequence. The enzyme Drosha cleaves the double strands at the neck to produce a smaller neck-loop RNA molecule (pre-miRNA). After the pre-miRNA is transferred from the cell nucleus to the cytoplasm, the enzyme Dicer cleaves the double strands at the neck near the loop, producing a double-stranded miRNA molecule. RISC is then generated through a processing mechanism similar to that of siRNA, and RNAi effects are exerted. The target RNA molecule of miRNA is typically intracellular mRNA, and its target sequence is located in the 3' untranslated region (3'UTR) of the mRNA molecule. RNA interference can be achieved by promoting the degradation of the target mRNA or hindering its translation. Relatively speaking, when a miRNA molecule is completely complementary to the target sequence in its target mRNA molecule, it tends to promote its degradation. RNAi caused by siRNA molecules is considered a way to regulate gene expression in cells. Unlike siRNA, miRNA molecules are often not completely complementary to their target molecules. For example, pairing may only involve a few (e.g., 6 or 7) nucleotides at the 5' end of the guide strand (called the "seed region") and a few nucleotides at other positions.

[0047] The length of the siRNA or miRNA is about 10-30 nucleotides, more preferably 20-24 (e.g., 20-23) nucleotides. When the siRNA or miRNA is double-stranded, it may include short overhangs at each end. Preferably, the overhang at the 3' end is 1-6 nucleotides in length.

[0048] Although there are differences in the natural formation mechanisms of siRNA and miRNA in cells, their mechanisms of action are similar and both can silence the expression of target genes. Therefore, small RNA molecules for silencing genes that are artificially introduced into cells or produced by vector expression can be collectively referred to as siRNA molecules in this article. That is, unless otherwise specified, siRNA and miRNA can be used without distinction.

[0049] "shRNA" refers to a single-stranded RNA molecule with a neck-loop or hairpin structure. These single-stranded RNA molecules have consecutive complementary bases that can fold back on themselves to allow complementary base pairs to meet, forming the neck of the neck-loop structure through hydrogen bonding, while the sequence between these complementary sequences forms the loop portion of the neck-loop structure. As described above, shRNA can be a precursor molecule to a miRNA molecule.

[0050] "piRNA" refers to small RNA molecules that bind to PIWI proteins, analogs of Argonaute proteins. They are typically 24-31 nt in length. PiRNAs are primarily found in mammalian germ cells and stem cells, where they regulate gene silencing by binding to PIWI proteins to form the piRNA complex (piRC).

[0051] "miRNA backbone" or "miR backbone" are used interchangeably herein and refer to nucleic acid molecules or nucleotide fragments that can be used to express and produce small RNA molecules (such as siRNA molecules or miRNA molecules) in cells. The miRNA backbone may include the coding sequence of the small RNA molecule, a 5' flanking sequence located in the 5' direction of the coding sequence, a 3' flanking sequence located in the 3' direction of the coding sequence, and a Loop sequence (the transcription product of the Loop sequence corresponds to the loop sequence of the neck-loop structure RNA molecule produced after transcription of the miRNA backbone), wherein the Loop sequence may be located between the coding sequence and the 3' flanking sequence or between the coding sequence and the 5' flanking sequence. Therefore, in some embodiments, the miRNA backbone includes from 5' to 3' direction: 5' flanking sequence-coding sequence of the small RNA molecule-Loop sequence-3' flanking sequence; in other embodiments, the miRNA backbone includes from 5' to 3' direction: 5' flanking sequence-Loop sequence-coding sequence of the small RNA molecule-3' flanking sequence. In some embodiments, the miRNA backbone further comprises a compensatory sequence (or passenger strand) that is at least partially complementary (e.g., at least 80% complementary, at least 85% complementary, or at least 90% complementary) to the coding sequence of the microRNA, such that its transcription product forms a neck with the transcription product of the coding sequence in the neck-loop structure RNA molecule generated after transcription of the miRNA backbone. Therefore, in some embodiments, the miRNA backbone comprises, from 5' to 3' direction: 5' flanking sequence - coding sequence of the microRNA molecule - Loop sequence - compensatory sequence - 3' flanking sequence; in other embodiments, the miRNA backbone comprises, from 5' to 3' direction: 5' flanking sequence - compensatory sequence - Loop sequence - coding sequence of the microRNA molecule - 3' flanking sequence. In some embodiments, the length of the compensatory sequence is the same as the length of the coding sequence. In some embodiments, the length of the compensatory sequence is different from the length of the coding sequence, for example, 1-5 nucleotides longer or 1-5 nucleotides shorter than the coding sequence. In some embodiments, the expression product of the compensatory sequence provided herein is degraded as a passenger strand. The coding sequence (and compensatory sequence) of the small RNA molecule can be designed based on the target RNA molecule sequence and varies with the targeted RNA molecule sequence. In some embodiments, the miRNA backbone provided herein is obtained by modifying the mouse genomic sequence expressing miR-155. In some embodiments, the mouse miR-155 backbone used has the following sequence (hereinafter referred to as the "original miR-155 backbone sequence" or the original backbone system):

[0052]

[0053] 30 GTTTTGGCCACTGACTGAC(N)10-

[0054] Two of them (N) 10-30 The mature miRNA coding sequence and compensation sequence corresponding to the miR-155 molecule. The sequence shown in italics in the original backbone sequence corresponds to the above-mentioned 5' flanking sequence, the underlined sequence corresponds to the above-mentioned Loop sequence, and the sequence shown in bold corresponds to the above-mentioned 3' flanking sequence. The inventors unexpectedly found that by deleting several (e.g., 5-7) nucleotide bases at the 3' end of the 5' flanking sequence of the original backbone sequence and deleting several (e.g., 6-8) nucleotide bases at the 5' end of the 3' flanking sequence, the miRNA backbone obtained (called CG-miR-155 backbone) can increase the expression level of the miR-155 molecule, and by replacing the coding sequence and compensation sequence of the miR-155 molecule with the coding sequence and compensation sequence of the miRNA or siRNA molecule of a different sequence, the expression level of the miRNA molecule can also be enhanced. The inventors also found that the increase in expression level is not only reflected in the cells, but also in the exosomes secreted by the cells.

[0055] In some embodiments, the 5' flanking sequence in the modified miR-155 backbone provided herein includes the sequence shown in SEQ ID NO: 1, a sequence having at least 80% (e.g., at least 85%, 90%, or 95%) sequence identity with the sequence shown in SEQ ID NO: 1, or a sequence comprising up to 5 base differences (including insertions, deletions, or substitutions) compared to the sequence shown in SEQ ID NO: 1.

[0056] In some embodiments, the 3' flanking sequence in the modified miR-155 backbone provided herein includes the sequence shown in SEQ ID NO: 2, a sequence having at least 80% (e.g., at least 85%, 90%, or 95%) sequence identity with the sequence shown in SEQ ID NO: 2, or a sequence comprising up to 5 base differences (including insertions, deletions, or substitutions) compared to the sequence shown in SEQ ID NO: 2.

[0057] In some embodiments, the Loop sequence in the modified miR-155 backbone provided herein includes the sequence shown in SEQ ID NO: 3, a sequence having at least 80% (e.g., at least 85%, 90%, or 95%) sequence identity with the sequence shown in SEQ ID NO: 3, or a sequence comprising up to 5 base differences (including insertions, deletions, or substitutions) compared to the sequence shown in SEQ ID NO: 3.

[0058] In a preferred embodiment, the modified miR-155 backbone provided herein (hereinafter referred to as CG-miR-155 backbone) comprises the following sequence: GGATCCTGGAGGCTTGCTGAAGGCTGTATGCTG(N) 10- 30 GTTTTGGCCACTGACTGAC(N) 10-

[0059] 30 CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCACTCGAG (SEQ ID NO: 4), two of which (N) 10-30 The coding sequence and the compensatory sequence corresponding to the target small RNA molecule (e.g., siRNA or miRNA) can be of the same or different lengths. Compared to the original miR-155 backbone sequence, the 5' flanking sequence does not contain consecutive "AATTCG" bases at the 3' end, and does not contain consecutive "CACCGGT" bases at the 5' end of the 3' flanking sequence.

[0060] "Expression vector" herein refers to a nucleic acid construct used to express (transcribe) RNA that can be used to produce microRNA. The expression vectors provided herein can include the aforementioned CG-miR-155 backbone, an operably linked promoter, and appropriate transcription start and stop sequences. A "promoter" is a DNA sequence that RNA polymerase recognizes, binds to, and initiates transcription. It contains conserved sequences required for specific RNA polymerase binding and transcription initiation. Most are located upstream of the transcription start site; the promoter itself is not transcribed. The expression vectors provided herein can utilize promoters suitable for RNA polymerase II (e.g., CMV, EF1A, etc.) or promoters suitable for RNA polymerase III (e.g., U6, H1). In addition, the expression vectors may possess the ability to replicate in the host, typically conferred by an origin of replication, and / or carry a selection gene that facilitates identification of transformants. Typically, expression vectors utilized in recombinant DNA techniques are often in the form of "plasmids," i.e., circular double-stranded DNA loops. Obviously, vectors derived from viruses such as retroviruses and adenoviruses can also be used.

[0061] "Operably linked" means that a regulatory sequence is linked to its regulated partner in such a way that the regulatory sequence is able to exert its influence on the partner. For example, a promoter is "operably linked" to a gene of interest if the promoter is able to drive transcription of the gene of interest from a precise start site.

[0062] Exosomes are tiny membrane vesicles that can be secreted by numerous cells. They have a lipid bilayer membrane structure and a diameter of approximately 10-300nm (other sizes are also possible). Exosomes may contain proteins, lipids, and nucleic acids (such as small RNA molecules) specific to the secreting cells, and can serve as a medium for information and material exchange between cells. Exosomes play an important role in many physiological and pathological conditions, such as antigen presentation in immunity, tumor growth and migration, and repair of tissue damage. Exosomes secreted by different cells have different components and functions and can be used as biomarkers for disease diagnosis. Exosomes have a lipid bilayer membrane structure that can well protect the substances they encapsulate and can flow between cells or tissues. Therefore, they can be used as a tool for delivery and drug administration.

[0063] "Host cell" refers to a cell that can be or has been a recipient of an expression vector or isolated polynucleotide. Host cells can be prokaryotic or eukaryotic. Exemplary eukaryotic cells include mammalian cells, such as primate or non-primate cells; fungal cells, such as yeast; plant cells; and insect cells. Non-limiting exemplary mammalian cells include, but are not limited to, NSO cells, 293 and CHO cells, and derivatives thereof, such as 293-6E, CHO-DG44, CHO-K1, CHO-S, and CHO-DS cells. Host cells include the progeny of a single host cell, and the progeny may not necessarily be completely identical to the original parent cell (in terms of morphology or genomic DNA complement) due to natural, accidental, or deliberate mutations. Host cells also include cells transfected in vivo with a nucleic acid molecule or expression vector provided herein.

[0064] When referring to pharmaceutical compositions, the term "pharmaceutically acceptable carrier" refers to a solid or liquid diluent, filler, antioxidant, stabilizer, or other substance that can be safely administered to a subject without excessive adverse side effects and is suitable for maintaining the activity of the drug or active agent contained therein. Depending on the route of administration, various carriers well known in the art can be used, including, but not limited to, sugars, starch, cellulose and its derivatives, maltose, gelatin, talc, calcium sulfate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffer, emulsifiers, isotonic saline, and / or pyrogen-free water. The pharmaceutical compositions provided herein can be prepared into clinically acceptable dosage forms such as powders and injections. The pharmaceutical compositions of the present invention can be administered to a subject using any appropriate route, for example, orally, by intravenous infusion, intramuscular injection, subcutaneous injection, subperitoneally, rectally, sublingually, or by inhalation, transdermally, or other routes of administration. In preferred embodiments, the pharmaceutical compositions are formulated according to conventional procedures for intravenous or intramuscular administration. Typically, pharmaceutical compositions for intravenous or intramuscular administration are solutions in sterile isotonic aqueous buffer.

[0065] As used herein, "subject" refers to an animal, such as a mammal, including but not limited to humans, rodents, monkeys, felines, canines, equines, bovines, porcines, sheep, goats, mammalian experimental animals, mammalian farm animals, mammalian sports animals, and mammalian pets. The subject can be male or female and can be any age-appropriate subject, including infants, young children, young adults, adults, and elderly subjects. In some instances, a subject refers to an individual in need of treatment for a disease or condition. In some instances, the subject being treated can be a patient who suffers from a condition associated with the treatment or is at risk of developing the condition. In a specific instance, the subject is a human, such as a human patient. The term is generally used interchangeably with "patient," "test subject," "treatment subject," etc.

[0066] When referring to nucleotide sequences, the term "sequence identity" (also referred to as "sequence identity") refers to the amount of consistency between two nucleotide sequences (e.g., a query sequence and a reference sequence), generally expressed as a percentage. Typically, before calculating the percentage of consistency between two nucleotide sequences, the sequences are aligned and gaps (if any) are introduced. If the bases in the two sequences are the same at a certain alignment position, the two sequences are considered to be consistent or matched at that position; if the bases in the two sequences are different, they are considered to be inconsistent or mismatched at that position. In some algorithms, the number of matching positions is divided by the total number of positions in the alignment window to obtain sequence consistency. In other algorithms, the number of gaps and / or the length of the gaps are also taken into account. For the purposes of the present invention, the publicly available alignment software BLAST (available at the webpage ncbi.nlm.nih.gov) can be used to obtain the best sequence alignment and calculate the sequence consistency between the two nucleotide sequences using the default settings. In some embodiments, "at least 90% sequence identity" as described herein includes, but is not limited to, at least 95%, at least 98%, at least 99% or even 100% sequence identity.

[0067] In one aspect, the present invention provides a miR backbone sequence comprising a 5' flanking sequence, a loop sequence, and a 3' flanking sequence, wherein a coding sequence for a microRNA targeting a target nucleic acid (e.g., a target gene) can be inserted between the 5' flanking sequence and the loop sequence. The miR backbone sequence can enhance the expression level of the microRNA in cells and exosomes.

[0068] The 5' flanking sequence comprises the sequence of SEQ ID NO: 1 or a sequence having at least 80% homology thereto. Preferably, the 3' end of the 5' flanking sequence does not contain consecutive "AATTCG" bases. Preferably, the 5' flanking sequence comprises the sequence of SEQ ID NO: 1 or a variant sequence thereof having no more than 5 base differences therefrom.

[0069] The 3' flanking sequence comprises the sequence shown in SEQ ID NO: 2 or a sequence having at least 80% homology thereto. Preferably, the 5' end of the 3' flanking sequence does not contain consecutive "CACCGGT" bases. Preferably, the 3' flanking sequence comprises the sequence shown in SEQ ID NO: 2 or a variant sequence thereof having no more than 5 base differences therefrom.

[0070] The Loop sequence comprises the sequence shown in SEQ ID NO: 3 or a sequence having at least 80% homology thereto.

[0071] In some embodiments, the miR backbone is a CG-miR-155 backbone.

[0072] In another aspect, the present invention provides an expression vector comprising the miR backbone, a microRNA coding sequence, and a compensatory sequence. The compensatory sequence is reverse complementary to the microRNA coding sequence at least 80% of the time, and upon transcription, forms a stem-loop structure with the transcription product of the loop sequence. In some specific embodiments, the compensatory sequence is reverse complementary to the microRNA coding sequence at 90% of the time.

[0073] The coding sequence product of the microRNA comprises at least one siRNA, miRNA, shRNA or mRNA. Preferably, the microRNA comprises 10-30 nucleotides. Preferably, the microRNA is a siRNA that specifically silences the expression of a target gene.

[0074] In some specific embodiments, the miR backbone sequence from the 5' end to the 3' end is 5' flanking sequence-siRNA-loop sequence-compensatory sequence-3' flanking sequence.

[0075] The expression vector may further comprise a promoter sequence.

[0076] The expression vector further comprises a targeting sequence that targets a specific tissue or organ, or its encoded product (polypeptide) can be targeted to a specific tissue or organ.

[0077] The target gene is a disease-related gene that is highly expressed in diseased tissues. The diseases include but are not limited to neurological diseases, ophthalmic diseases (VEGF, VEGFR, ANG1, ANG2), infectious diseases, scar hyperplasia, chronic diseases or cancer.

[0078] The target genes include but are not limited to ataxin-2, SLN, SOD1, ATXN3, C9ORF72, HTT, VEGF, VEGFR, ANG1, ANG2, SARS-CoV-2, HBV, HCV, HIV, HPV, HSV, COX-2, TGF-beta, GBAI, PCSK9, LDL, KRAS, NKRAS, HRAS, EGFR, ATL, MET, PIK3CA, SHP1, SOX2, PTEN, TP53, Yap1, HIF1a, CDK1, CDK4, CDK6, NRF2, beta-Catenin, STAT3, Aurora A, CDH17, CXCR4, IDO1, CSF-1, NF-kB, NOTCH, SOX9, PD-L1, PD1, CTLA4, LAG3, TIGIT, COX-2, TGF-beta, VEGF, VEFGR, BRAF and other genes.

[0079] Preferably, the target gene is a cancer-related gene that is highly expressed in cancer tissues. The cancer-related gene includes but is not limited to KRAS and / or EGFR.

[0080] In some embodiments, the sequence of the small RNA molecule and the corresponding passenger strand sequence are shown in Table 1.

[0081] In another aspect, the present invention provides a pharmaceutical composition comprising the above-mentioned expression vector and an acceptable pharmaceutical carrier.

[0082] In another aspect, the present invention provides use of the miR framework or expression vector in the treatment of diseases.

[0083] In another aspect, the present invention provides a method for treating a disease, comprising injecting an effective dose of the above-mentioned expression vector or pharmaceutical composition into a subject.

[0084] The miR skeleton or expression vector provided by the present invention can significantly increase the expression level of small RNA molecules in cells and exosomes, and can also increase the expression level in vivo.

[0085] In some embodiments, the CG-miR-155 backbone is an optimized miR-155 backbone sequence, specifically comprising optimization of the 5' and 3' flanking sequences. After optimization, the 5' flanking sequence comprises the sequence shown in SEQ ID NO: 1 or a sequence having at least 80% homology thereto. Preferably, the 3' end of the 5' flanking sequence does not contain consecutive "AATTCG" bases. The 3' flanking sequence comprises the sequence shown in SEQ ID NO: 2 or a sequence having at least 80% homology thereto. Preferably, the 5' end of the 3' flanking sequence does not contain consecutive "CACCGGT" bases. Preferably, the Loop sequence comprises the sequence shown in SEQ ID NO: 3 or a sequence having at least 80% homology thereto. Preferably, the coding sequence of the target siRNA is inserted between the 5' flanking sequence and the Loop sequence or between the Loop sequence and the 3' flanking sequence. Preferably, a compensatory sequence corresponding to the target siRNA coding sequence is inserted between the loop sequence and the 3' flanking sequence or between the 5' flanking sequence and the loop sequence. Preferably, the compensatory sequence comprises a sequence that is fully complementary to the siRNA coding sequence or has at least 80% homology thereto. Preferably, the compensatory sequence, while fully complementary to the siRNA coding sequence, contains a deletion of 2-3 consecutive bases from bases 7-12 from the 5' end to the 3' end. Preferably, the compensatory sequence, while fully complementary to the siRNA sequence, contains a deletion of bases 9 and 10 from the 5' end to the 3' end.

[0086] The technical solutions of the present invention will be further described in detail below by way of examples and in conjunction with the accompanying drawings. Unless otherwise stated, the methods and materials of the embodiments described below are all conventional products that can be purchased on the market. Those skilled in the art will appreciate that the methods and materials described below are merely exemplary and should not be construed as limiting the scope of the present invention.

[0087] Example 1: CG-miR-155 backbone promotes expression of target nucleic acid si-mEGFR in cells and exosomes

[0088] Plasmids containing the small RNA si-mEGFR and its complementary sequences, as shown in SEQ ID NOs: 6 and 7, were prepared by direct synthesis, along with a CG-miR-155 backbone (SEQ ID NO: 4). GenScript Biotech provided plasmids containing a CMV promoter sequence. 1E6 cells / well of 293FT cells were transfected with 5 μg of each plasmid containing the corresponding sequence via PEI transfection. 48 hours after transfection, the cells and supernatant were harvested. Exosomes were isolated and collected from the culture supernatant using Total Exosome Isolation Reagent (from cell culture media) (Invitrogen, 4478360) according to the manufacturer's instructions. 1 ml RNAiso for Small RNA (TAKARA, 9753A) was added to the sample, shaken vigorously, and allowed to stand at room temperature for 5 minutes to lyse the cells and exosomes. 0.2 ml chloroform (Sinopharm, 67-66-3) was added, shaken vigorously, and allowed to stand at room temperature for 5 minutes. After the mixture was separated, the centrifuge tube was placed in a refrigerated centrifuge at 4°C and centrifuged at 14000g for 20 minutes. The upper transparent liquid was collected into a new centrifuge tube and an equal volume of isopropanol (Sinopharm, 67-63-0) was added. After inversion, the cell sample was allowed to stand at -20°C for 20 minutes, and the exosome sample was allowed to stand at -20°C overnight. The centrifuge tube after standing was placed in a refrigerated centrifuge at 4°C and centrifuged at 14000g for 20 minutes. The supernatant was removed. 1 ml 75% ethanol was added to wash the precipitate. The centrifuge tube was placed in a refrigerated centrifuge at 4°C and centrifuged at 14000g for 10 minutes. The supernatant was removed. After the liquid in the centrifuge tube was air-dried, RNase-free Dissolve the RNA precipitate in water (Yeasen, 10601ES76) and measure the RNA concentration. TM Reverse transcription was performed using the miRNA First Strand Synthesis Kit (TAKARA, 638315) using Mir-X TM miRNA qRT-PCR TB The qPCR kit (TAKARA, 638316) was used to detect the internal reference gene (U6 in cells and miR-16U6 in exosomes) and the target gene. The relative expression level of the target gene in the sample was calculated, as shown in Figure 1.

[0089] Example 2: CG-miR-155 backbone promotes the expression of small RNA molecules si-hKRAS in cells and exosomes

[0090] Plasmids were prepared by attaching the small RNA molecule si-hKRAS and its complementary sequence, as shown in SEQ ID NOs: 30-51, to the CG-miR-155 backbone (synthesis performed by GenScript Biotech). 1E6 cells / well of 293FT cells were transfected with 5 μg of plasmid carrying the corresponding sequence using the PEI transfection method. 48 hours after transfection, the cells and supernatant were collected. Exosomes were isolated and collected from the culture supernatant using Total Exosome Isolation Reagent (from cell culture media) (Invitrogen, 4478360) according to the instructions. 1 ml RNAiso for Small RNA (TAKARA, 9753A) was added to the sample, shaken vigorously, and allowed to stand at room temperature for 5 minutes to lyse the cells and exosomes. 0.2 ml chloroform (Sinopharm, 67-66-3) was added, shaken vigorously, and allowed to stand at room temperature for 5 minutes. After the mixture was separated, the centrifuge tube was placed in a refrigerated centrifuge at 4°C and centrifuged at 14000g for 20 minutes. The upper transparent liquid was collected into a new centrifuge tube and an equal volume of isopropanol (Sinopharm, 67-63-0) was added. After inversion, the cell sample was allowed to stand at -20°C for 20 minutes, and the exosome sample was allowed to stand at -20°C overnight. The centrifuge tube after standing was placed in a refrigerated centrifuge at 4°C and centrifuged at 14000g for 20 minutes, and the supernatant was removed. 1 ml 75% ethanol was added to wash the precipitate, and the centrifuge tube was placed in a refrigerated centrifuge at 4°C and centrifuged at 14000g for 10 minutes. The supernatant was removed. After the liquid in the centrifuge tube was air-dried, RNase-free Dissolve the RNA precipitate in water (Yeasen, 10601ES76) and measure the RNA concentration. TM Reverse transcription was performed using the miRNA First Strand Synthesis Kit (TAKARA, 638315) using Mir-X TM miRNA qRT-PCR TB The reference gene and target gene were detected by qPCR using the TAKARA PCR Kit (638316). The relative expression levels of the target genes in the samples were calculated, as shown in Figure 2.

[0091] Example 3: CG-miR-155 backbone promotes the expression of small RNA molecules si-hEGFR in cells and exosomes

[0092] Plasmids were prepared by attaching the small RNA molecule si-hEGFR and its complementary sequence, as shown in SEQ ID NOs: 8-29, to the CG-miR-155 backbone (synthesis performed by GenScript Biotech). 1E6 cells / well of 293FT cells were transfected with 5 μg of plasmid carrying the corresponding sequence using the PEI transfection method. 48 hours after transfection, the cells and supernatant were collected. Exosomes were isolated and collected from the culture supernatant using Total Exosome Isolation Reagent (from cell culture media) (Invitrogen, 4478360) according to the instructions. 1 ml RNAiso for Small RNA (TAKARA, 9753A) was added to the sample, shaken vigorously, and allowed to stand at room temperature for 5 minutes to lyse the cells and exosomes. 0.2 ml chloroform (Sinopharm, 67-66-3) was added, shaken vigorously, and allowed to stand at room temperature for 5 minutes. After the mixture was separated, the centrifuge tube was placed in a refrigerated centrifuge at 4°C and centrifuged at 14000g for 20 minutes. The upper transparent liquid was collected into a new centrifuge tube and an equal volume of isopropanol (Sinopharm, 67-63-0) was added. After inversion, the cell sample was allowed to stand at -20°C for 20 minutes, and the exosome sample was allowed to stand at -20°C overnight. The centrifuge tube after standing was placed in a refrigerated centrifuge at 4°C and centrifuged at 14000g for 20 minutes. The supernatant was removed. 1 ml 75% ethanol was added to wash the precipitate. The centrifuge tube was placed in a refrigerated centrifuge at 4°C and centrifuged at 14000g for 10 minutes. The supernatant was removed. After the liquid in the centrifuge tube was air-dried, RNase-free Dissolve the RNA precipitate in water (Yeasen, 10601ES76) and measure the RNA concentration. TM Reverse transcription was performed using the miRNA First Strand Synthesis Kit (TAKARA, 638315) using Mir-X TM miRNA qRT-PCR TB The internal reference gene and target gene were detected by qPCR using the TAKARA RT-PCR Kit (638316). The relative expression levels of the target genes in the samples were calculated, as shown in FIG3 .

[0093] Example 4: CG-miR-155 backbone promotes expression of small RNA molecules in vivo

[0094] A plasmid was prepared by attaching the small RNA molecule si-mEGFR to the CG-miR-155 backbone. C57 mice were injected intravenously with the plasmid at a dose of 80 mg / ml in a 2 ml injection volume within 7 seconds. Serum samples were collected 24 hours after injection. 1 ml RNAiso for Small RNA (TAKARA, 9753A) was added to the serum sample, shaken vigorously, and allowed to stand at room temperature for 5 minutes to lyse the cells and exosomes. 0.2 ml chloroform (Sinopharm, 67-66-3) was added, shaken vigorously, and allowed to stand at room temperature for 5 minutes. After the mixture was separated, the centrifuge tube was placed in a refrigerated centrifuge at 4°C and centrifuged at 14000g for 20 minutes; the upper transparent liquid was collected into a new centrifuge tube, and an equal volume of isopropanol (Sinopharm, 67-63-0) was added. After mixing, it was inverted and allowed to stand at -20°C overnight; the centrifuge tube after standing was placed in a refrigerated centrifuge at 4°C and centrifuged at 14000g for 20 minutes, and the supernatant was removed; 1 ml 75% ethanol was added to wash the precipitate, and the centrifuge tube was placed in a refrigerated centrifuge at 4°C and centrifuged at 14000g for 10 minutes. The supernatant was removed, and after the liquid in the centrifuge tube was air-dried, RNase-free The RNA precipitate was dissolved in water (yeasen, 10601ES76) and the RNA concentration was measured. The RT primers in the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, 4366597) and Custom TaqMan Small RNA Assay (Applied Biosystems, 4398987) were used for reverse transcription according to the instructions. TM qPCR was performed using Universal Master Mix II with UNG (Applied Biosystems, 4440038) and the probe-primer mixture in Custom TaqMan Small RNA Assay (Applied Biosystems, 4398987). Single-stranded siRNA was used as a standard, inverted, and serially diluted. qPCR was performed simultaneously with the samples to determine the relative amount of siRNA in the samples. The serum siRNA content was then calculated, as shown in Figure 4.

[0095] From the above results, it can be seen that the use of the miR backbone provided in this article can significantly increase the expression of target small RNA molecules by cells compared with the original backbone system, whether it is intracellular, secreted in vivo, or in animals.

[0096] The embodiments of the present invention are not limited to the above embodiments. Without departing from the spirit and scope of the present invention, ordinary technicians in this field can make various changes and improvements to the present invention in form and details, and these are all considered to fall within the scope of protection of the present invention.

[0097] The nucleotide sequences mentioned herein are shown in Table 1 below.

[0098] Table 1 Nucleotide sequence

Claims

1. An isolated nucleic acid molecule comprising, in the 5'-3' direction: 1) a 5' flanking sequence comprising the sequence shown in SEQ ID NO: 1 or a sequence having at least 80% sequence identity thereto; 2) Loop sequence comprising the sequence shown in SEQ ID NO: 3 or a sequence having at least 80% sequence identity thereto; as well as 3) a 3' flanking sequence comprising the sequence shown in SEQ ID NO: 2 or a sequence having at least 80% sequence identity thereto, The nucleic acid molecule further comprises a coding sequence for a small RNA molecule, and the coding sequence for the small RNA molecule is located between the 5' flanking sequence and the Loop sequence or between the Loop sequence and the 3' flanking sequence. 2 . The nucleic acid molecule of claim 1 , wherein the 5′ flanking sequence does not comprise the sequence AATTCG at its 3′ end, and / or the 3′ flanking sequence does not comprise the sequence CACCGGT at its 5′ end.

3. The nucleic acid molecule of claim 1 or 2, further comprising a compensatory sequence, wherein when the coding sequence of the small RNA molecule is located between the 5' flanking sequence and the Loop sequence, the compensatory sequence is located between the Loop sequence and the 3' flanking sequence; when the coding sequence of the small RNA molecule is located between the Loop sequence and the 3' flanking sequence, the compensatory sequence is located between the 5' flanking sequence and the Loop sequence, and the compensatory sequence is at least partially reverse complementary to the coding sequence of the small RNA molecule.

4. The nucleic acid molecule according to any one of claims 1 to 3, wherein the compensatory sequence is complementary to at least 80% of the bases in the coding sequence of the small RNA molecule; preferably, compared with a sequence that is completely reverse complementary to the coding sequence of the small RNA molecule, the compensatory sequence lacks any consecutive 2-3 bases from the 7th to 12th bases from its 5' end; more preferably, compared with a sequence that is completely reverse complementary to the coding sequence of the small RNA molecule, the compensatory sequence lacks the 9th and 10th bases from its 5' end.

5. The nucleic acid molecule according to any one of claims 1 to 4, wherein in the transcript RNA produced by transcription of the nucleic acid molecule, the transcription product of the coding sequence of the small RNA molecule, the Loop sequence and the compensation sequence can form a neck-loop structure, the transcription product of the coding sequence of the small RNA molecule and the transcription product of the compensation sequence form the neck of the neck-loop structure, and the transcription product of the Loop sequence forms the ring portion of the neck-loop structure. The nucleic acid molecule according to claim 1 , wherein the transcript RNA is a pre-miRNA.

7. The nucleic acid molecule according to any one of claims 1 to 6, wherein the small RNA molecule is a miRNA or siRNA molecule, preferably 20-24 nt in length.

8. The nucleic acid molecule of any one of claims 1 to 7, wherein the small RNA molecule targets a disease-related gene expressed in diseased tissue.

9. The nucleic acid molecule of any one of claims 1 to 8, wherein the disease-associated gene is selected from the group consisting of ataxin-2, SLN, SOD1, ATXN3, C9ORF72, HTT, VEGF, VEGFR, ANG1, ANG2, SARS-CoV-2, HBV, HCV, HIV, HPV, HSV, COX-2, TGF-beta, GBAI, PCSK9, LDL, KRAS, NKRAS, HRAS, EGFR, ATL, MET, PIK3CA, SHP1, SOX2, PTEN, TP53, Yap1, HIF1a, CDK1, CDK4, CDK6, NRF2, beta-Catenin, STAT3, Aurora A, CDH17, CXCR4, IDO1, CSF-1, NF-kB, NOTCH, SOX9, PD-L1, PD1, CTLA4, LAG3, TIGIT, COX-2, TGF-beta, VEGF, VEFGR, BRAF, KRAS, and EGFR genes.

10. The nucleic acid molecule of any one of claims 1 to 9, wherein the sequence of the small RNA molecule is as shown in any one of SEQ ID NOs: 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, or 50.

11. The nucleic acid molecule according to any one of claims 1 to 10, wherein: 1) The sequence of the small RNA molecule is shown in SEQ ID NO: 6, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 7; 2) The sequence of the small RNA molecule is shown in SEQ ID NO: 8, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 9; 3) The sequence of the small RNA molecule is shown in SEQ ID NO: 10, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 11; 4) The sequence of the small RNA molecule is shown in SEQ ID NO: 12, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 13; 5) The sequence of the small RNA molecule is shown in SEQ ID NO: 14, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 15; 6) The sequence of the small RNA molecule is shown in SEQ ID NO: 16, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 17; 7) The sequence of the small RNA molecule is shown in SEQ ID NO: 18, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 19; 8) The sequence of the small RNA molecule is shown in SEQ ID NO: 20, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 21; 9) The sequence of the small RNA molecule is shown in SEQ ID NO: 22, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 23; 10) The sequence of the small RNA molecule is shown in SEQ ID NO: 24, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 25; 11) The sequence of the small RNA molecule is shown in SEQ ID NO: 26, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 27; 12) The sequence of the small RNA molecule is shown in SEQ ID NO: 28, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 29; 13) The sequence of the small RNA molecule is shown in SEQ ID NO: 30, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 31; 14) The sequence of the small RNA molecule is shown in SEQ ID NO: 32, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 33; 15) The sequence of the small RNA molecule is shown in SEQ ID NO: 34, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 35; 16) The sequence of the small RNA molecule is shown in SEQ ID NO: 36, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 37; 17) The sequence of the small RNA molecule is shown in SEQ ID NO: 38, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 39; 18) The sequence of the small RNA molecule is shown in SEQ ID NO: 40, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 41; 19) The sequence of the small RNA molecule is shown in SEQ ID NO: 42, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 43; 20) The sequence of the small RNA molecule is shown in SEQ ID NO: 44, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 45; 21) The sequence of the small RNA molecule is shown in SEQ ID NO: 46, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 47; 22) The sequence of the small RNA molecule is shown in SEQ ID NO: 48, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO: 49; or 23) The sequence of the small RNA molecule is shown in SEQ ID NO: 50, and the RNA sequence produced by transcription of the compensatory sequence is shown in SEQ ID NO:

51.

12. An expression vector comprising the nucleic acid molecule according to any one of claims 1 to 11.

13. The expression vector of claim 12, further comprising a promoter sequence operably linked to the nucleic acid molecule.

14. The expression vector according to claim 12 or 13, wherein The vector is selected from a plasmid vector, an adeno-associated virus vector, an adenovirus vector, a retrovirus vector or a lentivirus vector.

15. A host cell comprising the nucleic acid molecule of any one of claims 1 to 11 or the expression vector of claim 12, 13 or 14.

16. A method for producing a small RNA molecule, comprising culturing the host cell of claim 15 and optionally isolating the small RNA molecule.

17. A method for producing exosomes comprising small RNA molecules, comprising culturing the host cell of claim 15 and isolating the exosomes from the culture supernatant.

18. Use of the nucleic acid molecule according to any one of claims 1 to 11, the expression vector according to claim 12, 13 or 14, or the host cell according to claim 15 in preparing small RNA molecules.

19. A pharmaceutical composition comprising: 1) The expression vector of claim 12, 13 or 14 or the host cell of claim 15; as well as 2) Pharmaceutically acceptable carrier.

20. Use of the expression vector according to claim 12, 13 or 14 or the host cell according to claim 15 in the preparation of a medicament for treating a disease, wherein the disease is associated with abnormal gene expression or mutation.

21. A method for treating a disease in a subject, comprising administering a therapeutically effective amount of the expression vector of claim 12, 13 or 14 or the host cell of claim 15 to the subject, wherein the disease is associated with abnormal gene expression or mutation.