Alkaline protease mutant and use thereof

Abstract

The application belongs to the technical field of enzyme engineering, and particularly relates to a basic protease mutant and application thereof. The application provides a basic protease mutant, which is based on 2709 basic protease gene derived from bacillus licheniformis, and is obtained by random mutation through error-prone PCR and then screening. The basic protease obtained by the application can resist high-salt environment, can maintain good activity and enzymolysis efficiency in the high-salt environment, and after being treated in 20% (w / v) NaCl high-salt environment for 3 hours, the protease activity retention rate is increased by 25-50% compared with the original protease, the enzymolysis capacity in the 20% (w / v) NaCl high-salt environment is nearly 2-3 times that of the original protease, and the application can meet the application requirements in high-salt scenes such as food fermentation.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of enzyme engineering, and particularly relates to a basic protease mutant and application thereof. BACKGROUND

[0002] The basic protease refers to a kind of enzyme capable of hydrolyzing protein peptide bonds in an alkaline pH range, has a wide range of action and strong hydrolysis capacity, is one of the enzymes with the largest amount used in the industry at present, and is an important enzyme preparation in the industries of detergent production, food industry, medicine, feed, chemical industry, waste treatment and leather manufacturing. Microorganisms have become the main source of industrial basic protease preparation due to their higher production efficiency, low requirement for growth conditions and easy modification.

[0003] Among the basic proteases from microorganisms, the basic proteases from Bacillus, represented by Bacillus licheniformis, have become the main source of basic proteases due to their stronger enzyme activity and environmental tolerance. The 2709 basic protease is purified from the original body of Bacillus licheniformis 2709 through deep fermentation, has strong protein hydrolysis capacity, and the process of hydrolyzing protein is mild, and the product is non-toxic and harmless. The 2709 basic protease is a kind of industrial basic protease with the highest domestic rate and the most common use at present. Nowadays, the application field of the 2709 basic protease is becoming wider, and it has been widely used in the food industry, the textile industry, the washing industry and the pharmaceutical industry.

[0004] At present, there are many researches on the modification and application of the 2709 basic protease from Bacillus licheniformis and its host. For example, patent CN114908074A discloses that some sites of the 2709 basic protease are predicted and modified using the method of molecular dynamics calculation, so that the 2709 basic protease has stronger stability and enzyme activity in aqueous solution. Patent CN112239743A discloses that the Bacillus licheniformis producing the 2709 protease is modified, so that it has stronger 2709 expression and production capacity. It has been proved by the current research that the 2709 basic protease from Bacillus licheniformis has good effect and high enzyme activity in the enzymolysis of soybean and other raw materials, and has good application prospect in food production. However, in the food industry and other industries, especially in the fermentation production of condiments, enzymes are generally used for enzymolysis reaction in a high-salt environment. Although the 2709 basic protease has been proved to have strong enzymolysis capacity, it has poor tolerance to high-salt environment, and cannot effectively exert its degradation capacity, thereby greatly limiting its application range.

[0005] It is a good enzyme improvement strategy to construct a protease mutant with better performance by changing the amino acid sequence of a specific site, and it has little effect on the characteristics of the protease itself. However, there is still no study to construct a 2709 alkaline protease mutant that can work in a high-salt environment. Developing or finding a 2709 protease that can tolerate high-salt environment and can exert its enzymatic ability in a salt environment will have important value and significance for expanding its application range. SUMMARY

[0006] Based on the above technical problems, the main purpose of the present application is to overcome the shortcomings of the background art. The 2709 alkaline protease gene is used as a template, and the alkaline protease gene is randomly mutated by error-prone PCR. Then, the alkaline protease mutant gene that can tolerate high-salt environment is obtained by screening. The expressed alkaline protease still maintains high activity in high-salt environment, which meets the application requirements in high-salt environment.

[0007] To achieve the above-mentioned purpose, the inventors have conducted in-depth research and completed the present application scheme after repeated research and demonstration, as follows:

[0008] In a first aspect, the present application provides an alkaline protease mutant, wherein the amino acid sequence of the alkaline protease mutant is shown in any one of SEQ ID NO. 2-3.

[0009] In a second aspect, the present application provides a gene, wherein the gene encodes the above-mentioned alkaline protease mutant.

[0010] In a third aspect, the present application provides a recombinant expression vector, wherein the recombinant expression vector carries a gene encoding the above-mentioned alkaline protease mutant.

[0011] The vector backbone of the recombinant vector can be selected by a person skilled in the art according to the needs of implementation, and can be any vector with expression ability disclosed or not disclosed in the art, including but not limited to eukaryotic vectors and prokaryotic vectors. Preferably, the pBE vector is used. The protease gene of the present application is inserted into a suitable site of the expression vector, so that the nucleotide sequence thereof is operably linked to the expression regulatory sequence. As a preferred embodiment of the present application, the original promoter and signal peptide of the pBE vector are replaced by the p43 and pamyQ double promoters and the mpr secretion signal peptide.

[0012] In a fourth aspect, the present application provides a recombinant host cell, wherein the recombinant host cell is a host cell transformed / transfected with the above-mentioned recombinant expression vector.

[0013] The base cell of the host cell can be any cell type with expression ability disclosed or not disclosed in the art, including but not limited to eukaryotic cells or prokaryotic cells; preferably Bacillus, further preferably Bacillus subtilis.

[0014] In a fifth aspect, the embodiments of the present application provide application of the above-mentioned recombinant vector or recombinant host cell in production of alkaline protease.

[0015] In a sixth aspect, the embodiments of the present application provide application of the above-mentioned alkaline protease mutant in degradation of protein and peptide chain.

[0016] In a seventh aspect, the embodiments of the present application provide application of the above-mentioned alkaline protease mutant in food fermentation; specifically, the alkaline protease mutant can be used for enzymatic hydrolysis of high-salt fermented soybean meal.

[0017] In an eighth aspect, the embodiments of the present application provide an enzyme preparation, which comprises the above-mentioned alkaline protease mutant.

[0018] The one or more technical solutions provided in the embodiments of the present application have at least the following technical effects or advantages:

[0019] 1. The present application provides an alkaline protease mutant, which has significantly improved salt tolerance of expressed alkaline protease compared with the original protein. After 3h of high-salt environment treatment with 20%(w / v) NaCl, the protease enzyme activity retention rate is increased by 25-50% compared with the original protease, and the enzymatic hydrolysis capacity is nearly 2-3 times that of the original protease in 20%(w / v) NaCl high-salt environment.

[0020] 2. The alkaline protease mutant provided by the present application can maintain good activity and enzymatic hydrolysis efficiency in high-salt environment. In 18%(w / v) salt water environment, the content of amino acid nitrogen produced by hydrolysis of soybean meal is increased by more than 20% compared with the original protease, and the total nitrogen content is increased by 10%.

[0021] The content of amino acid nitrogen produced by hydrolysis of soybean meal is increased by more than 20% compared with the original protease, and the total nitrogen content is increased by 10%. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 The pBE vector map used in the present experiment is shown in the following figure:

[0023] Figure 2 The stability determination results of each alkaline protease in salt environment are shown in the following figure:

[0024] Figure 3 The enzymatic hydrolysis capacity determination results of each alkaline protease in salt environment are shown in the following figure:

[0025] Figure 4 The results of enzymatic hydrolysis of each alkaline protease on amino nitrogen of soybean meal are shown in the following figure:

[0026] Figure 5 Figure 1 shows the results of the total nitrogen of the soybean dregs hydrolyzed by each alkaline protease. DETAILED DESCRIPTION

[0027] In order to facilitate the understanding of the present application, a more comprehensive description of the present application will be given below. However, the present application can be realized in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs.

[0029] Unless specifically noted, the reagents, methods and equipment used in the present application are conventional reagents, methods and equipment in the art.

[0030] The terms used in the specification of the present application herein are only for the purpose of describing the specific embodiments and are not intended to limit the present application. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0031] The terms and related determination methods involved in the present application are explained as follows:

[0032] 1. Protease enzyme activity determination method: The protease enzyme activity determination method GB / T 23527.1-2023 of the People's Republic of China is adopted; 1 ml of casein substrate (10.0 g / L pH=10.4) is mixed with protease fermentation broth of different sources, and the reaction is carried out at 40℃ for 10 min, then 2 ml of trichloroacetic acid solution (0.4 mol / L) is added to terminate the reaction, the supernatant is obtained by centrifugation from the suspension, 5 ml of sodium carbonate solution (0.4 mol / L) and 1 ml of Folin solution are added and reacted for 20 min, then the protease activity is determined according to the absorbance at 680 nm.

[0033] 2. The protease activity is defined as: the amount of protease required to hydrolyze 1 μg of tyrosine from casein at 40℃ and pH=10.4 in 1 min, which is 1 protease activity unit U.

[0034] Example 1 Construction of alkaline protease expression vector

[0035] 1. With the genomic DNA of Bacillus licheniformis 2709 strain as the template, the 2709 alkaline protease complete gene is amplified by PCR, and the encoded amino acid sequence is SEQ ID NO: 1. The PCR amplification conditions are as follows: 98℃ for 2 min; 98℃ for 10 s, 57℃ for 15 s, 72℃ for 30 s, 32 cycles; 72℃ for 5 min. After PCR amplification, a 2709 alkaline protease gene fragment with a size of about 1000 bp is obtained.

[0036] 2. With pBE plasmid (laboratory construction, plasmid map as shown in Figure 1 ) as the template, PCR amplification is performed to complete the linearization of the vector. The PCR amplification conditions are as follows: 98℃ for 2 min; 98℃ for 20 s, 57℃ for 20 s, 72℃ for 2 min, 32 cycles; 72℃ for 5 min. After PCR amplification, a linearized pBE plasmid with a size of about 8000 bp is obtained.

[0037] 3. The linearized pBE plasmid and the 2709 alkaline protease gene fragment are connected, and the product is transformed into DH5α competent cells. Colony PCR is performed using 2709 alkaline protease gene amplification primers to verify and screen positive clones to extract plasmid, which is pBE-2709 expression vector.

[0038] Example 2 Construction of alkaline protease mutants

[0039] 1. The pBE-2709 expression vector is amplified by error-prone PCR to introduce mutations and construct a mutant library, and then effective alkaline protease mutants are isolated by screening. The primers for mutation PCR are as follows:

[0040] F: 5'-atgatccggatgtcgcttatgtggaagaggatcatgtggcccatgccttg-3'

[0041] R: caaggtttctagactatttgcccggtggtcgaccccgggctgttatttacgc-3'

[0042] In the error-prone PCR reaction system, the above primers are used as the upstream and downstream primers, and the pBE-2709 expression vector is used as the template to perform error-prone PCR, and base mutations are randomly introduced into the 2709 gene. The error-prone PCR product is recovered by gel recovery and connected with the linearized pBE plasmid, and the connection product is transformed into the competent cells of Bacillus subtilis SCK6 to construct a mutant library.

[0043] 2. Screening of the mutant library

[0044] The activated mutant bacteria were plated on LB plates containing 5% (w / v) skim milk powder and 50 μg / mL ampicillin, and incubated at 37°C for 12-16 hours. The transparent zones produced by the colonies were observed, and the colonies with larger transparent zones were selected and inoculated into deep well plates and incubated at 37°C for 24 hours.

[0045] A 4% (w / v) skim milk powder solution containing 20% (w / v) NaCl was prepared. 500 μL of the bacterial solution obtained in the previous step was mixed with 1.5 mL of the skim milk powder solution, and enzymolysis was performed at 40°C for 3 hours. The absorbance at 600 nm of the enzymolysis product was then measured. The mutant strains with stronger salt tolerance were selected according to the absorbance values. Two mutant strains with stronger salt tolerance were obtained, and were named mu-3 and mu-8. The mutant plasmids pBE-mu-3 and pBE-mu-8 were extracted from the corresponding strains.

[0046] The mutant plasmids pBE-mu-3 and pBE-mu-8 were transformed into B. subtilis WB800N cells, and positive transformants were selected to obtain recombinant strains expressing alkaline protease, which were named WB800N-mu-3 and WB800N-mu-8, respectively. The amino acid sequences of the expressed alkaline proteases are shown in SEQ ID NOs: 2-3.

[0047] Example 3: Determination of the properties of alkaline protease

[0048] 1. Preparation of protease solution: the recombinant strains prepared in Example 2 were inoculated into 2 mL of LB medium, and incubated at 37°C and 220 rpm for 8 hours. Then, the strains were inoculated into 400 mL of LB medium, and incubated at 37°C and 220 rpm for 12 hours to obtain seed solution. The seed solution was inoculated into a fermenter, and incubated at 37°C. The rotation speed was initially set to 25 Hz, and the air flow was set to 600 m 3 / h. After 2 hours of fermentation, the rotation speed was adjusted to 50 Hz, and the air flow was adjusted to 900 m 3 / h. The glucose content was controlled at 1-2 g / L during the fermentation process. After 24 hours of fermentation, the fermentation was terminated by discharging the fermentation broth. The WB800N recombinant strain transformed with the unmutated pBE-2709 was used as a control.

[0049] 4% diatomite and perlite were added to the fermentation broth, and stirred for 30 minutes before plate and frame filtration. The filtrate was concentrated to 1 / 20 of the initial volume using a 10 KDa molecular weight hollow fiber column. Then, 20% glycerol and 0.1% sodium benzoate were added to prepare different alkaline protease solutions.

[0050] Fermentation medium: 300g corn steep liquor powder, 120g yeast powder FB00, 12g dipotassium hydrogen phosphate trihydrate, 12g magnesium sulfate heptahydrate, 12g defoamer, add water to 6L and then load into a 20L fermentation tank, and adjust the initial pH to 7.5 with ammonia water.

[0051] 2. Determination of the stability of alkaline protease in salt environment: Take different alkaline protease solutions, place them in a buffer solution containing 20% ​​(w / v) NaCl and incubate them. Samples of the enzyme solution are taken after 1 hour, 2 hours and 3 hours respectively. The residual enzyme activity of each alkaline protease is then measured and the results are recorded in Figure 2 middle.

[0052] like Figure 2 As shown, the activity of each alkaline protease decreased after salt treatment, but the extent of the decrease in each mutant was greater than that of the original 2709 protease. The original protease lost 50% of its activity after 1 hour of salt treatment, while the mutant proteases mu-3 and mu-8 only lost 20-25% of their activity over the same period. After 3 hours of salt treatment, the activity loss in each group stabilized, with 41% of the 2709 protease remaining, 51% of the mutant protease mu-3, and 62% of the mutant protease mu-8.

[0053] 3. Determination of enzymatic activity of alkaline protease in salt environment: Take different alkaline protease solutions, dilute them with buffer containing NaCl to make the final concentration of NaCl 5%, 10%, 15%, 20% (w / v), then mix them with casein substrate containing corresponding concentration of NaCl, and measure the enzymatic activity of each alkaline protease. Use the alkaline protease solution diluted with buffer without NaCl at the same multiple as the control, calculate the relative retention rate of each alkaline protease under different salt concentrations, and record the results in Figure 3 middle.

[0054] like Figure 3 As shown, when reacting in a salty environment, the retained enzymatic activity of each mutant protease was improved compared to that of the 2709 protease. At 10% salt, the enzymatic activity of each group began to decline significantly, with the original protease losing 71% of its activity, while the two mutant proteases lost 37% and 50%, respectively, less than that of the 2709 protease. At 20% salt, the mutant protease mu-8 retained the highest activity at 22%, while the mutant protease mu-3 retained 17%. The original 2709 protease retained only 8% of its activity.

[0055] Example 4 Alkaline protease mutant application effect test

[0056] Soy sauce residue is the residual product of soy sauce fermentation enzymatic hydrolysis. It is composed of proteins and other impurities that cannot be degraded by the original fermentation enzyme system. It is very difficult to degrade. Further degradation of the soy sauce residue helps to improve the utilization rate of raw materials. 2709 protease has a good effect in the enzymatic hydrolysis of soy protein and has a certain ability to decompose soy sauce residue. However, due to the high salt environment during the fermentation process, it cannot play a good role. Using mutants to test the enzymatic hydrolysis of soy sauce residue in a salt environment can effectively characterize whether the mutants can decompose difficult-to-degrade proteins in a real high-salt fermentation environment. Its improvement is of great significance to the utilization rate of high-salt fermentation raw materials.

[0057] 1. Configuration of the enzymatic hydrolysis reaction system for the sauce residue: Take the sauce residue and dry it at low temperature, then grind it into a uniform and fine powder. Take 2g of the sauce residue and add it to a 100ml conical flask. Add 18% (w / v) saline to make the weight up to 20g. Shake the material to mix it thoroughly, boil it in a boiling water bath for 40min, and cool it naturally to complete the preparation.

[0058] 2. Prepare mutant protease mu-3 and mu-8 enzyme solutions according to the method in Example 3. After measuring the enzyme activity, add the enzyme solution to the sauce residue enzymatic hydrolysis reaction system configured in the previous step at an access amount of 6000U. Shake the materials to mix them thoroughly. Then put them in a 30°C incubator and perform enzymolysis at 200rpm. After 5 days of enzymolysis, take samples and measure the amino acid nitrogen content and total nitrogen content. The results are recorded in Figures 4-5 middle.

[0059] like Figure 4 and Figure 5 As shown, the two mutant proteases showed improved enzymatic hydrolysis effects on sauce residue in a high-salt environment compared to the original 2709 protease. The ammonia nitrogen and total nitrogen contents of the 2709 protease were similar to those of the blank control group without enzyme addition, indicating that the 2709 protease does not have the ability to enzymatically hydrolyze the sauce residue substrate in a high-salt environment. The ammonia nitrogen contents of the enzymatic hydrolysis products of the mutant proteases mu-3 and mu-8 were 0.072g / 100mL and 0.076g / 100mL, respectively, which were 20% and 26% higher than those of 2709 under the same environment. The enzymatic hydrolysis product of the mutant protease mu-8 had the highest total nitrogen content, at 0.176g / 100g, an 11% increase compared to the enzymatic hydrolysis product of the 2709 protease; the total nitrogen content of the enzymatic hydrolysis product of the mutant protease mu-3 was 0.169g / 100g, an increase of 9% compared to the enzymatic hydrolysis product of the 2709 protease.

[0060] The above embodiments only express several implementation manners of the present application, and the description is more specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are within the scope of protection of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims.

Claims

1. A mutant of alkaline protease, characterized in that, The amino acid sequence of the alkaline protease mutant is shown in any one of SEQ ID NO. 2-3.

2. A gene, characterized in that, The gene encodes the alkaline protease mutant of claim 1.

3. A recombinant expression vector, characterized in that, The recombinant expression vector carries the gene of claim 2.

4. A recombinant host cell, characterized in that, The recombinant host cell is a host cell transformed / transfected with the recombinant expression vector of claim 3.

5. The recombinant host cell of claim 4, wherein, The host cell is Bacillus subtilis.

6. Use of the recombinant vector of claim 3 or the recombinant host cell of claim 4 in the production of alkaline protease.

7. Use of the alkaline protease mutant of claim 1 in the degradation of protein and peptide chains.

8. Use of the alkaline protease mutant of claim 1 in food fermentation.

9. Use according to claim 8, wherein the compound is ###0002### The use is for the enzymatic hydrolysis of high-salt fermented soybean residue.

10. An enzyme preparation, characterized in that, The enzyme preparation comprises the alkaline protease mutant of claim 1.

Images