A method for breeding potato by editing ALS gene
By optimizing the Agrobacterium infection method and using imidazolinone herbicides for screening, the problem of limited screening systems in existing potato breeding has been solved, enabling the efficient acquisition of ALS gene-mutant resistant potato varieties and improving transformation efficiency and screening effect.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-31
- Publication Date
- 2026-04-10
AI Technical Summary
Existing potato genetic transformation and gene editing methods have limited screening systems, making it difficult to efficiently obtain potato varieties resistant to imidazolinone herbicides.
A potato breeding method using gene-edited ALS gene was employed. Potato explants were infected with Agrobacterium tumefaciens transformed with gene-editing tools. By optimizing the CaCl2 and MS medium concentrations in the infection medium and using imidazolinone herbicides for direct screening, a system for inducing resistant callus, resistant shoots, and strong seedlings was established to obtain potato varieties with ALS gene mutations.
High infection and gene editing efficiency were achieved, potato varieties resistant to imidazolinone herbicides were obtained, the probability of regeneration of seedlings in the genetic transformation system was optimized, and the transformation efficiency was improved.
Smart Images

Figure CN120400209B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of crop breeding, and relates to a potato breeding method for genetically editing ALS genes. BACKGROUND
[0002] Potato (Solanum tuberosum L.) belongs to the Solanaceae family and is a herbaceous dicotyledonous perennial tuber plant. It is an important food and vegetable crop and has multiple uses such as feed, light industry and raw materials. Potato is the fourth largest food crop in China, ranking second only to rice, wheat and corn, and its total yield ranks first in the world.
[0003] The common genetic transformation methods for potato currently include the gene gun method, the ultrasonic wave method, the protoplast method and the Agrobacterium-mediated genetic material delivery method. Among them, the Agrobacterium-mediated genetic transformation method is widely used in plant transgenic delivery due to its convenient operation, high repeatability and low cost. The Agrobacterium-mediated genetic transformation method has many advantages, such as efficient insertion of exogenous genes, simple fragments of inserted exogenous DNA, low copy number of exogenous genes and wide application in commercial event development. In view of the many advantages of the Agrobacterium-mediated genetic transformation method, it is of great significance to further optimize the method and improve the transformation efficiency.
[0004] At present, the commonly used screening systems for potato genetic transformation and gene editing include kanamycin screening system and Bar screening system, and it is necessary to develop a new screening system. SUMMARY
[0005] The purpose of the present application is to provide a potato breeding method for genetically editing ALS genes, so as to obtain potato varieties with ALS gene mutations at high infection efficiency and high gene editing efficiency, and make the potato varieties resistant to imidazolinone herbicides.
[0006] To achieve this purpose, in the basic embodiment, the present application provides a potato breeding method for genetically editing ALS genes, which comprises the following steps:
[0007] (1) using Agrobacterium transformed with a gene editing tool to infect potato explants, and the infection medium used in the infection contains CaCl2 at a total concentration of 9-15 mM, and the gene editing tool targets potato ALS genes for editing mutation of ALS genes, so as to make the potato resistant to imidazolinone herbicides;
[0008] (2) After co-cultivation and recovery culture, the potato explants are subjected to resistant callus induction, resistant bud induction and seedling culture in turn on resistant callus induction medium, resistant bud induction medium and seedling medium, and the resistant callus induction medium, resistant bud induction medium and seedling medium all contain imidazolinone herbicide.
[0009] The present application uses imidazolinone herbicide to directly screen potato ALS mutant genes. Acetolactate synthase (ALS, EC 2.2.1.6) is one of the key enzymes in the biosynthesis pathway of branched-chain amino acids (valine, leucine and isoleucine) in plants and microorganisms, and ALS inhibitor herbicides have the advantages of wide herbicidal spectrum, strong selectivity, low toxicity and high efficiency, and low soil residual activity. Currently developed ALS inhibitor herbicides can be divided into 13 categories and more than 50 types, including sulfonylureas (SU), pyrimidinyloxy benzoic acids (PTB, also known as pyrimidyl salicylic acids), imidazolinones (IMI) and triazolopyrimidine sulfonanilides (SUT) and other main types. Their mechanism of action is to inhibit the activity of acetolactate synthase, thereby affecting the synthesis of branched-chain amino acids and affecting the synthesis of proteins, ultimately leading to the death of plants. There are some conserved amino acids in ALS genes, for example, Ala at positions 122 and 205, Pro, Asp, Arg, Trp, Ser and Gly at positions 197, 376, 377, 574, 653 and 654 in Arabidopsis thaliana, and changes in these amino acids can lead to resistance to ALS inhibitor herbicides. Imidazolinone herbicides are ideal selection agents in genetic transformation due to their good absorption, stability and resistance to photolysis.
[0010] In a preferred embodiment, the present application provides a potato breeding method for genetically editing ALS genes, wherein in step (1), the gene editing tool carries a gene expressing Cas9 protein and carries sgRNA.
[0011] In a preferred embodiment, the present application provides a potato breeding method for genetically editing ALS genes, wherein in step (1), the Agrobacterium is Agrobacterium LBA4404.
[0012] In a preferred embodiment, the present application provides a potato breeding method for genetically editing ALS gene, wherein in step (1), a stem section or a leaf of a potato plant cultured for 21-28 days is taken for pre-culture to obtain the potato explant for infection.
[0013] In a preferred embodiment, the present application provides a potato breeding method for genetically editing ALS gene, wherein the variety of the potato plant is Fueruita.
[0014] In a preferred embodiment, the present application provides a potato breeding method for genetically editing ALS gene, wherein the length of the stem section is 0.5-2 mm.
[0015] In a preferred embodiment, the present application provides a potato breeding method for genetically editing ALS gene, wherein in step (1), the coding sequence of ALS gene is shown as SEQ ID NO: 1, and the coding sequence of ALS gene mutant is shown as SEQ ID NO: 3.
[0016] The amino acid sequence of the protein encoded by the ALS gene shown as SEQ ID NO: 1 is shown as SEQ ID NO: 2. The amino acid sequence of the protein encoded by the ALS gene mutant shown as SEQ ID NO: 3 is shown as SEQ ID NO: 4.
[0017] In a preferred embodiment, the present application provides a potato breeding method for genetically editing ALS gene, wherein the imidazolinone herbicide is imazapyr.
[0018] In a preferred embodiment, the present application provides a potato breeding method for genetically editing ALS gene, wherein the infection and co-culture use an infection medium and a co-culture medium both containing 1xMS.
[0019] In a preferred embodiment, the present application provides a potato breeding method for genetically editing ALS gene, wherein the breeding method comprises the following steps:
[0020] (1) Preparing explants: taking a stem section or a leaf of a potato plant cultured in a culture bottle, making a wound with a scalpel, and then placing it on a pre-culture medium for pre-culture;
[0021] (2) After pre-culture, the potato stem section or leaf is infected with a bacterial solution of Agrobacterium transformed with a gene editing tool, and then dried with filter paper;
[0022] (3) Co-culturing the infected potato stem section or leaf on a co-culture medium;
[0023] (4) the potato stem segments or leaves at the end of the co-culture are subjected to recovery culture on a recovery medium;
[0024] (5) the potato stem segments at the end of the recovery culture are subjected to resistance callus induction on a resistance callus induction medium;
[0025] (6) the potato stem segments at the end of the resistance callus induction or the leaves after the recovery culture are subjected to resistance bud induction on a resistance bud induction medium;
[0026] (7) the regenerated buds are subjected to strong seedling culture on a strong seedling medium to obtain strong regenerated seedlings.
[0027] Preferably, in step (1), the pre-culture medium comprises 4.43 g / L MS salts and vitamins + 30 g / L sucrose + 6.0 g / L agar, pH = 5.8, and the pre-culture is a light culture for 48 h.
[0028] Preferably, in step (1), the leaf explants are cut transversely to the main leaf veins using a scalpel.
[0029] Preferably, in step (2), the infection medium used for the infection comprises 4.43 g / L MS salts and vitamins + 20 g / L sucrose + 10 g / L glucose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 50 μM AS, pH = 5.6.
[0030] Preferably, in step (2), the OD of the bacterial solution is 0.3. 600
[0031] Preferably, in step (2), the infection time is 15 min.
[0032] Preferably, in step (2), the room temperature during the infection is lower than 28°C.
[0033] Preferably, in step (3), the co-culture medium comprises 4.43 g / L MS salts and vitamins + 20 g / L sucrose + 10 g / L glucose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 50 μM AS, pH = 5.6.
[0034] Preferably, in step (4), the recovery medium comprises 4.43 g / L MS salts and vitamins + 30 g / L sucrose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 6.0 g / L agar + 250 mg / L cefotaxime + 100 mg / L timentin, pH = 5.8.
[0035] Preferably, in step (5), the resistant callus induction medium comprises 4.43 g / L MS salts and vitamins + 30 g / L sucrose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 6.0 g / L agar + 250 mg / L cefotaxime + 100 mg / L timentin + 260 mg / L imazapyr, pH = 5.8.
[0036] Preferably, in step (6), the resistant bud induction medium comprises 4.43 g / L MS salts and vitamins + 30 g / L sucrose + 1.0 mg / L trans-Zeatin + 0.01 mg / L NAA + 6.0 g / L agar
[0037] + 250 mg / L cefotaxime + 100 mg / L timentin + 260 mg / L imazapyr, pH = 5.8.
[0038] Preferably, in step (6), the resistant bud induction medium comprises 4.43 g / L MS salts and vitamins + 30 g / L sucrose + 2.0 mg / L trans-Zeatin + 0.02 mg / L NAA + 6.0 g / L agar
[0039] + 250 mg / L cefotaxime + 100 mg / L timentin + 260 mg / L imazapyr, pH = 5.8.
[0040] Preferably, in step (7), the seedling culture medium comprises 5.688 g / L MS salts and vitamins + 30 g / L sucrose + 250 mg / L cefotaxime + 260 mg / L imazapyr + 5 g / L carrageenan, pH = 5.8.
[0041] The potato breeding method for genetically editing ALS genes of the present application has the beneficial effect that ALS gene mutant potato varieties with high infection efficiency and high gene editing efficiency can be obtained, so that the potato varieties are resistant to imidazolinone herbicides.
[0042] The method of the present application obtains imazapyr-resistant gene editing seedlings with gene editing and no insertion of exogenous fragments by optimizing the total concentration of CaCl2 in the infection medium, the concentration of MS medium, the length of the explant stem, and the physiological state of the explant, wherein the probability of editing of the regenerated seedlings of the genetic transformation system involved is higher.
[0043] The beneficial effects of the present application are embodied in the following aspects:
[0044] 1) The present application uses a new screening agent, imidazolinone herbicide, in the Agrobacterium-based potato genetic editing method. The screening agent has good absorption, is stable and not easy to photodegrade, and is an ideal genetic transformation screening agent.
[0045] 2) The invention optimizes the Agrobacterium-based genetic editing method for potatoes, and establishes a genetic editing method with high probability of edited regeneration seedlings in a genetic transformation system. BRIEF DESCRIPTION OF DRAWINGS
[0046] Figure 1 Structure map of the gene editing tool vector.
[0047] Figure 2 Result graph of the effect of different total CaCl2 concentrations on the infection efficiency of Fueirita stem segments.
[0048] Figure 3 Result graph of GUS staining of different total CaCl2 concentrations in the infection and co-culture stages.
[0049] Figure 4 Result graph of the effect of different MS concentrations on the infection of Fueirita stem segments.
[0050] Figure 5 Result graph of the effect of different stem segment lengths on the infection efficiency of Agrobacterium.
[0051] Figure 6 Stem segments with different subculture days.
[0052] Figure 7 GUS staining comparison of different stem segment thicknesses.
[0053] Figure 8 Comparison of sequencing results of corresponding ALS gene sequences of wild type and genetically edited seedlings. DETAILED DESCRIPTION
[0054] The embodiments of the present application will be described in detail below with reference to the examples, but those skilled in the art will understand that the following examples are only for illustration of the present application and should not be regarded as limiting the scope of the present application. If the specific conditions are not specified in the examples, the conventional conditions or the conditions recommended by the manufacturer are used; if the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased on the market.
[0055] Example 1: Construction of a gene editing tool vector
[0056] A gene editing tool vector with the structure shown in Figure 1 is constructed, which uses a commercially available pCambia2300 plasmid as a backbone. The following five sequences of fragments are artificially synthesized by KingsRiver Biotech (Nanjing):
[0057] 1. PcUbi promoter: GenBank Accession No.: X64345.1, 1-982 bp;
[0058] 2. Cas9n sequence with 3x flag tag and SV40 NLS, see Xu et al., “A design optimized prime editor with expanded scope and capability in plants,” Nat Plants, 2022, 8, 45-52.
[0059] 3. M-MLV-RT + SV40 NLS sequence, Cas9n-M-MLV-RT and linker sequence, see Xu et al., “A design optimized prime editor with expanded scope and capability in plants,” Nat Plants, 2022, 8, 45-52.
[0060] 4. NptII + t35S sequence, see pCambia2300 plasmid
[0061] 5. Three sgRNA expression cassettes from AtU6-26p to polyT, target sequences are as follows (PAM sequence in brackets):
[0062] ASST1013 + esgRNA (SEQ ID NO: 5): AAGATCTCTTCCTCGTTAGC (AGG);
[0063] ASST1015 + esgRNA (SEQ ID NO: 6): CTAGACAGATAGAACACTTT (TGG);
[0064] SST1012 - pegRNA (SEQ ID NO: 7): CTTGGGAATGGTGGTTCAAT (GGG);
[0065] SST1014 - pegRNA (SEQ ID NO: 8): GTTCTACCTATGATTCCCAG (CGG),
[0066] The above five fragments were ligated to the backbone outside the T-DNA of pCambia2300 by NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) to obtain the PS0967 gene editing tool vector.
[0067] Example 2: Appropriately increasing the concentration of CaCl2 in the Agrobacterium infection step and the co-culture stage can improve the efficiency of Agrobacterium infection
[0068] Agrobacterium infection and co-culture are the first step in genetic transformation, and the infection efficiency has a direct impact on genetic transformation. In this embodiment, the effect of CaCl2 concentration on infection efficiency in infection medium and co-culture medium was tested, and the total CaCl2 concentration was set to 3 mM, 9 mM, 15 mM and 30 mM (the MS medium provides a CaCl2 concentration of 3 mM, and the insufficient part of the total CaCl2 concentration is provided by additional CaCl2), and the best infection effect is tested, and the implementation process is as follows:
[0069] (1) Prepare explants: Take potato plants that have been subcultured in culture bottles for 21-28 days, remove the youngest top stem segments of the plants, and use a scalpel to cut the remaining stem segments into 5-10 mm stem segments (without axillary buds); place the cut stem segments in the pre-culture medium (MS salt and vitamin 4.43 g / L (PTL company, item number M519, same below) + sucrose 30 g / L + agar 6.0 g / L, pH = 5.8) for 2 days, 23±2℃, light cycle 16 hours light, 8 hours darkness, light intensity 2000Lux.
[0070] (2) Prepare the infection working solution: Take 4 disposable 50 ml centrifuge tubes, and add 10 ml of infection medium (4.43 g / L MS salt (containing vitamins) + 20 g / L sucrose + 10 g / L glucose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 50 μM AS, pH 5.6) to each tube, respectively, with a total CaCl2 concentration of 3 mM, 9 mM, 15 mM and 30 mM. LB solid medium containing kanamycin was used to culture Agrobacterium LBA4404 containing the GUS gene; use a disposable inoculation loop to collect the Agrobacterium obtained by culture into a 50 ml centrifuge tube, and use a vortex to shake the bacterial mass to make it evenly dispersed in the infection medium, to prepare an infection working solution with an OD value of about 0.3, ready for use. 600
[0071] (3) Infection: To eliminate the influence of physiological state and stem thickness of different single plants on infection efficiency, all pre-cultured potato stem segments were collected in a new culture dish for mixing, and then randomly divided into 4 parts and placed in different culture dishes. Add infection working solution with different total CaCl2 concentrations (3 mM, 9 mM, 15 mM and 30 mM) to the four culture dishes, and shake the culture dishes constantly to make the stem segments fully contact with the bacterial solution during the 15-minute infection at room temperature (the room temperature is lower than 28℃).
[0072] (4) After the infection is completed, use a disposable sterile pipette to discard the bacterial solution, and use sterile filter paper to absorb the residual bacterial solution.
[0073] (5) Co-cultivation: Put two layers of sterile filter paper into a new Petri dish, and add 2 ml of infection medium with CaCl2 concentration of 3 mM, 9 mM, 15 mM and 30 mM respectively (Infection medium (4.43 g / L MS salts (with vitamins) + 20 g / L sucrose + 10 g / L glucose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 50 μM AS, pH 5.6), make sure that there is no air bubble between the filter paper and the Petri dish and between the two layers of filter paper. Put the stem segments of step (4) into it, about 30 stem segments per dish. Seal the Petri dish with 3M sterile air-permeable adhesive tape to prevent excessive evaporation of water from the stem segments. Place the Petri dish in an incubator at 23°C for dark culture for 3 days.
[0074] (6) After co-cultivation, the stem segments are transferred to recovery medium containing antibiotics but no selection agent (Recovery medium (4.43 g / L MS salts (with vitamins) + 30 g / L sucrose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 6.0 g / L agar + 250 mg / L cefotaxime + 100 mg / L timentin, pH = 5.8) for recovery culture for 3 days, and then GUS staining is performed on different treated stem segments, staining overnight at 37°C, and decolorizing with 70% ethanol (freshly prepared), and observing the staining results under a microscope.
[0075] (7) Staining observation: There are three cases of potato stem segment staining: stem segments with blue spots, slightly blue stem segments and non-stained stem segments (negative), and the number of stem segments with different staining conditions is recorded when observing, and the GUS staining efficiency is calculated.
[0076] GUS staining efficiency % = number of stem segments with blue spots / total number of stem segments x 100%
[0077] Experimental results:
[0078] The GUS staining results of the stem segments of potato variety Fawreita after Agrobacterium infection showed that appropriate increase of CaCl2 concentration during the infection and co-cultivation stages could improve the Agrobacterium infection efficiency. Figure 2 Compared with the control (3 mM), when the CaCl2 concentration in the infection solution and co-cultivation solution was 9 mM and 15 mM, the GUS staining efficiency of Fawreita stem segments was 74.19% and 75.86% respectively, both higher than the control 68.75%; when the CaCl2 concentration reached 30 mM, the GUS staining efficiency decreased to 43.33%, lower than the control. The GUS staining results showed that appropriate increase of CaCl2 concentration during the infection and co-cultivation stages could improve the GUS staining efficiency, promote the Agrobacterium infection efficiency, and thus improve the transformation efficiency; when the CaCl2 concentration reached 30 mM, the Agrobacterium infection efficiency was reduced, which affected the transformation efficiency.
[0079] Example 3: CaCl2 improves Agrobacterium transformation efficiency by acting in the infection stage
[0080] The results of Example 2 show that CaCl2 can improve Agrobacterium infection efficiency. To determine whether CaCl2 acts in the infection or co-cultivation stage, Example 3 was designed and carried out. The test variety was Fuyu pear stem segments. The specific experimental design is shown in Table 1 below.
[0081] Experimental procedure:
[0082] The medium composition, genetic manipulation and culture conditions, staining method and observation criteria for each stage of genetic transformation were the same as in Example 2.
[0083] Table 1 CaCl2 concentration in the infection and co-cultivation stages
[0084]
[0085]
[0086] Experimental results:
[0087] The infection experiment using sterile Fuyu pear seedling stem segments showed that: Figure 3 ) :
[0088] When the CaCl2 concentration was increased to 9 mM and 15 mM in the infection step, the GUS staining efficiency was approximately 2 times that of the control (3 mM-3 mM: 13.3%), with values of 22.6% and 25.8%, respectively. When the CaCl2 concentration was further increased to 30 mM, the GUS staining efficiency decreased to 12.9%, which was comparable to the control.
[0089] When the CaCl2 concentration was increased to 9 mM and 15 mM in the co-cultivation stage, the staining efficiency was 9.7% and 13.3%, respectively, which was comparable to the control of 13.3%. This indicates that increasing the CaCl2 concentration in the co-cultivation stage did not promote the infection ability of Agrobacterium.
[0090] The results of increasing CaCl2concentration only in the infection stage and only in the co-cultivation stage showed that only the infection stage with higher CaCl2concentration promoted the infection ability of Agrobacterium and increased the GUS staining efficiency. Therefore, when the CaCl2concentration in the infection and co-cultivation stages was 9 mM and 15 mM, respectively, the observed GUS staining efficiency was comparable to that of the GUS staining efficiency of the infection stage with CaCl2concentration of 9 mM and 15 mM, both of which were 25.8%, which was 100% higher than the GUS staining efficiency of the control. The treatment of increasing CaCl2concentration in the infection and co-cultivation stages was also a re-verification of the results of Example 2, indicating that the experimental results of increasing CaCl2to improve the infection efficiency of Agrobacterium were reproducible. The experimental results showed that the promotion of CaCl2to the infection efficiency of Agrobacterium was in the infection step.
[0091] Example 4: Influence of different concentrations of MS components on the infection efficiency of Agrobacterium
[0092] It has been reported that the use of 1 / 4 x NB in the infection and co-cultivation stages can significantly improve the transformation efficiency of rice. In this example, two different concentrations of MS components, 1 / 4 x MS and 1 x MS, were tested in the infection and co-cultivation stages. The medium composition, transgenic operation and culture conditions, and result analysis method of each stage of genetic transformation were the same as those of Example 2.
[0093] Result analysis: GUS staining results showed that Figure 4 ), the GUS staining efficiency of Fueiyita stem segments was 48.39% when 1 / 4 x MS components were used in the infection and co-cultivation stages, which was lower than the GUS staining efficiency of 68.75% when 1 x MS components were used, so 1 x MS had a positive effect on the infection efficiency. Therefore, in the genetic transformation of potato stem segments as explants, 1 x MS components were used in the infection and co-cultivation stages. This result was contrary to that of rice, indicating that it was caused by different species.
[0094] Example 5: Influence of different stem lengths on the infection of Agrobacterium
[0095] Potato stem segments are frequently used as explants in potato genetic transformation studies due to their ease of acquisition and simple operation. Literature reports typically show stem segment lengths of 5-10 mm. Shortening the stem segment length allows for the production of more explants from the same plant. To clarify the optimal stem segment length for potato genetic transformation, this example tests the Agrobacterium infection effect on stem segments of two different lengths. The culture medium used for the explants was: 4.43 g / L MS salts and vitamins + 30 g / L sucrose + 10 ml CaCl2 solution (44 mg / ml) + 2 ml / L MgSO4·7H2O solution (185 mg / ml) + 2 ml / L KH2PO4 solution (85 mg / ml) + 5 g / L carrageenan, pH = 5.8. "Long" indicates a stem segment length of 5-10 mm, and "short" indicates a stem segment length of 0.5-2 mm. Shorter stem segments can produce 2.5-5 times the number of explants required for transformation as longer stem segments.
[0096] The composition of the culture medium, transgenic operation and culture conditions, and result analysis methods for each stage of genetic transformation are the same as in Example 2.
[0097] GUS staining results indicate that ( Figure 5 The GUS staining efficiencies of explant stem segments with a length of 5-10 mm and short stem segments with a length of 0.5-2 mm were 17.07% and 18.75%, respectively. The difference in GUS staining efficiencies between long and short stem segments was not significant; therefore, short stem segments can also be used in potato genetic transformation. Under the same number of explants or when explant material is scarce, shorter stem segments are more conducive to producing more explants, thereby generating more transformation events.
[0098] Example 6: Effect of explant physiological state on Agrobacterium infection efficiency
[0099] (a) Succession time
[0100] The experimental method in this embodiment is the same as that in Embodiment 2.
[0101] GUS staining results showed that sterile potato seedlings needed to be cultured for at least two weeks before they could be used for genetic transformation; potato stem segments cultured for only two weeks after subculturing showed hollow pith (e.g. Figure 6 As shown in the left figure, the stem segment with incomplete vascular bundle development affects the transformation efficiency; while the stem segment cultured for 21 days has fully developed its vascular bundles. Figure 6 (See the image on the right, indicated by the solid arrow). GUS staining is mainly concentrated in the vascular bundles. Based on the principles of cell development, regenerated shoots from vascular bundle tissues have strong heritability. It is further speculated that the growth time after subculturing and the infection efficiency of Agrobacterium will be affected by the culture medium composition, potato variety, and culture conditions.
[0102] (b) the thickness and strength of the stems of the potato tissue culture seedlings
[0103] The experimental method of this example is the same as that of Example 2.
[0104] In the GUS staining experiment, it was found that when the stem segments were thicker and stronger, the GUS staining was darker and the cut ends of the stem segments swelled significantly during the culture process Figure 7 (left), indicating that more cells were transformed or the transformed cells had stronger differentiation ability and faster proliferation, and the transformation efficiency of the thicker and stronger stem segments was higher; on the contrary, the callus induction at the cut ends of the slender stem segments was weaker Figure 7 (right), indicating that there were fewer transformed cells or the cells had weaker vitality and slower proliferation, and the transformation efficiency was significantly reduced.
[0105] Example 7: Transformation test after optimization of the parameters of Examples 2-6
[0106] (1) Stem segment pre-culture: Take potato plants that have been subcultured in a culture bottle for 21-28 days, remove the youngest top stem of the plant, and use a scalpel to cut the remaining stem into axillary bud-free stem segments of 0.5-2 mm in length; place the cut stem segments on the pre-culture medium (4.43 g / L MS salt (containing vitamins) + 30 g / L sucrose + 6.0 g / L agar powder, pH 5.8) for 2 days at 23±2°C, with a light cycle of 16 hours of light and 8 hours of darkness, and a light intensity of 2000 Lux.
[0107] (2) Prepare the infection working solution: use LB solid medium containing kanamycin to culture Agrobacterium LBA4404 containing the targeted potato ALS gene editing tool, collect it into a 50 ml centrifuge tube with a disposable inoculation loop, and shake the bacterial mass with a vortex instrument for uniform dispersion in different infection media.
[0108] Prepare the infection medium for treatment 1, which consists of: 4.43 g / L MS salt and vitamins + 20 g / L sucrose + 10 g / L glucose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 50 μM AS pH=5.6;
[0109] Prepare the infection medium for treatment 2, which consists of: 4.43 g / L MS salt and vitamins + 20 g / L sucrose + 10 g / L glucose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 6 mM CaCl2+ 50 μM AS pH=5.6;
[0110] Prepare the infection medium for treatment 3, which consists of: 4.43 g / L MS salt and vitamins + 20 g / L sucrose + 10 g / L glucose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 12 mM CaCl2+ 50 μM AS pH=5.6;
[0111] Prepare the infection medium for treatment 4, the components are: 4.43 g / L MS salt and vitamin + 20 g / L sucrose + 10 g / L glucose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 27 mM CaCl2+ 50 μM AS pH = 5.6.
[0112] OD of the infection medium of treatment 1 to treatment 4 600 The value is about 0.3, and the standby is prepared.
[0113] (3) Infection: collect the potato stem segments at the end of pre-culture in a new culture dish, add the prepared infection working solution, and shake the culture dish constantly to make the stem segments fully contact with the bacterial solution at room temperature for 15 minutes (the room temperature should be lower than 28°C during the infection). After the infection, discard the bacterial solution with a disposable sterile pipette, and dry the residual bacterial solution with sterile filter paper.
[0114] (4) Co-culture: place two layers of sterile filter paper in a new culture dish, add 2 ml of co-culture medium (4.43 g / L MS (containing vitamins) + 20 g / L sucrose + 10 g / L glucose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 50 μM AS, pH = 5.6), and ensure that there are no air bubbles between the filter paper and the culture dish and between the two layers of filter paper. Place the stem segments of step (3) in it, about 30 stem segments per dish. Seal the culture dish with 3M sterile breathable adhesive tape to prevent excessive water evaporation and cause the stem segments to dry out. Place the culture dish in an incubator and incubate in the dark at 23°C for 3 days.
[0115] (5) Recovery culture: transfer the stem segments after co-culture to a recovery medium containing antibiotics but no selection agent (4.43 g / L MS salt (containing vitamins) + 30 g / L sucrose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 6.0 g / L agar + 250 mg / L cefotaxime + 100 mg / L timentin, pH = 5.8) for recovery culture for 7 days, with a culture condition of 23 ± 2°C, 16 hours of light, 8 hours of darkness, and a light intensity of 2000 Lux.
[0116] (6) Resistant callus selection culture: transfer the stem segments after recovery culture to a resistant callus induction medium containing imidazole nicotinic acid 260 μg / L (4.43 g / L MS salt (containing vitamins) + 30 g / L sucrose + 2.5 mg / L 6-BA + 0.5 mg / L 2,4-D + 6.0 g / L agar + 250 mg / L cefotaxime
[0117] (7) Resistance bud regeneration: 14 days after resistance callus induction, the stems were transferred to resistance bud induction medium (4.43 g / L MS salts (with vitamins) + 30 g / L sucrose + 1.0 mg / L zeatin + 0.01 mg / L NAA + 6.0 g / L agar + 250 mg / L cefotaxime + 260 μg / L imazapyr, pH = 5.8) containing 260 μg / L imazapyr for induction of resistance buds, and cultured for 21 days, with the culture conditions being the same as in step (5). Resistance bud development required 2-3 subcultures. Generally, stem segments produced adventitious buds at the end of the second subculture.
[0118] (7) Resistance bud regeneration: 14 days after resistance callus induction, the stems were transferred to resistance bud induction medium (4.43 g / L MS salts (with vitamins) + 30 g / L sucrose + 1.0 mg / L zeatin + 0.01 mg / L NAA + 6.0 g / L agar + 250 mg / L cefotaxime + 260 μg / L imazapyr, pH = 5.8) containing 260 μg / L imazapyr for induction of resistance buds, and cultured for 21 days, with the culture conditions being the same as in step (5). Resistance bud development required 2-3 subcultures. Generally, stem segments produced adventitious buds at the end of the second subculture.
[0119] (7) Resistance bud regeneration: 14 days after resistance callus induction, the stems were transferred to resistance bud induction medium (4.43 g / L MS salts (with vitamins) + 30 g / L sucrose + 1.0 mg / L zeatin + 0.01 mg / L NAA + 6.0 g / L agar + 250 mg / L cefotaxime + 260 μg / L imazapyr, pH = 5.8) containing 260 μg / L imazapyr for induction of resistance buds, and cultured for 21 days, with the culture conditions being the same as in step (5). Resistance bud development required 2-3 subcultures. Generally, stem segments produced adventitious buds at the end of the second subculture.
[0120] (8) Rooting culture of regenerated seedlings: the regenerated buds were subjected to rooting culture on rooting medium (5.688 g / L MS salts and vitamins + 30 g / L sucrose + 250 mg / L cefotaxime + 260 μg / L imazapyr + 5 g / L carrageenan, pH = 5.8).
[0121] (9) The transformation efficiency of the rooted and robust seedlings obtained by the above method was detected, and the results are shown in Table 2 below:
[0122] Table 2: Results of detection of rooted seedlings
[0123] Serial number Treatment Number of explants Number of plants detected Number of edited plants Editing efficiency 1 Treatment 1 (CaCl2 3 mM) 339 4 4 1.18% 2 Treatment 2 (CaCl29 mM) 261 39 36 13.8% 3 Treatment 3 (CaCl215 mM) 536 79 72 13.4% 4 treatment 4 (CaCl230 mM) 972 15 14 1.44%
[0124] Editing efficiency % = number of edited strains / total number of explants x 100%.
[0125] The results in the above table show that when the total concentration of CaCl2 in the infection medium is 9-15 mM, the best gene editing efficiency of potato using imazapyr as the screening system can be obtained.
[0126] Further sequencing was performed on one wild-type and one gene-edited seedling of Treatment 2 (the sequences of the sequencing primers are shown in SEQ ID NO: 9 (forward primer) and SEQ ID NO: 10 (reverse primer)), and the results are shown in Table 3 below. Figure 8
[0127] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; although the present application has been described in detail with reference to the above embodiments, those skilled in the art should understand that the technical solutions recorded in the above embodiments can still be modified, or some or all of the technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.
Claims
1. A potato breeding method for gene editing of the ALS gene, characterized in that, The breeding method includes the following steps: (1) Potato explants were infected with Agrobacterium tumefaciens transformed with gene editing tools. The infection medium used for infection contained a total concentration of 9-15 mM CaCl2. The gene editing tools were used to target the potato ALS gene to edit and mutate the ALS gene so that the potato would develop resistance to imidazolinone herbicides. (2) After co-culture and recovery culture, the potato explants were sequentially cultured on resistant callus induction medium, resistant bud induction medium and seedling strengthening medium to obtain regenerated seedlings. The resistant callus induction medium, resistant bud induction medium and seedling strengthening medium all contained imidazolinone herbicides. in: In step (1), the gene editing tool carries a gene that expresses the Cas9 protein and carries sgRNA; In step (1), stem segments of potato plants that have been subcultured for 21-28 days are precultured to obtain potato explants for infection. The potato plant variety is Feurita, and the length of the stem segments is 0.5-2 mm. In step (1), the coding sequence of the ALS gene is shown in SEQ ID NO: 1, and the coding sequence of the ALS gene mutant is shown in SEQ ID NO: 3; The imidazolinone herbicide mentioned is methyl benzoate; Both the infection and co-culture media used for infection and co-culture contained 1×MS.
2. The breeding method according to claim 1, characterized in that: In step (1), the Agrobacterium is Agrobacterium LBA4404.
3. The breeding method according to claim 1 or 2, characterized in that, The breeding method includes the following steps: (1) Preparation of explants: Take the stem segments of potato plants that have been subcultured in culture bottles, make wounds with a scalpel, and place them on the pre-culture medium for pre-culture. (2) After pre-culturing, potato stem segments were infected with bacterial solution of Agrobacterium tumefaciens transformed with gene editing tools and then dried with filter paper. (3) The infected potato stem segments were co-cultured on a co-culture medium; (4) The potato stem segments after co-culture were placed on a recovery medium for recovery culture; (5) Potato stem segments that have completed recovery culture were subjected to resistance callus induction on a resistance callus induction medium; (6) Potato stem segments after the induction of resistant callus were induced to develop resistant shoots on a resistant shoot induction medium; (7) The regenerated buds are cultured on a seedling culture medium to obtain robust regenerated seedlings.
Citation Information
Patent Citations
Genetic transformation method for rice transgene
CN103740752A
TAL-mediated transfer DNA insertion
CN104884626A
Transgenic potato event ST2400643 and detection method thereof
CN119464547A