Fluorescent fusion protein and application thereof
By designing the fluorescent fusion protein Hellen, the problem of detecting dynamic changes in intracellular fatty acids in existing technologies has been solved, enabling the specific detection of stearic acid and palmitic acid. It has good sensitivity and compatibility and is suitable for monitoring fatty acids in living cells.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-20
- Publication Date
- 2026-03-31
AI Technical Summary
Existing technologies are insufficient for efficiently and sensitively detecting dynamic changes in intracellular fatty acids, especially long-chain fatty acids, and conventional methods are either toxic to cells or require complex procedures and expensive instruments.
A fluorescent fusion protein, Hellen, was designed to fuse and express the LBD domain of PPARα, cpEGFP, and LXXLL. Through structural design and optimization, an intracellular fluorescence sensing system was constructed for the detection of stearic acid in the cell membrane and mitochondria.
It achieves specific detection of stearic acid and palmitic acid, with good sensitivity and compatibility. It does not require complicated operation or expensive instruments, and can dynamically monitor changes in the content and distribution of fatty acids in cells, with low cytotoxicity.
Smart Images

Figure CN120424229B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biosensing technology, specifically relating to a fluorescent fusion protein and its applications. Background Technology
[0002] Fatty acids are important small-molecule metabolites. Their content, distribution, and metabolic pathways in the body are closely related to many pathophysiological processes, such as obesity, type 2 diabetes, and atherosclerosis. With the proposal and refinement of the lipid "multiple-hit" theory, the malignant positive feedback of abnormal lipid accumulation and inflammatory responses in cells and tissues is a common pathological feature of many metabolic diseases.
[0003] However, current methods for detecting fatty acids face significant challenges and limitations. Specifically, fatty acids have smaller molecular weights and simpler functional groups and structures compared to proteins, making it difficult to uncover the underlying mechanisms for labeling. Furthermore, many methods require cell lysis or fixation, hindering dynamic monitoring of cells at different time points. Secondly, chemical modifications to fatty acids affect their polarity and molecular weight, leading to inconsistent localization after introduction into cells and making it difficult to translate imaging results into objective scientific explanations. Isotope labeling methods, which have less impact on fatty acid composition, require specific imaging instruments and lack compatibility with other optical imaging instruments and commonly used molecular biology methods. Therefore, developing novel, high-performance, localizable, and dynamic fatty acid tracing technologies from a biological perspective can not only provide more intuitive and reliable evidence for lipid metabolism research but also has significant implications for in-depth disease research. Summary of the Invention
[0004] To address the problems in the prior art, this invention provides a fluorescent fusion protein and its application. It fuses and expresses the LBD domain, cpEGFP, and LXXLL from PPARα. Through structural design and optimization, it constructs an intracellular fluorescence sensing system for the detection of stearic acid in the cell membrane and mitochondria (High Efficiency Long-chain saturated fatty acid sensor, hereinafter referred to as Hellen).
[0005] The technical problem solved by this invention is achieved by the following technical solution:
[0006] The purpose of this invention is to provide a fluorescent fusion protein, wherein the expression order from the N-terminus to the C-terminus of the fusion protein is LBD, cpEGFP and LXXLL, and a linker 1 is added between LBD and cpEGFP, and a linker 2 is added between cpEGFP and LXXLL.
[0007] PPARs are a class of transcription activators in the nuclear receptor family. Long-chain fatty acids can act as ligands to activate and regulate downstream energy metabolism under physiological conditions. Similar to other nuclear receptors, PPARα contains an activation domain 1 (AF1), a DNA-binding domain, a ligand-binding domain (LBD), and an activation domain 2 (AF2). AF1 activation is ligand-independent, while AF2 requires ligand-dependent activation. The carboxyl group of the long-chain fatty acid interacts with tyrosine residues in AF2 after entering the hydrophobic pocket of the LBD, making the highly conserved "LXXLL" sequence (L stands for leucine, X for any amino acid; LXXLL is a short peptide motif rich in leucine that plays a crucial role in the interaction between nuclear receptors and co-regulatory factors) the dominant conformation in the co-activator, thus achieving the co-binding of LBD, LXXLL, and the fatty acid molecule. cpEGFP is a mutant green fluorescent protein. Compared to the wild-type fluorescent protein, its barrel structure in its tertiary structure is incomplete. When it is fused with other target proteins for expression, the conformational change of the target protein causes a change in the fluorescence intensity of the fluorescent protein.
[0008] Furthermore, connector 1 is SGGS and connector 2 is SGGGGS.
[0009] Furthermore, the amino acid sequence of the fluorescent fusion protein is shown in SEQ ID NO.1 of the sequence listing.
[0010] A recombinant expression vector containing the nucleotide sequence SEQ ID NO.2 encoding a fluorescent fusion protein.
[0011] A recombinant bacterial strain containing the aforementioned recombinant expression vector.
[0012] A recombinant expression vector containing the nucleotide sequence SEQ ID NO.4 encoding a fluorescent fusion protein and Igκ.
[0013] A recombinant expression vector containing the nucleotide sequence SEQ ID NO.6 encoding a fluorescent fusion protein and Cox8.
[0014] Application of a fluorescent fusion protein as a biosensor for detecting fatty acids.
[0015] Technical principle of the invention:
[0016] The LBD domain in PPARα has a high affinity for stearic acid and palmitic acid. When fatty acids enter the hydrophobic cavity of the LBD, the carboxyl group of the fatty acid forms hydrogen bonds with the tyrosine residue at position 314 and the histidine residue at position 440 in the LBD, causing a conformational change in the AF2 domain of PPARα to form a groove. This groove can well match the helical structure formed by the "LXXLL" sequence in the coactivator. This is the principle of the trimeric complex formed by fatty acids, LBD, and LXXLL. Secondly, by using amino acid position 145 of wild-type EGFP as the new N-terminus, the original C-terminus and N-terminus of the protein are connected by a short peptide, and amino acid position 144 becomes the new C-terminus, thus obtaining cpEGFP. The structural basis for fluorescent protein fluorescence lies in having a complete barrel structure, but cpEGFP lacks this barrel structure. When expressed alone, hydrogen ions in the environment can enter through the gap, causing quenching of the fluorophore. Therefore, this invention uses a suitable short peptide linker to fuse cpEGFP with LBD and LXXLL for expression. If stearic acid is absent in the system, LXXLL cannot bind to LBD, and cpEGFP can only emit weak fluorescence due to hydrogen ion quenching. If stearic acid enters LBD and causes it to bind to LXXLL, the short peptide linker will compensate for the barrel structure defect, avoiding quenching by hydrogen ions in the environment, and causing the fluorescent protein to emit a clear and strong green fluorescence. Comparing the difference in fluorescence intensity before and after the change reflects the content of stearic acid in the system.
[0017] The prediction of the tertiary structure and binding ability of Hellen protein using Alpha Fold 3 and Autodock 4.0 includes the following steps:
[0018] a. Input the four sequences LBD-cpEGFP-LXXLL, LXXLL-cpEGFP-LBD, cpEGFPa-LBD-LXXLL-cpEGF Pb and cpEGFPa-LXXLL-LBD-cpEGFPb into the Alpha Fold database to obtain the tertiary structure files of the four predicted fusion proteins;
[0019] b. Obtain small molecule files of various fatty acids, including stearic acid, through the PDB protein data bank and Pubchem database;
[0020] c. Using Autodock 4.0, molecular docking was performed between protein structures and small molecule fatty acids to obtain binding sites and binding energy data for different structures and different types of fatty acids;
[0021] d. Optimize the design of short peptide linkers of different lengths and types in the fusion protein, and then determine the amino acid sequence of the optimal linker by comparing the changes in binding energy through molecular docking.
[0022] A method for constructing a prokaryotic expression plasmid for *E. coli*, purifying the protein, and validating the fluorescence properties, specificity, and sensitivity of a sensor in vitro includes the following steps:
[0023] Based on the above prediction results, prokaryotic codons were optimized, and the nucleotide sequences of the LBD and AF2 domains in PPARα, the complete cpEGFP, and the LXXLL domain in the coactivator were fused and ligated into the pET-22b cloning vector to construct the E. coli expression plasmid pET22b-Hellen expressing Hellen protein.
[0024] b. The E. coli expression plasmid pET22b-Hellen was transformed into Rosetta(DE3) strain, and the sequence was verified by first-generation genome sequencing;
[0025] c. E. coli was induced to express Hellen protein by IPTG. After centrifugation to break the bacteria, the supernatant and precipitate were collected, and finally Hellen protein was obtained by nickel column affinity chromatography.
[0026] d. In vitro verification of the binding effect of Hellen with different types of fatty acids.
[0027] A method for constructing eukaryotic expression plasmids for expression in HEK293T and HepG2 cells includes the following steps:
[0028] a. Add the cell membrane signal peptide Igκ or the mitochondrial signal peptide Cox8 to the 5' end of the Hellen nucleic acid sequence, and optimize the codons for eukaryotic purposes. Then, ligate the optimized Igκ-Hellen or Cox8-Hellen sequence into the pcDNA3.1 cloning vector to construct the eukaryotic expression vector pcDNA-Igκ-Hellen or pcDNA-Cox8-Hellen.
[0029] b. The pcDNA-Igκ-Hellen plasmid was transfected into HEK293T cells using Lipo8000 transfection reagent, and the sensing characteristics of Hellen for various fatty acids in the cells were detected.
[0030] c. The pcDNA-Cox8-Hellen plasmid was transfected into HepG2 cells using a transfection reagent, and the detection characteristics of Hellen after localization to mitochondria for stearic acid and palmitic acid were detected.
[0031] d. Transform the pcDNA-Cox8-Hellen plasmid into HepG2 cells and detect changes in mitochondrial stearic acid content under physiological or inflammatory conditions.
[0032] Compared with the prior art, the beneficial technical effects of the present invention are as follows:
[0033] 1. Compared with isotope labeling methods, it does not require complex operating procedures and expensive isotope inspection instruments. It is compatible with conventional molecular biology methods and can be coupled with other fluorescence detection methods, exhibiting good universality and compatibility. Compared with fatty acid analog labeling methods such as BODIPY-C14, it does not alter the structure of small molecule fatty acids, and can detect both exogenous and endogenous fatty acids within cells.
[0034] 2. This invention can be detected using conventional transfection reagents without the need to introduce other compounds. It has low cytotoxicity, maximizes cell viability and normal physiological state, eliminates the need for cell fixation, and allows for dynamic monitoring of changes in the content and distribution of fatty acids in cells at different time points.
[0035] 3. This invention has good specificity and can detect stearic acid and palmitic acid, the two most abundant long-chain saturated fatty acids in the body, especially stearic acid.
[0036] 4. Co-transfection with the plasmid of this invention and lentivirus can construct a stable expression cell line specifically for specific cells and disease processes, which is economical and affordable. Attached Figure Description
[0037] Figure 1 The imaging principle of the Hellen sensor in this invention is as follows: when SA is not present in the system, Hellen emits only weak fluorescence; when SA is present in the system and binds to Hellen, the fluorescence is enhanced.
[0038] Figure 2 This invention relates to the molecular docking of Hellen with different fatty acids; A.SA enters the binding pocket of Hellen, and its carboxyl group forms a hydrogen bond with the tyrosine side chain, with a bond distance of [missing information]. B.PA enters the binding pocket of Hellen, where its carboxyl group forms hydrogen bonds with tyrosine and histidine, with bond lengths of [missing information]. and C.DA did not enter the Hellen combination pocket; D.MA did not enter the Hellen combination pocket; E.OA did not enter the Hellen combination pocket; F.LA did not enter the Hellen combination pocket.
[0039] Figure 3 The Hellen-purified protein of this invention was stained with Coomassie Brilliant Blue. The predicted molecular weight of Hellen was 61.9 kDa, the position was consistent, and there were no extraneous bands.
[0040] Figure 4To illustrate the fluorescence characteristics of Hellen in this invention, A. fluorescence excitation and emission spectra of Hellen at different concentrations show that fluorescence intensity increases with increasing concentration. Similar to the excitation spectrum of wild-type green fluorescent protein, it exhibits a characteristic peak around 400 nm, with a maximum excitation wavelength of approximately 485 nm and a maximum emission wavelength of approximately 515 nm; B. changes in Hellen fluorescence intensity at different pH levels. Similar to wild-type green fluorescent protein, decreasing pH and higher hydrogen ion concentrations lead to a decrease in fluorescence.
[0041] Figure 5 The following are dose-effect curves of Hellen combined with SA and PA according to the present invention: A. Dose-effect curve of Hellen combined with SA, with an EC50 value of 710 nM and a linear range of approximately 100 nM-200 μM; B. Dose-effect curve of Hellen combined with PA, with an EC50 value of 80 μM and a linear range of approximately 1 μM-1 mM.
[0042] Figure 6 The fluorescence co-localization of Igκ-Hellen and Dio in this invention is shown in the scale bar at 5 μm.
[0043] Figure 7 The following are the changes in cell membrane fluorescence of HEK293T cells transfected with Igκ-Hellen treated with SA and PA according to the present invention: A. Changes in cell membrane fluorescence and pseudo-color images before and after the addition of 50 μM SA and 50 μM PA, with a scale bar of 5 μm; B. Fluorescence intensity changes over time before and after the addition of SA and PA.
[0044] Figure 8 The changes in cell membrane fluorescence of HEK293T cells transfected with Igκ-Hellen treated with BSA, DA, MA, OA, LA and AA in this invention; N≥3, the bar chart is expressed as mean ± standard error, * represents p<0.05, ** represents p<0.01.
[0045] Figure 9 The following figures illustrate the changes in cell membrane fluorescence of HEK293T cells transfected with Igκ-Hellen treated with different concentrations of SA and PA in this invention: A. Fluorescence intensity changes over time after adding 50 μM, 100 μM, 150 μM, and 200 μM of SA and PA to the culture medium, respectively; B. Bar charts of cells treated with the four concentrations of SA and PA, N=3, expressed as mean ± standard error.
[0046] Figure 10 The CCK8 assay was performed on HEK293T cells and HepG2 cells transfected with Hellen culture for 24 h and 30 h. There was no significant difference in cell viability between the transfected cells and the control group cells after 24 h and 30 h of culture.
[0047] Figure 11 The scale bar shows the co-localization of Cox8-Hellen and Mito-tracker fluorescence in this invention, with a scale bar of 5 μm.
[0048] Figure 12 The present invention describes the treatment of wild-type HepG2 cells transfected with Cox8-Hellen with 50 μM SA or PA, and the treatment of HepG2 cells with interfered CD36 expression with SA. A. Changes in mitochondrial fluorescence before and after treatment, as shown in color; B. Curves of changes in mitochondrial fluorescence before and after treatment; C. Bar charts of changes in mitochondrial fluorescence in the three groups, N=4, expressed as mean ± standard error, ** represents p<0.01.
[0049] Figure 13 The following figures illustrate the changes in mitochondrial fluorescence in HepG2 cells under SA conditions mediated by LPS in this invention: A. Color graph showing the changes in mitochondrial fluorescence in HepG2 cells in the siCON and siCD36 groups after 6 hours of 200 μM SA treatment followed by 20 minutes of stimulation with 5 μg / mL LPS; B. Curves showing the changes in mitochondrial fluorescence of the four groups of HepG2 cells over time; C. Bar graphs showing the changes in mitochondrial fluorescence of the four groups of HepG2 cells at 1 min, 2 min, 5 min, and 10 min, with N≥3, expressed as mean ± standard error. *** indicates p<0.001 compared to the siCON+SA+LPS group, and ### indicates p<0.001 compared to the siCD36+SA+LPS group.
[0050] Figure 14 This invention uses Seahorse XF to detect mitochondrial oxygen consumption in HepG2 cells under LPS-mediated SA conditions. A. Mitochondrial oxygen consumption curves of HepG2 cells in the siCON and siCD36 groups after 12 h of 200 μM SA treatment followed by stimulation with 5 μg / mL LPS. B. Differences in basal mitochondrial oxygen consumption, ATP production, maximum oxygen consumption, and residual respiration capacity of the four groups of HepG2 cells, N=4. The bar chart is expressed as mean ± standard error, ** indicates p<0.01. Detailed Implementation
[0051] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing from the market or prepared by existing methods.
[0052] Example 1: Hellen protein structure prediction and fatty acid molecule docking
[0053] Methods: The Hellen fusion protein comprises an LBD-AF2 domain, a cpEGFP domain, and an "LXXLL" domain. Through structural prediction and optimized design, the expression order from the N-terminus to the C-terminus of the fusion protein was determined to be LBD, cpEGFP, and LXXLL, respectively. An "SGGS" linker was added between LBD and cpEGFP, and an "SGGG GS" linker was added between cpEGFP and LXXLL. The final amino acid sequence of the Hellen fusion protein sensor, SEQ ID NO. 1, is as follows:
[0054] *
[0055] The predicted Hellen protein structure was used for molecular docking with stearic acid (SA, C18:0), palmitic acid (PA, C16:0), dodecanoic acid (DA, C16:0), myristic acid (DA, C14:0), oleic acid (OA, C18:1), and linoleic acid (LA, C18:2). The Alphafold database provided five predicted structures for Hellen. The top-ranked structure was selected and its format converted. The protein and fatty acid molecules were then imported into Autodock software to remove water molecules and add hydrogen. Binding pocket regions in the protein molecule were selected to obtain 10 preferred docking results. The top-ranked result was selected to output the binding parameters and 3D structure, which was then visualized using Pymol software.
[0056] Result: As Figure 2 As shown, SA and PA can enter and bind to Hellen's hydrophobic pocket, with a binding energy of -5.53 for SA and -4.45 for PA. Other types of fatty acids do not bind to Hellen. These results indicate that this fusion expression method preserves LBD's binding ability to SA and PA and avoids steric hindrance, making it highly likely to fold into a complete protein structure to achieve the desired purpose.
[0057] Example 2: Hellen protein induced expression, purification, and in vitro validation in E. coli
[0058] Methods: The pET22b-Hellen plasmid was synthesized and constructed by Beijing Qingke Biotechnology Co., Ltd. The Hellen sequence with optimized prokaryotic codons was inserted between the NdeI / XhoI restriction sites in the vector. The corresponding optimized nucleotide sequence is shown in SEQ ID NO.2 below:
[0059]
[0060] The constructed pET22b-Hellen plasmid was transformed into *E. coli* Rosetta (DE3) competent cells. After overnight incubation at 37°C, single colonies were picked and transferred to 5 mL of Luria-Bertani (LB) medium (containing 100 μg / mL ampicillin) and cultured at 37°C and 220 rpm until turbidity was reached. The bacterial culture was then transferred to 300 mL of LB medium containing ampicillin resistance for amplification until the OD 600 reached approximately 0.7. Then, 0.2 mM isopropyl-β-D-thiogalactopyranoside was added, and Hellen expression was induced at 16°C for 16 h. The induction culture medium was centrifuged at 4000 rpm for 30 min, then resuspended in 10 mL of cold NTA lysis buffer (20 mM Tris, 500 mM sodium chloride, 10% glycerol, 0.1 mg / mL lysozyme, pH 8.0), allowed to stand for 30 min, and sonicated for 30 min. The lysis buffer was then centrifuged at 13000 rpm for 30 min and the supernatant was collected. An equal volume of equilibration buffer (20 mM trisodium phosphate, 300 mM sodium chloride, 10 mM imidazole, pH 7.4) was added. Add 2 mL of the above equilibration mixture to a nickel affinity chromatography column (Thermo Fisher Scientific), mix at 4°C for 30 min, centrifuge at 700 g for 2 min, wash three times with washing buffer (20 mM trisodium phosphate, 300 mM sodium chloride, 25 mM imidazole, pH 7.4), and finally elute three times with 1 mL of elution buffer (20 mM trisodium phosphate, 300 mM sodium chloride, 250 mM imidazole, pH 7.4) and collect the eluent. Analyze the Hellen purified protein by SDS-PAGE gel electrophoresis and Coomassie Brilliant Blue staining.
[0061] The purified Hellen protein solution was replaced with phosphate-buffered saline (PBS) using a 30 kDa ultrafiltration tube (Merck, Millipore), and the concentration was determined using a BCA protein quantification kit (Beyotime, Beyotime). Fatty acids were dissolved in 1 ml of ultrapure water heated to 70°C. A 2 mM fatty acid stock solution was prepared using phosphate-buffered saline and subsequently diluted to 1 mM to 500 nM. 1 μM Hellen and fatty acids were added to each well of a 96-well plate, and the changes in fluorescence intensity at different fatty acid concentrations were measured using a microplate reader.
[0062] Result: As Figure 3 As shown, the molecular weight of the purified protein is as expected, and there are no impurities, indicating that the Hellen protein did not undergo breakage or shearing during the purification process, and the protein purity meets the requirements for subsequent experiments.
[0063] like Figure 4As shown, Hellen protein exhibits stable green fluorescence properties, with a maximum excitation wavelength of 488 nm and a maximum emission wavelength of 515 nm, indicating that fusion expression did not affect the fluorescence properties of Hellen protein. The fluorescence intensity of Hellen decreased with decreasing pH value, which is also consistent with the characteristics of fluorescent proteins.
[0064] like Figure 5 As shown, Hellen exhibits high affinity for SA, with a half-maximal effective concentration (EC50) of 710 nM and a linear range of 100 nM–200 μM. Its EC50 for PA is 80 μM, only 1% of that for SA, with a linear range of 1 μM–1 mM. Hellen shows no significant dose-response relationship for other types of fatty acids, further confirming its specificity for SA, consistent with the molecular docking results in Example 1. According to the literature, the reason why LBD has a higher affinity for SA than PA is twofold: firstly, the size of the binding cavity is closer to that of SA; although PA can also enter the cavity of LBD, it cannot effectively activate the AF2 region after entry; secondly, the recruitment effect of PA on the LXXLL domain after entering the cavity is only 10% of that of SA. Therefore, LBD is an excellent SA-specific carrier and has the potential to be optimized into a carrier specifically binding to a certain long-chain fatty acid.
[0065] Example 3: Construction of eukaryotic vector for Igκ-Hellen protein and validation in HEK293T cells
[0066] Methods: The cell membrane localization signal peptide Igκ was linked to the N-terminus of the Hellen sequence. The amino acid sequence of Igκ (SEQ ID NO.3) is as follows: METDTLLLWVLLLWVPGSTGD. Hellen was inserted between the NheI / XhoI restriction sites of the pcDNA3.1 vector. A "SGGGGS" linker 2 was added between Hellen and Igκ, and a kozak sequence was added before the start codon to obtain the Hellen eukaryotic expression plasmid. The codon-optimized nucleotide sequence (SEQ ID NO.4) is as follows:
[0067]
[0068] Hellen was inserted into the pcDNA3.1 vector using a seamless cloning method, and then the Igκ sequence was added to the 5' end of the Hellen sequence. The reagents used in this process included 2x Phanta Max Master Mix PCR high-fidelity enzyme (Novazia, Vazyme) and HB-infusion seamless cloning recombinase (Hanbio). The specific steps are as follows:
[0069] a. Hellen primer design for PCR ligation of pcDNA vectors:
[0070] pcDNAliner F:TGACTCGAGCGGCCGCCA;
[0071] pcDNAliner R:ACTTCCTCCCCCGCCGGA;
[0072] Hellen F: GGCGGGGGAGGAAGTTGTGAGCACGACATCGAGGATTC;
[0073] Hellen R: CGGCCGCTCGAGTCATCCCTCCTGCAGCAGCCG.
[0074] b. PCR amplification system and procedure:
[0075]
[0076] c. Configure a seamless cloning system and react at 50°C for 25 min:
[0077] pcDNA liner 6μL Hellen 2μL DEPC 2μL HB-infusion 10μL .
[0078] d. Igκ signal peptide PCR primer design:
[0079] IgκF1: CACTCCTGCTATGGGTACTGCTGCTCTCCGGCGGGGGAGGAA-GTTGT GAGC;
[0080] IgκR1:CCCATAGCAGGAGTGTGTCTGTCTCCATGGTGGCGCTAGCCA-GC;
[0081] IgκF2: TTCCAGGTTCCACTGGTGACGTCCGGCGGGGGAGGAAGT;
[0082] IgκR2: CAGTGGAACCTGGAACCCAGAGCAGCAGTACCCATAGCAGG.
[0083] e. PCR amplification system and procedure:
[0084]
[0085] f. Configure a seamless cloning system and react at 50°C for 25 min:
[0086] pcDNA-Igκ-Hellen 5μL DEPC 5μL HB-infusion 10μL .
[0087] The ligation product was transformed into DH5α competent cells, and single colonies were picked and cultured in ampicillin-resistant LB medium. After incubation at 37°C for 4-5 hours, gene sequencing was performed. The pcDNA-Igκ-Hellen plasmid was extracted using an endotoxin-free plasmid miniprep kit (Magen Biosciences). The steps were as follows: centrifugation at 3000g for 10 min resulted in the discarding of the supernatant. 250 μL of lysis buffer was added, and the mixture was repeatedly vortexed. Equal volumes of alkali and acid were added sequentially, and excess protein and genomic nucleic acid were removed by salting out. After centrifugation at 13000g for 10 min, the supernatant was collected and added to one-third of the buffer volume. This mixture was then added to a filter column and centrifuged at 10000g for 1 min. The cells were washed three times with washing buffer containing ethanol, dissolved in DEPFC water, and centrifuged at 10000g for 1 min. The plasmid extract was collected, and the DNA concentration was determined.
[0088] HEK293T cells were seeded into confocal dishes and cultured for 24 h. Transfection reagent was prepared by adding 2 μL of Lipo8000 (Beyotime) reagent and 2 μL of pcDNA-Igκ-Hellen plasmid to 75 μL of serum-free (Dulbecco's Modified Eagle Medium, DMEM) (Gibco). After mixing, the transfection reagent was added to the confocal dishes and cultured for 24 h. Cells were then treated with Dio cell membrane dye and Hochest (Beyotime) nuclear dye at room temperature for 10 min. Cells were washed three times with PBS. Fluorescence was observed under an oil immersion lens using a Nikon AX inverted confocal microscope (Plan Apoλ60x). The excitation wavelength for Hellen was 488 nm, and the emission wavelength was set to 505-540 nm; the excitation wavelength for Dio was 561 nm, and the emission wavelength was set to 571-605 nm; and the excitation wavelength for Hochest was 405 nm, and the emission wavelength was set to 429-474 nm.
[0089] Cells were starved for 12 h in DMEM medium containing bovine serum albumin (BSA), transfected with pcDNA-Igκ-Hellen, and cultured for 24 h. The dish was placed on a CO2 cell culture platform under a confocal microscope, and resonance imaging was enabled. The well volume was set to 0.6 μM. 50 μM fatty acid was added to the medium, and the cell membrane fluorescence intensity change curve under a single stimulus was recorded. The imaging interval was 0.07 s. The mean cell membrane fluorescence intensity of 10 frames after adding BSA or 50 μM fatty acid was subtracted from the mean fluorescence intensity of the 10 frames before addition to obtain ΔF. This ΔF / F0 was obtained by dividing the mean ΔF by the initial fluorescence value and then normalizing. Resonance imaging was disabled, and the well volume was adjusted to 0.6-1.0 μM. Different concentrations of SA and PA were added to the medium, and the cell membrane fluorescence intensity change curves at different concentrations were recorded. The fluorescence images were processed using ImageJ software. The fluorescence images after adding SA or PA were subtracted from the images before addition, and the fluorescence intensity change was annotated using pseudocolor.
[0090] In addition, HEK293T cells transfected with pcDNA-Igκ-Hellen were seeded in 96-well plates, and the cytotoxicity of the transfection process was evaluated using the CCK8 kit (APExBIO).
[0091] Result: As Figure 6 As shown, Igκ-Hellen and Dio have obvious co-localization, and the Igκ signal peptide can anchor Hellen to the cell membrane.
[0092] like Figure 7 As shown, SA can significantly enhance Igκ-Hellen fluorescence. The fluorescence increases slightly after the addition of PA, which is consistent with the results of in vitro purified protein and verifies the feasibility of detecting SA in cells using Hellen.
[0093] like Figure 8 As shown, the addition of BSA, DA, MA, OA, LA, or arachidonic acid (AA) to the culture medium of HEK293T cells transfected with pcDNA-Igκ-Hellen showed no significant change or a slight decrease in fluorescence, consistent with the specificity of Hellen observed in vitro, suggesting that BSA, as one of the nutrient sources added during cell starvation, does not affect Hellen fluorescence intensity itself. Literature mentions that OA and LA inhibit the ability of PPARα to recruit the "LXXLL" domain. This evidence explains why OA and LA cause a slight decrease in Hellen fluorescence, whether in vitro purified protein or applied to cells. This may be because OA and LA inhibit the recruitment ability of LBD to the "LXXLL" domain.
[0094] like Figure 9As shown, when different concentrations of SA or PA were added to the culture medium of HEK293T cells transfected with pcDNA-Igκ-Hellen, it was observed that the fluorescence intensity increased with increasing concentration. These results validate the feasibility of using Hellen to detect SA or PA content in cells. These concentration ranges cover the intracellular fatty acid content corresponding to normal physiological conditions and normal high-fat diet conditions. Subsequently, Hellen can be used to classify intracellular fatty acid content, distinguish between fatty acid overload and oxygen consumption states in cells, and assess whether there is a risk of excessive fatty acid accumulation in cells.
[0095] like Figure 10 As shown, after 24h and 30h of transfection with pcDNA-Igκ-Hellen, the cell viability was not significantly different from that of the control group, further demonstrating the feasibility of Hellen in cell detection.
[0096] In summary, Hellen retains stable fluorescence properties both in vitro and in cells, exhibiting extremely high specificity for long-chain saturated fatty acids, especially SA, while also possessing good sensitivity, with in vitro fluorescence as low as 10. 2 Even concentrations of SA at the nM level can induce corresponding fluorescence changes. Purified Hellen protein has the potential to detect the content of free SA in plasma or homogenate samples; transfection of live cells with Hellen-expressing eukaryotic plasmids allows for the dynamic detection of changes in fatty acid content in different organelles at different stages of various cells; and Hellen plasmids can be used to construct stable Hellen-expressing cell lines as tool cells to detect differences in fatty acid content under different pathological models.
[0097] Example 4: Construction of eukaryotic vector for Cox8-Hellen protein and validation in HepG2 cells
[0098] Methods: The mitochondrial localization signal peptide Cox8 was used to replace Igκ and linked to the N-terminus of the Hellen sequence. The Cox8 amino acid sequence SEQ ID NO.5 is as follows: MVSVLTPLLLRGLTGSARRLPVPRAKIHSLSVLTPLLLRGLTGSARRLPV PRAKIHSL. The construction steps are the same as in Example 3. The Cox8 nucleotide sequence SEQ ID NO.6 is as follows:
[0099] ATGGTGAGCGTGCTGACCCCTCTGCTGCTGAGAGGACTGACCGGAAGCGCTAGAAGACTGCCCGTGCCTAGAGCCAAGATCCACAGCCTGAGCGTGCTGACACCCCTGCTGCTGAGGGGACTGACAGGATCTGCCAGAAGACTGCCTGTGCCCAGAGCCAAGATTCACAGCCTG.
[0100] After confirming the accuracy of gene sequencing, pcDNA-Cox8-Hellen plasmid was extracted using a low-endotoxin plasmid miniprep kit. HepG2 cells were transfected with Lipo8000 for 24 hours, and then treated with Mito-tracker mitochondrial probe dye (Beyotime) and Hochest dye for 10 minutes. Fluorescence colocalization was observed under a confocal microscope. The excitation wavelength of the Mito-tracker was 561 nm, and the emission wavelength was set to 571-605 nm. In addition, a small interfering RNA (siCD36) targeting the CD36 fatty acid transporter was synthesized by Heyuan Biotechnology Co., Ltd. CD36 is a membrane protein mainly responsible for the uptake of exogenous long-chain saturated fatty acids, which is the main pathway for SA and PA to enter cells. Add 2 μL siCD36 to 50 μL of serum-free DMEM without antibiotics, gently mix by pipetting, then add 4 μL Lipo8000 transfection reagent, mix again by pipetting, and then add to a confocal dish containing HepG2 cells and culture for 24 h. Finally, place the dish on a confocal cell culture platform, add 50 μM SA to the culture medium, and measure the difference in the amount of exogenous SA transported to mitochondria under the condition of reduced CD36 content.
[0101] Result: As Figure 11 As shown, Cox8-Hellen and Mito-tracker have obvious co-localization. The Cox8 signal peptide can locate Hellen in mitochondria, suggesting the feasibility of Hellen in detecting mitochondrial SA content.
[0102] like Figure 12 As shown, exogenous fatty acids (SA) significantly enhanced mitochondrial Hellen fluorescence in wild-type HepG2 cells, while exogenous polyphenols (PA) had no significant effect on mitochondrial fluorescence. However, HepG2 cells transfected with siCD36, which resulted in downregulation of CD36 levels, showed no significant response to exogenous SA. These results suggest that when exogenous fatty acid intake is the primary source of fatty acids, short-term changes in Hellen fluorescence can accurately reflect the amount of exogenous SA entering the mitochondria, demonstrating that Hellen fluorescence can be used for dynamic monitoring of SA in live cell mitochondria.
[0103] Example 5: Hellen monitoring of dynamic changes in mitochondrial SA content under cellular inflammatory conditions
[0104] Methods: HepG2 cells were seeded in confocal microscopy dishes and cultured until the cell density reached approximately 60%. The cells were then transfected with pcDNA-Cox8-Hellen plasmid and siCD36. After starving the cells for 12 hours, the culture medium was replaced with DMEM containing BSA and cultured for another 6 hours. 5 μg / mL lipopolysaccharide (LPS, Sigma) was added to the culture medium to induce an acute inflammatory response in the cells. After 20 minutes, the cells were observed on a confocal microscope cell culture platform to monitor fluorescence changes.
[0105] Similarly, HepG2 cells were digested, centrifuged, and resuspended. They were diluted 10-fold with PBS and filled into the cell counting chambers of a Boehringer Instantaneous Cell Plate. The number of cells in the four corner squares was counted and converted. Cells were seeded at a density of 15,000 cells / well in Seahorse XF cell culture plates (Agilent), with 100 μL of culture medium reserved in each well. Cells were incubated at 37°C for 3-5 hours until complete cell attachment. Then, 350 μL of culture medium was added to each well overnight. Cells were starved for 12 hours, treated with 0.2 mM SA for 12 hours, and then treated with LPS for 12 hours. 1 mL of Seahorse XF calibration solution (Agilent) was added to the Utility Plate, and the plate was incubated overnight at 37°C without CO2 to hydrate the probe for 12 hours. Add 400 μL of 1 mM pyruvate (Beyotime), 400 μL of 2 mM glutamine (Beyotime), and 400 μL of 10 mM glucose (Macklin) to 38.8 mL of Seahorse XF Base Medium to prepare the test solution. Aspirate the culture medium from the Seahorse XF cell culture plate, retaining 100 μL. Wash twice with 500 μL of test solution, and finally adjust the volume to 500 μL of test solution per well. Incubate in a cell culture incubator for 1 h. Simultaneously, prepare three drug regimens using the test solution: oligomycin, carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP), and rotenone + antimycin A. Add these to the corresponding wells sequentially. Place the probe plate and the Utility Plate containing calibration solution into the instrument for calibration. After the instrument ejects the Utility Plate, replace it with a cell culture plate for detection. Use the BCA kit to perform quantitative standardization of proteins in the cells within the wells. Analyze the data using Wave software to obtain oxygen consumption curves.
[0106] Result: As Figure 13As shown, the fluorescence intensity of the siCON+SA+LPS group increased significantly, suggesting that LPS treatment leads to a greater influx of exogenous SA taken up in the siCON group into the mitochondria. The fluorescence intensity changes in the siCON+SA and siCD36+SA groups were not significant. In the siCON+SA group, the amount of SA flowing into the mitochondria reached equilibrium after 6 hours of SA treatment. In the siCD36+SA group, exogenous SA uptake was blocked, and endogenous synthesis, as the main source of SA or PA, also reached equilibrium after the starvation process. The fluorescence of the siCD36+SA+LPS group decreased significantly, suggesting that the cells were starved and lacked sufficient SA uptake, and that mitochondrial Hellen proteins may have degraded under LPS stimulation. These results preliminarily demonstrate that cellular inflammation promotes the transport of more SA to the mitochondria and also preliminarily validate the "lipid multiple hit" hypothesis, that is, inflammation alters the localization and distribution of fatty acids within the cell.
[0107] like Figure 14 As shown, under conditions of sufficient exogenous SA, both LPS stimulation and interference with CD36 expression can inhibit overall cellular oxygen consumption, while mitochondrial basal oxygen consumption, maximum oxygen consumption, ATP production, and residual respiration capacity all show significant differences. In summary, under LPS-mediated cellular inflammation, the amount of exogenous SA transported to mitochondria increases. This excess SA accumulates in mitochondria and cannot effectively generate energy through β-oxidation, potentially leading to apoptosis due to fatty acid toxicity or disruption of mitochondrial membrane potential.
[0108] This invention relates to the construction and application of a long-chain saturated fatty acid sensing system based on the fusion expression of peroxisome proliferator-activate d receptor alpha (PPARα) and circularly permuted enhanced green fluorescent protein (cpEGFP). The sensing system was validated in vitro and in cells through molecular docking, plasmid construction, and protein purification. Experimental results show that the sensing system exhibits stable fluorescence characteristics both in vitro and in cells, demonstrates good binding specificity and sensitivity for long-chain saturated fatty acids, particularly stearic acid, and achieves dynamic detection of stearic acid from different suborganisms in living cells. Based on these characteristics, the gene-encoded fatty acid sensing system of this invention has broad application prospects and can play an important role in the field of metabolic diseases, providing a new solution for the dynamic detection of small lipid molecules.
[0109] The sequence numbers of the above embodiments of the present invention are for descriptive purposes only and do not represent the superiority or inferiority of the embodiments.
Claims
1. A fluorescent fusion protein, characterized in that, The expression sequence of the N-terminal to C-terminal of the fusion protein is LBD, cpEGFP and LXXLL in turn, and linker 1 is added between LBD and cpEGFP, and linker 2 is added between cpEGFP and LXXLL; The linker 1 is SGGS, and the linker 2 is SGGGGS; The amino acid sequence of the fluorescent fusion protein is shown as SEQ ID NO.
1.
2. A recombinant expression vector, characterized by: The nucleotide containing the fluorescent fusion protein of claim 1, and the sequence of the nucleotide is SEQ ID NO.
2.
3. A recombinant bacterial strain, characterized in that: The recombinant expression vector of claim 2.
4. A recombinant expression vector, characterized by: The nucleotide containing the Igκ-Hellen fusion protein, the Igκ-Hellen fusion protein is formed by connecting the cell membrane localization signal peptide Igκ at the N-terminal of the fluorescent fusion protein of claim 1, and the sequence of the nucleotide containing the Igκ-Hellen fusion protein is SEQ ID NO.
4.
5. A recombinant expression vector, characterized by: The nucleotide containing the Cox8-Hellen fusion protein, the Cox8-Hellen fusion protein is formed by connecting the mitochondrial localization signal peptide Cox8 at the N-terminal of the fluorescent fusion protein of claim 1, and the sequence of the nucleotide containing the Cox8 is SEQ ID NO.
6.
6. The fluorescent fusion protein of claim 1 in the preparation of a biosensor for detecting stearic acid.
Citation Information
Patent Citations
Compositions and methods for modulating circulating factors
CN120035678A
Preparation method and application of protein switch-based explosive molecule detection biosensor
CN120058968A