Corn event CSJ1031 and primer and method for detecting same

Abstract

The invention provides a corn transformation event CSJ1031 as well as a primer pair and a method for detecting the corn transformation event CSJ1031. The maize plant carrying the CSJ1031 transformation event comprises the event on a chromosome 4, namely the junction of an exogenous insertion DNA sequence and a maize genome DNA sequence. A detection primer can be designed by using an exogenous insertion DNA sequence and a DNA sequence of a junction region on a flanking corn genome, and is used for specific detection of a CSJ1031 event. The detection method aiming at the CSJ1031 event can provide a convenient means for tracking the insertion event of the specific gene for breeding by using the plant event, and the insertion event of the specific gene can be used as a molecular marker to improve the working efficiency of insect-resistant and herbicide-resistant breeding by using the transformation event.

Description

Technical Field

[0001] The present invention belongs to the field of plant molecular biology, especially the field of transgenic crop breeding in agricultural biotechnology research, and particularly relates to a transgenic corn event that is resistant to insects and tolerates the application of glyphosate herbicide, as well as a nucleic acid sequence and method for detecting the presence of the transformation event. Background Art

[0002] Corn, one of the world's three major staple foods and a crucial feed crop, plays a crucial role in the global food system. my country has the largest corn planting area in the world, covering approximately 600 million mu (approximately 1.6 million hectares). However, corn growth, yield, and quality have long been severely threatened by insect pests such as the corn borer and weeds. Insect resistance and herbicide tolerance are two crucial agronomic traits in corn production. Lepidoptera insects, such as the corn borer, cotton bollworm, armyworm, and fall armyworm, pose significant threats to corn. Transgenic technology, by expressing lepidoptera resistance genes in corn plants, can effectively enhance corn's resistance to these pests. Regarding herbicide tolerance, glyphosate is a commonly used herbicide in corn production. Biotechnology can introduce and express glyphosate-tolerant genes (such as cp4 epsps) into corn plants, conferring tolerance to glyphosate. These transgenic approaches can significantly improve the agronomic traits and quality of corn.

[0003] In the field of plant transgenic technology, the expression efficiency of exogenous genes is closely related to the integration site of chromosomes. The synergistic effects of chromatin structural features (such as heterochromatin regions) and adjacent transcriptional regulatory elements (such as enhancers) lead to significant expression heterogeneity among different transformants. This site effect is specifically manifested as: (1) the expression level of exogenous genes in different transformants shows a hundred-fold difference; (2) the spatiotemporal expression pattern deviates from the design expectation (such as tissue-specific disorder); (3) it may interfere with the normal expression of endogenous genes. Therefore, conventional technical means require the construction of hundreds to thousands of independent transformation events, and multiple rounds of screening are required to obtain commercial transformants with both efficient target trait expression and excellent agronomic characteristics.

[0004] In the international seed industry, transformation events, due to their unique molecular structure and unpredictable phenotypic advantages, have become a core subject of intellectual property protection. Mainstream commercial transformation events (such as MON810 and Bt11) have established technological barriers through patent portfolios. my country has also made significant breakthroughs in establishing patent protection systems for its own transformation events (such as Huahui No. 1). Establishing specific detection and verification methods for transformation events is not only essential for the commercialization of varieties (meeting regulatory requirements such as GMO labeling) but also a key support for strengthening the exclusivity of patented technologies. Summary of the Invention

[0005] In one aspect, the present invention provides a corn transformation event, characterized in that a partial genomic sequence of corn is replaced by a T-DNA insertion sequence on chromosome 4 of the corn, wherein the T-DNA insertion sequence is the 521-19645 bp sequence of the sequence shown in SEQ ID NO: 13, and the partial genomic sequence is shown in SEQ ID NO: 18.

[0006] In some embodiments, the upstream flanking maize genomic sequence of the T-DNA insertion sequence is:

[0007] 1) the first 520 bp of the sequence shown in SEQ ID NO: 13; or

[0008] 2) A 3' end sequence of the first 520 bp of the sequence shown in SEQ ID NO: 13 having a length of not less than 100 bp.

[0009] In some embodiments, the downstream flanking maize genomic sequence of the T-DNA insertion sequence is:

[0010] 1) bp 19646-20425 of the sequence shown in SEQ ID NO: 13; or

[0011] 2) A 5' end sequence of 19646-20425 bp of the sequence shown in SEQ ID NO: 13 having a length of not less than 100 bp.

[0012] In some embodiments, the maize transformation event results in a DNA sequence on maize chromosome 4 as shown in SEQ ID NO: 13, which consists of a T-DNA insertion sequence of 521-19645 bp, an upstream flanking maize genomic sequence of 1-520 bp, and a downstream flanking maize genomic sequence of 19646-20425 bp.

[0013] In some embodiments, the DNA fragment comprises, from the 5' end to the 3' end:

[0014] 1) Upstream flanking maize genomic sequence: the 1st to 520th bp sequence of the sequence shown in SEQ ID NO: 13; or the 3' end sequence of the 1st to 520th bp sequence of the sequence shown in SEQ ID NO: 13 with a length of not less than 100 bp;

[0015] 2) T-DNA insertion sequence: 521-19645 bp of the sequence shown in SEQ ID NO: 13;

[0016] 3) Downstream flanking maize genomic sequence: the 19646-20425 bp sequence of the sequence shown in SEQ ID NO: 13; or the 5' end sequence of the 19646-20425 bp sequence of the sequence shown in SEQ ID NO: 13 with a length of not less than 100 bp.

[0017] On the other hand, the present invention provides a primer pair for detecting the above-mentioned corn transformation event or the above-mentioned DNA fragment, wherein the primer pair consists of a first primer that specifically recognizes the upstream flanking corn genomic sequence or the downstream flanking corn genomic sequence and a second primer that specifically recognizes the T-DNA insertion sequence.

[0018] In some embodiments, the sequence of the first primer is shown as SEQ ID NO: 14, and the sequence of the second primer is shown as SEQ ID NO: 15; or the sequence of the first primer is shown as SEQ ID NO: 16, and the sequence of the second primer is shown as SEQ ID NO: 17.

[0019] On the other hand, the present invention provides a method for identifying whether the above-mentioned corn transformation event exists in a corn biological sample, comprising: (a) extracting a DNA sample from the corn biological sample to be identified; (b) performing PCR amplification using the above-mentioned primer pair using the extracted DNA sample as a template; and (c) detecting the PCR amplification product. If the length of the PCR amplification product is consistent with the length obtained by amplification using the DNA template with the sequence shown in SEQ ID NO: 13, it indicates that the corn transformation event exists in the corn biological sample.

[0020] On the other hand, this article provides a method for obtaining transgenic insect-resistant and herbicide-resistant corn materials, comprising: hybridizing corn materials containing the above-mentioned corn transformation event with other corn breeding materials, and further backcrossing to obtain new materials containing the corn transformation event (such as obtaining pure line plants); wherein during the hybridization and / or backcrossing process, the above-mentioned identification method is used to screen and identify the offspring population to confirm the existence of the corn transformation event.

[0021] On the other hand, the present invention provides the use of the above DNA fragment for improving the insect resistance and herbicide tolerance agronomic traits of corn, conducting corn breeding, and as a molecular marker. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a map of the plant expression vector pBioT001.

[0023] Figure 2 Schematic diagram of the sequence flanking the left border (LB).

[0024] Figure 3Schematic diagram of the sequence flanking the right border (RB).

[0025] Figure 4 The results show that an amplified product of about 370 bp was obtained using the receptor material C01 DNA as a template and a primer pair with sequences of SEQ ID NO: 11 and SEQ ID NO: 12, and then sequenced and aligned with the flanking sequence of the CSJ1031 event.

[0026] Figure 5 Schematic diagram of the insertion sequence and flanking sequences.

[0027] Figure 6 Shown are the results of amplifying maize samples from CSJ1031 (T1 generation), CSJ1031 (T2 generation), CSJ1031 (T3 generation), and C01 using the primer pair CSJ1031LB5 / CSJ1031LB3, respectively. In the figure: M, marker, DL2000 plus; 1: CSJ1031-1 (the "-" after CSJ1031 indicates a passage, and the numbers represent plant numbers, similarly below), 2: CSJ1031-2, 3: CSJ1031-1-1, 4: CSJ1031-1-2, 5: CSJ1031-1-1-1, 6: CSJ1031-1-1-1, 7: C01. The positive amplified band is approximately 449 bp.

[0028] Figure 7 Shown are the results of amplifying maize samples from CSJ1031 (T1 generation), CSJ1031 (T2 generation), CSJ1031 (T3 generation), and C01 using the primer pair CSJ1031RB5 / CSJ1031RB3, respectively. In the figure: M, marker, DL2000 plus; 1: CSJ1031-1, 2: CSJ1031-2, 3: CSJ1031-1-1, 4: CSJ1031-1-2, 5: CSJ1031-1-1-1, 6: CSJ1031-1-1-1, 7: C01. The positive amplified band is approximately 534 bp. DETAILED DESCRIPTION

[0029] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0030] The present invention provides a maize transformation event CSJ1031 and primer pairs and methods for detecting the same. Maize plants carrying the CSJ1031 transformation event contain the event, i.e., a junction of an exogenous inserted DNA sequence and a maize genomic DNA sequence, on chromosome 4. Using the exogenous inserted DNA sequence and the DNA sequences of the junction regions flanking the maize genome, detection primers can be designed for specific detection of the CSJ1031 event. The detection method for the CSJ1031 event provides a convenient means for tracking this specific gene insertion event for applications utilizing this plant event for breeding. This specific gene insertion event can be used as a molecular marker to improve the efficiency of insect-resistant and herbicide-resistant breeding using this transformation event.

[0031] In the present invention, "transformation event" refers to an event in which an exogenous target gene is transformed into corn cells through an Agrobacterium-mediated genetic transformation method (well known to those skilled in the art), and the exogenous DNA sequence in the transgenic corn plant obtained is inserted and integrated at a specific position in the corn genome; the preferred corn transformation event CSJ1031 of the present invention has unique molecular characteristics of genetic information and insect-resistant and herbicide-resistant properties, and is suitable for the cultivation and application of insect-resistant and herbicide-resistant corn.

[0032] A "transformation event" is not a plant cell or plant; it is merely the vehicle for the transformation event. The core characteristic of a transformation event is a characteristic DNA sequence formed by the insertion of a foreign gene into a specific site in the plant genome, connecting the foreign insertion sequence with a specific maize genomic sequence and exhibiting specific application properties. Although the foreign target gene vector is identical, different transformation events exhibit different genetic traits due to the different insertion locations. These differences arise from two factors: first, the positional effect of insertion leads to different expression patterns of the foreign gene; second, the insertion of the foreign gene alters the genetic structure of the recipient plant, resulting in altered genetic traits. Seeking patents related to transformation events to protect the intellectual property rights of genetically modified crops is a new international trend. A commercialized transformation event is a unique biological creation, discovered through screening and identification by the inventor. The integration of the foreign gene into the specific site of the recipient crop genome not only imparts unique molecular characteristics but also unique expression patterns, distinguishing the transformation event from other transformation events discovered during research and possessing characteristics that are more suitable for commercial applications. Therefore, it possesses significant novelty, practicality, and inventiveness. At present, many transformation events have obtained intellectual property protection internationally, all of which are owned by some multinational companies. Some have also applied for patents in China, such as the Chinese patent ZL02802047.2.

[0033] "T-DNA insertion sequence" refers to an exogenous DNA sequence (including the iaaM protein coding sequence) that can be introduced into plants via the T-DNA sequence of Agrobacterium. Designating this insertion sequence as a T-DNA insertion sequence simply indicates that the present method utilizes Agrobacterium to achieve plant transformation and does not limit the maize transformation events of the present invention to being achieved solely via T-DNA sequences.

[0034] "Upstream flanking maize genomic sequence" refers to a sequence in the maize genome that is located upstream (5') of the T-DNA insertion sequence and adjacent to the 5' end of the T-DNA insertion sequence in the genome of a plant comprising the maize transformation event of the present invention. In this manner, the insertion position of the T-DNA insertion sequence in the maize genome can be determined. In some embodiments, the upstream flanking maize genomic sequence is the first 520 bp of the sequence set forth in SEQ ID NO: 13. In other embodiments, the upstream flanking maize genomic sequence is the first 520 bp of the sequence set forth in SEQ ID NO: 13, with a 3' end sequence length of no less than 100 bp (e.g., 200 bp, 300 bp, 400 bp, 500 bp, etc.). Those skilled in the art will appreciate that as long as the 3' end sequence is long enough to determine the genomic location (and therefore the insertion position of the T-DNA insertion sequence) in the maize genome, particularly on chromosome 4, it may even be less than 100 bp in length.

[0035] "Downstream flanking maize genomic sequence" refers to a sequence in the maize genome that is located downstream (3') of the T-DNA insertion sequence and adjacent to the 3' end of the T-DNA insertion sequence in the genome of a plant comprising the maize transformation event of the present invention. In this manner, the insertion position of the T-DNA insertion sequence in the maize genome can also be determined. In some embodiments, the downstream flanking maize genomic sequence is the 19646-20425 bp sequence of SEQ ID NO: 13. In other embodiments, the upstream flanking maize genomic sequence is the 5' end sequence of the 19646-20425 bp sequence of SEQ ID NO: 13, which is no less than 100 bp (e.g., 200 bp, 300 bp, 400 bp, 500 bp, etc.). Those skilled in the art will appreciate that as long as the 5' end sequence is long enough to determine the genomic position (and therefore the insertion position of the T-DNA insertion sequence) in the maize genome, particularly on chromosome 4, it may even be less than 100 bp in length.

[0036] When referring to a primer pair, the term "specific recognition" means that the first primer in the primer pair is complementary to or identical to a portion of the upstream sequence of a given template, and the second primer in the primer pair is identical to or complementary to a portion of the downstream sequence of the given template, so as to perform PCR amplification to obtain an amplicon including the portion of the upstream sequence and the portion of the downstream sequence and the sequence therebetween.

[0037] The inventors generated a maize plant transformation event, designated CSJ1031, that confers insect resistance and herbicide tolerance via transgenic methods. Representative seeds of this maize (Zea mays) transformation event were deposited with the China General Microbiology Culture Collection (CGMCC, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China) on March 21, 2025, under the deposit number CGMCC No. 30703.

[0038] The first aspect of the present invention provides a corn transformation event CSJ1031, characterized in that a DNA sequence on chromosome 2 of group D is shown in SEQ ID NO: 13, which consists of a T-DNA insertion sequence of 521-19645 bp, an upstream flanking corn genomic sequence of 1-520 bp, and a downstream flanking corn genomic sequence of 19646-20425 bp.

[0039] The second aspect of the present invention provides a DNA sequence comprising at least part or all of the T-DNA insertion sequence and part or all of the flanking maize genomic sequence. This characteristic DNA sequence fragment can be detected by the method provided in the fourth aspect of the present invention.

[0040] A third aspect of the present invention provides a primer pair for detecting the maize transformation event described in the first aspect of the present invention and the characteristic DNA sequence fragment described in the second aspect of the present invention, comprising a first primer that specifically recognizes either flanking sequence described in the first aspect of the present invention and a second primer that specifically recognizes the T-DNA insertion sequence described in the first aspect of the present invention. In some embodiments, the sequence of the first primer is SEQ ID NO: 14, and the sequence of the second primer is SEQ ID NO: 15; or the sequence of the first primer is SEQ ID NO: 16, and the sequence of the second primer is SEQ ID NO: 17.

[0041] A fourth aspect of the present invention provides a method for identifying transformation event CSJ1031 in a corn biological sample, comprising:

[0042] (a) extracting a DNA sample from a corn biological sample to be identified;

[0043] (b) using the extracted DNA sample as a template and performing PCR amplification using the primer pair described in the third aspect of the present invention;

[0044] (c) detecting the PCR amplification product. If the length of the amplified product is consistent with the theoretical length of the sequences of the PCR primer pair in SEQ ID NO: 13, it indicates the presence of the CSJ1031 transformation event in the corn biological sample.

[0045] A fifth aspect of the present invention provides a method for obtaining an insect-resistant and herbicide-tolerant transgenic corn material, comprising:

[0046] After hybridizing a corn material containing the corn transformation event described in the first aspect of the present invention with other corn breeding materials, preferably further backcrossing is performed to obtain a new material containing the transformation event described in the first aspect of the present invention;

[0047] During the hybridization or backcrossing process, the method described in the fourth aspect of the present invention is used to screen and identify the progeny population to confirm the presence of the transformation event described in the first aspect of the present invention.

[0048] The sixth aspect of the present invention provides the transformation event described in the first aspect of the present invention, the fragment of the characteristic DNA sequence of the transformation event described in the second aspect of the present invention, and the methods described in the fourth and fifth aspects of the present invention for improving insect resistance and herbicide tolerance traits, conducting plant breeding, and using them as molecular markers.

[0049] The novel transformation event of the present invention for improving insect resistance and herbicide tolerance can express insect resistance and herbicide tolerance proteins, and can be used to significantly improve the agronomic traits and quality of corn.

[0050] The present invention will be further described below with reference to the following non-limiting examples.

[0051] Example 1. Genetic transformation of maize

[0052] The method used in this study to obtain maize transformation events was Agrobacterium-mediated transformation according to the method and culture medium formulation reported by Frame et al. (Frame BR et al., Plant Physiol, 2002, 129: 13-22), using dipropyl ammonium phosphine as the screening agent.

[0053] The specific steps are as follows:

[0054] (1) Take parent corn ears 12 to 16 days after pollination and sterilize them with 75% alcohol for 2-4 minutes. Collect immature embryos 1.2-2.0 mm in size. Co-culture the Agrobacterium containing the transformation vector with the immature embryos at 22°C for 2-4 days.

[0055] (2) The immature embryos cultured in step (1) were transferred to a callus induction medium containing a final concentration of 200 mg / L of timentin antibiotic (GlaxoSmithKline, USA) and cultured in the dark at 28°C for 10-14 days to kill Agrobacterium.

[0056] (3) All callus tissues induced in step (2) were transferred to a screening medium containing a final concentration of 0.5 mM glyphosate and cultured in the dark at 28°C for 2-3 weeks.

[0057] (4) Transfer all calli from step (3) to fresh selection medium containing 0.5 M glyphosate and culture in the dark at 28°C for 2-3 weeks.

[0058] (5) Then, transfer the embryonic tissue that survived in step (4) to the regeneration medium and culture it in the dark at 28°C for 10-14 days, with one strain per dish.

[0059] (6) Transfer the embryonic tissue from step (5) to fresh regeneration medium and culture at 26°C in the light for 10-14 days.

[0060] (7) Transfer all fully developed plants from step (6) to rooting medium and culture them under light at 26°C until roots are fully developed. The rooted regenerated seedlings are transplanted to a greenhouse for growth and reproduction for screening and analysis.

[0061] Example 2. Field experiment of transgenic corn

[0062] According to the method of Example 1, 108 independent insect-resistant and glyphosate-tolerant maize transformants were obtained through Agrobacterium-mediated transformation, numbered CSJ1001 to CSJ1108. The maize transformants were screened for high expression of both the glyphosate-resistant gene cp4 and the insect-resistant gene cry1Ab by ELISA. Preliminary testing of insect and glyphosate resistance was conducted in a greenhouse: transformants with poor glyphosate resistance were removed by spraying 2000 ppm of glyphosate. The remaining transformants were inoculated with corn borers and screened for transformants that were not damaged by corn borers. A total of 9 maize transformants with strong insect and glyphosate resistance were obtained, including transformation events numbered "CSJ1001," "CSJ1031," "CSJ1034," "CSJ1045," "CSJ1051," "CSJ1063," "CSJ1072," "CSJ1077," and "CSJ1083." The transformants from the independent transformation events containing insect resistance and herbicide tolerance were saved as seeds for subsequent screening analysis.

[0063] (1) Glyphosate resistance screening

[0064] Nine T1 and T2 transgenic corn lines containing transformation events were selected for glyphosate tolerance comparison. Twenty to 30 days after germination, when the transgenic corn and their non-transgenic control parents had grown to the 4-5 leaf stage, they were sprayed with glyphosate at a final concentration of 8,000 ppm at a rate of 35 L / mu. Ten days later, corn growth and mortality were recorded. The results of the glyphosate spraying test are shown in Table 1. All transgenic lines exhibited significant glyphosate tolerance. Among them, those containing transformation events "CSJ1031," "CSJ1034," "CSJ1051," "CSJ1072," and "CSJ1083" exhibited the highest levels of glyphosate tolerance (Table 1).

[0065] (2) Insect resistance test

[0066] Nine T1 and T2 transgenic maize plants, including those from transformation event "CSJ1001," were selected for insect resistance analysis. Transgenic maize plants and their non-transgenic parental controls were sprayed with glyphosate at a final concentration of 8000 parts per million (PPM) 20 days after germination in the greenhouse to confirm transgenic status. Ten plants from each group were then inoculated with ten first-year corn borers (Ostrinia nubilalis) from the Corn Pest Group of the Institute of Plant Protection, Chinese Academy of Agricultural Sciences. Egg masses were incubated at 28±1°C, 70±5% relative humidity, and a 16:8 hour (L:D) ratio. Larvae within 12 hours of hatching were selected for bioassay testing. Seven days after inoculation, corn borer damage was assessed and grading was performed for insect resistance. The insect resistance grading adopts a 9-level standard (Marcon et al., Journal of Economic Entomology, 1999, 92(2):329-334): Level 1-3: Insect holes are needle-like (Level 1: rare and scattered; Level 2: medium number; Level 3: large number). Level 4-6: Insect holes are the size of a match head (Level 4: rare and scattered; Level 5: medium number; Level 6: large number). Level 7-9: Insect holes are larger than a match head (Level 7: rare and scattered; Level 8: medium number; Level 9: large number). Resistance level classification: Level 1-2 (highly resistant), Level 3-4 (resistant), Level 5-6 (susceptible), Level 7-9 (highly susceptible). The results are shown in Table 2. "CSJ1031", "CSJ1034" and "CSJ1077" have high insect resistance.

[0067] Table 1. Glyphosate tolerance test of corn

[0068] Conversion events T1 generation T2 generation CSJ1001 Heart leaves turn yellow Heart leaves turn yellow CSJ1031 No obvious weaknesses No obvious weaknesses CSJ1034 No obvious weaknesses No obvious weaknesses CSJ1045 Heart leaves turn yellow Heart leaves turn yellow CSJ1051 No obvious weaknesses No obvious weaknesses CSJ1063 Heart leaves turn yellow Heart leaves turn yellow CSJ1072 No obvious weaknesses No obvious weaknesses CSJ1077 Heart leaves turn yellow Heart leaves turn yellow CSJ1083 No obvious weaknesses No obvious weaknesses Non-GMO control die die

[0069] Table 2: Identification of resistance levels of different transformation events to corn borer

[0070] Conversion events T1 generation T2 generation Insect resistance level CSJ1001 Eat small amounts Eat small amounts 3 CSJ1031 A small number of feeding spots A small number of feeding spots 1 CSJ1034 A small number of feeding spots A small number of feeding spots 1 CSJ1045 A small number of feeding spots A small number of feeding spots 2 CSJ1051 Eat small amounts Eat small amounts 3 CSJ1063 A small number of feeding spots A small number of feeding spots 2 CSJ1072 Eat small amounts Eat small amounts 3 CSJ1077 A small number of feeding spots A small number of feeding spots 1 CSJ1083 Eat small amounts Eat small amounts 3 Non-GMO control Severe feeding Severe feeding 8

[0071] Example 3. Flanking sequence analysis

[0072] Sample preparation: Genomic DNA of corn materials containing the CSJ1031 transformation event was extracted using a plant DNA extraction method known to those skilled in the art. 2.5 μg of DNA was digested with Ssp I for 6-8 hours, purified by alcohol precipitation, and then dissolved in an appropriate amount of water.

[0073] Connectors: Based on the analysis of the vector enzyme cutting sites, two pairs of connectors were designed and synthesized:

[0074] GenomeWalker Adaptor+, GenomeWalker Adaptor- (sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively), wherein the 5' end of SEQ ID NO: 2 is phosphorylated and an amino group is added to the 3' end.

[0075] Mix equal amounts of GenomeWalker Adaptor+ and GenomeWalker Adaptor-, incubate at 70°C for 10 minutes, and then slowly cool to room temperature. Add 4 μl of digested and purified DNA to a tube containing 1.9 μl GenomeWalker Adaptor (25 μM), 1.6 μl 10X ligation buffer, and 0.5 μl T4 DNA ligase (6 units / μl). Ligate overnight at 16°C. Stop the reaction by incubating at 70°C for 5 minutes. Add 72 μl of TE (10 / 1, pH 7.5) to each tube and shake at low speed for 5-10 seconds.

[0076] Left border (LB) end sequence analysis: using Clontech GenomeWalker TM The Universal kit was used, using primers AP1 and GSP1 (SEQ ID NO:3 and SEQ ID NO:4, respectively) with the ligation product as the template. The first round of amplification was performed: 7 cycles of 94°C for 25 seconds, 72°C for 4 minutes; 32 cycles of 94°C for 25 seconds, 67°C for 4 minutes; and a final cycle followed by a 7-minute incubation at 67°C. The PCR product was diluted 50-fold and then a second round of PCR amplification was performed using primers AP2 and GSP2 (SEQ ID NO:5 and SEQ ID NO:6, respectively). The PCR program was as follows: 5 cycles of 94°C for 25 seconds, 72°C for 5 minutes; 20 cycles of 94°C for 25 seconds, 67°C for 4 minutes; and a final cycle followed by a 10-minute incubation at 67°C. The product was recovered and sequenced.

[0077] SEQ ID NO: 1

[0078] GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT

[0079] SEQ ID NO:2ACCAGCCC

[0080] SEQ ID NO:3GTAATACGACTCACTATAGGGC

[0081] SEQ ID NO:4AACGTCCTCATGAATCCGACACGC

[0082] SEQ ID NO:5ACTATAGGGCACGCGTGGT

[0083] SEQ ID NO:6TCGACGAATATCCGATCCTGGCCG

[0084] The left boundary (LB) sequence analysis of the CSJ1031 event is as follows Figure 2 As shown, a total of 1553bp of nucleotide sequence was obtained (the sequence is shown in SEQ ID NO: 7), including the 1st bp-398bp as the epsps partial sequence, the 399bp-654bp as the T-Nos terminator sequence, the 655bp-753bp as the intervening sequence (non-specific DNA sequence required for genetic manipulation, derived from T-DNA), and the 754bp-1553bp as the maize DNA sequence.

[0085] SEQ ID NO: 7 sequence description:

[0086] 1-398 EPSPS partial sequence

[0087] 399-654 T-Nos terminator

[0088] 655-753 interleaved sequence

[0089] 754-1553 Corn DNA

[0090]

[0091]

[0092] Right border (RB) end sequence analysis: Based on the obtained maize flanking sequences and the published maize genome sequence (https: / / phytozome-next.jgi.doe.gov / blast-search), upstream primer CSJ1031RBF (SEQ ID NO: 8) was designed. PCR amplification was performed using CSJ1031 genomic DNA as a template using CSJ1031RBM and downstream primers (shown in SEQ ID NO: 9). The PCR program was as follows: 35 cycles of 94°C for 25 seconds, 62°C for 25 seconds, and 72°C for 1 minute; the final cycle was followed by a 5-minute incubation at 72°C. The product was recovered and sequenced.

[0093] SEQ ID NO:8TAGCCGAGCA AGCAAATTTCTTCC

[0094] SEQ ID NO:9GCGAAGCATCCGCCGGTTCCT

[0095] The right boundary (RB) end sequence analysis of the CSJ1031 event is as follows Figure 3 As shown, a total of 921 bp of nucleotide sequence was obtained (the sequence is shown in SEQ ID NO: 10), including 1 bp to 520 bp of corn DNA sequence and 521 bp to 921 bp of vector backbone sequence.

[0096] SEQ ID NO: 10 sequence description:

[0097] 1bp-520bp corn DNA sequence

[0098] 521bp-921bp vector backbone sequence

[0099]

[0100] Using the receptor material C01 DNA as a template, primers CSJ1031J14F (sequence as SEQ ID NO: 11) and CSJ1031J14R (sequence as SEQ ID NO: 12) were designed at the LB and RB ends of the inserted sequence, respectively, to obtain an amplified product of about 370 bp and sequenced. Comparison with the flanking sequence of the CSJ1031 event revealed that the event was obtained by replacing 87 bp of the original genomic sequence (SEQ ID NO: 18, GGATTGTGATCTATGAAGCGAGAGCGGATACCATTCTTTGTCGTCGTTCCAACCTCA GCTTCTCTGCATTCGCTTTCTCGTATTCAC) by the inserted sequence. A screenshot of the alignment results is shown in FIG. Figure 4 .

[0101] SEQ ID NO:11TTTGTAGCAATACGTCCCGTCCT

[0102] SEQ ID NO:12GAATGAGTTG ACCCCAGGGC TGC

[0103] Based on the above results, those skilled in the art can easily derive the characteristic DNA sequence of the CSJ1031 event (SEQ ID NO: 13), as shown below. The underlined portion shows the T-DNA insertion sequence, and the ununderlined portion shows the flanking maize genomic DNA sequence of the insertion sequence. The schematic diagram of the insertion sequence and the flanking sequence is shown in FIG. Figure 5 shown.

[0104] SEQ ID NO: 13:

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111] Example 4. Transformation event detection

[0112] Whether the corn material has the unique marker DNA information of the CSJ1031 transformation event can identify whether the corn material is obtained using the technology of the present invention. Therefore, a specific DNA primer pair can be used for PCR amplification to detect the CSJ1031 event. The primer pair consists of a first primer that specifically recognizes any flanking sequence of the insertion sequence and a second primer that specifically recognizes the T-DNA insertion sequence of the present invention. For example, when the first primer is CSJ1031LB5 (SEQ ID NO: 14), the second primer can be CSJ1031LB3 (SEQ ID NO: 15); when the first primer is CSJ1031RB5 (SEQ ID NO: 16), the second primer can be CSJ1031RB3 (SEQ ID NO: 17). The results of amplifying the corn samples of the CSJ1031 event and C01 using the primer pairs CSJ1031LB5 / CSJ1031LB3 and CSJ1031RB5 / CSJ1031RB3, respectively, are as follows. Figure 6 and Figure 7 shown.

[0113] The PCR system is as follows:

[0114]

[0115] CSJ1031LB5 / CSJ1031LB3, CSJ1031RB5 / CSJ1031RB3, PCR program: 94.0℃5 min; 35 cycles: 94.0℃30 s, 62.0℃30 s, 72℃30 s; 72.0℃5 min.

[0116] SEQ ID NO:14GCGCGCGTGTCATCTATGTT

[0117] SEQ ID NO:15AGGGATGTGGGACGAAAGCAT

[0118] SEQ ID NO:16CACCCATCCCAGAAGCCCCTCT

[0119] SEQ ID NO:17CGGAGCAGATGCTAGGGCAAA

[0120] Example 5. Chromosome localization

[0121] Comparative analysis of the obtained maize flanking sequences with the published maize genome sequence (https: / / phytozome-next.jgi.doe.gov / blast-search) revealed that the maize flanking DNA sequence joining the insertion sequence in the CSJ1031 event is highly homologous to sequences on chromosome 4. Therefore, the integration site of the exogenous DNA insertion sequence in the CSJ1031 event is located on chromosome 4 of the recipient maize. Representative maize seeds from this plant transformation event were deposited with the General Microbiology Center of the China General Microbiology Culture Collection (CGMCC, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China) on March 21, 2025, under the accession number CGMCC No. 30703.

Claims

1. A maize transformation event, characterized in that The partial genome sequence of corn is replaced by the T-DNA insertion sequence on chromosome 4 of the corn, wherein the T-DNA insertion sequence is the 521-19645 bp sequence of the sequence shown in SEQ ID NO: 13, and the partial genome sequence is shown in SEQ ID NO:

18.

2. The corn transformation event of claim 1, wherein The upstream flanking maize genome sequence of the T-DNA insertion sequence is: 1) bp 1-520 of the sequence shown in SEQ ID NO: 13; or 2) A 3' end sequence of bp 1 to 520 of the sequence shown in SEQ ID NO: 13 that is no less than 100 bp in length.

3. The corn transformation event of claim 1 or 2, wherein: The downstream flanking maize genome sequence of the T-DNA insertion sequence is: 1) bp 19646-20425 of the sequence shown in SEQ ID NO: 13; or 2) A 5' end sequence of bp 19646-20425 of SEQ ID NO: 13 with a length of not less than 100 bp.

4. The maize transformation event according to any one of claims 1 to 3, wherein The DNA sequence shown in SEQ ID NO: 13 is included on chromosome 4 of maize, and the DNA sequence consists of the T-DNA insertion sequence of 521-19645 bp, the upstream flanking maize genomic sequence of 1-520 bp, and the downstream flanking maize genomic sequence of 19646-20425 bp.

5. A DNA fragment, characterized in that The DNA fragment includes, from the 5' end to the 3' end: 1) Upstream flanking maize genomic sequence: bp 1-520 of SEQ ID NO: 13; or a 3' end sequence of bp 1-520 of SEQ ID NO: 13 with a length of not less than 100 bp; 2) T-DNA insertion sequence: 521-19645 bp of the sequence shown in SEQ ID NO: 13; 3) Downstream flanking maize genomic sequence: the 19646-20425 bp sequence of the sequence shown in SEQ ID NO: 13; or the 5' end sequence of the 19646-20425 bp sequence of the sequence shown in SEQ ID NO: 13 with a length of not less than 100 bp.

6. A primer pair for detecting the maize transformation event according to any one of claims 1 to 4 or the DNA fragment according to claim 5, characterized in that: The method consists of a first primer which specifically recognizes the upstream flanking corn genome sequence or the downstream flanking corn genome sequence and a second primer which specifically recognizes the T-DNA insertion sequence.

7. The primer pair according to claim 6, wherein the sequence of the first primer is shown in SEQ ID NO: 14, and the sequence of the second primer is shown in SEQ ID NO: 15; or the sequence of the first primer is shown in SEQ ID NO: 16, and the sequence of the second primer is shown in SEQ ID NO:

17.

8. A method for identifying whether the maize transformation event of claim 1 is present in a maize biological sample, characterized in that: include: (a) extracting a DNA sample from the corn biological sample to be identified; (b) performing PCR amplification using the extracted DNA sample as a template and the primer pair according to claim 6 or 7; and (c) detecting the PCR amplification product. If the length of the PCR amplification product is consistent with the length obtained by amplification using the DNA template of the sequence shown in SEQ ID NO: 13, it indicates that the maize transformation event exists in the maize biological sample.

9. A method for obtaining transgenic insect-resistant and herbicide-resistant corn material, characterized in that: include: After hybridizing a corn material containing the corn transformation event described in any one of claims 1 to 4 with other corn breeding materials, backcrossing is further performed to obtain a new material containing the corn transformation event; wherein during the hybridization and / or backcrossing process, the method described in claim 8 is used to screen and identify the offspring population to confirm the presence of the corn transformation event.

10. Use of the DNA fragment according to claim 5 for improving the agronomic traits of corn such as insect resistance and herbicide tolerance, for corn breeding, and as a molecular marker.

Images