Novel cell lines and their use in therapy

Abstract

The present invention provides novel mesenchymal stem cell (MSC)-like cells and cell populations. Related DNA formulations, cell-free conditioned media, secretion groups, extracellular vesicle populations, compositions and uses thereof are also provided.

Description

Technical Field

[0001] The present invention provides novel mesenchymal stem cell (MSC)-like cells and cell populations, as well as related DNA preparations, cell-free conditioned medium, secretomes, extracellular vesicle populations, compositions, and uses thereof. Background Art

[0002] Mesenchymal stem cells (MSCs) reside in the bone marrow, where they generate skeletal tissue and interact with the immune system. The potent reparative and immunosuppressive functions of MSCs have driven their widespread clinical application as tissue regeneration and anti-inflammatory mediators. However, MSCs are almost always deployed in therapeutic settings as uncharacterized, mixed stromal cell populations derived from donor tissue (Wilson et al, 2021). This MSC heterogeneity introduces inconsistencies and complicates the mechanism of action, a fundamental requirement for any research drug. Furthermore, there are concerns regarding batch safety, reproducibility, scalability, and shipping / storage costs.

[0003] Extracellular vesicles (EVs) are nanometer-sized, membrane-bound carriers of proteins and nucleic acids that are produced and released by cells and mediate intercellular signaling. Accumulating evidence suggests that EVs produced by MSCs can deliver many of the restorative and anti-inflammatory therapeutic benefits of the parent cells, but with far fewer safety, delivery, and cost constraints. EVs survive for extended periods in the body without degradation or aggregation, are cell-free and therefore pose minimal risk of immunogenicity, and can be engineered to carry additional cargo, including pharmaceuticals. Consequently, there has been significant interest in developing EVs as a new therapeutic modality that combines the potency of stem cell therapies with the practicality of biopharmaceuticals. However, key challenges to further progress are batch consistency and scalability.

[0004] Therefore, there is a need for an improved approach to deliver the benefits of MSCs in a therapeutic setting. Summary of the Invention

[0005] To address the challenges posed by the use of MSCs in therapy, the inventors initiated an immortalization and cloning program to provide a group of MSC lines representing different bone marrow stromal subtypes, including stem cells of different potencies. From the numerous initial clones, eight clones were selected for in-depth characterization based on their strong in vitro growth performance. Advantageously, the inventors specifically identified a cell line, called Y201, which exhibits typical MSC characteristics, with strong tissue formation and anti-inflammatory properties in vitro and in vivo. The inventors have demonstrated that Y201 MSCs are highly reproducible and have thoroughly characterized these cells (e.g., their growth, transcriptomics, secretome, surfaceomics, and marker expression).

[0006] The inventors have demonstrated that Y201 MSCs produce abundant and consistent EVs and have collected data on their size, morphology, EV markers, miRNA, and proteomics. Advantageously, the inventors have demonstrated that Y201 EVs can stimulate cell growth (e.g., of donor MSCs and chondrocytes from arthritis patients), cartilage formation, and inhibit inflammation.

[0007] Surprisingly, further engineering of Y201 MSCs using CRISPR / Cas9 to target deletion of the FGFR3 gene favorably increased proliferation, migratory activity, and secretory behavior, enabling growth in serum-free conditions.

[0008] Therefore, provided herein is a mesenchymal stem cell (MSC)-like cell or a derivative thereof deposited with the European Collection of Authenticated Cell Cultures ("ECACC") under the deposit number 22072103.

[0009] Suitably, the derivative may have reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited as ECACC accession number 22072103.

[0010] Suitably, the derivative may only differ from the MSC-like cells deposited under ECACC accession number 22072103 in having reduced FGFR3 expression and / or activity.

[0011] Suitably, the derivative may:

[0012] (a) the levels of at least 10 different RNA transcripts selected from Table 5 are increased compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as ECACC deposit number 22072103; and / or

[0013] (b) the levels of at least 10 different RNA transcripts selected from Table 6 are reduced compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as ECACC deposit number 22072103.

[0014] Also provided is a mesenchymal stem cell (MSC)-like cell or a derivative thereof deposited with the European Collection of Animal Cells ("ECACC") with the deposit number 22072101.

[0015] Also provided is a cell population comprising a plurality of cells provided herein.

[0016] Also provided is a DNA preparation (DNA preparation) comprising genomic DNA of the cells provided herein.

[0017] Provided is a cell-free conditioned medium obtainable by cell culture of a cell provided herein, or a cell population provided herein.

[0018] Suitably, the cell-free conditioned medium may be depleted of extracellular vesicles (EVs).

[0019] Suitably, the cell-free conditioned medium may be substantially free of extracellular vesicles (EVs).

[0020] Also provided is a secretome or a portion thereof obtainable by cell culture of a cell provided herein, or a cell population provided herein.

[0021] Suitably, the secretome or fraction thereof may be depleted of extracellular vesicles (EVs).

[0022] Suitably, the secretome or portion thereof may be substantially free of extracellular vesicles (EVs).

[0023] Also provided is a population of extracellular vesicles (EVs) obtainable by cell culture of a cell provided herein, or a cell population provided herein.

[0024] Suitably, the EV population may be a 100K EV fraction.

[0025] Suitably, the cell-free conditioned medium, or secretome, or fraction thereof may comprise at least 10 different proteins selected from Table 2.

[0026] Suitably, the cell-free conditioned medium, or the secretome, or a fraction thereof, or the EV population may comprise at least 10 different proteins selected from Table 3.

[0027] Suitably, the cell-free conditioned medium, or the secretome, or a fraction thereof, or the EV population may comprise at least 10 different miRNAs selected from Table 4.

[0028] A composition is provided comprising at least 10 different proteins selected from Table 2.

[0029] Also provided is a composition comprising at least 10 different proteins selected from Table 3.

[0030] Also provided is a composition comprising at least 10 different miRNAs selected from Table 4.

[0031] Suitably, the composition may be a cell-free composition.

[0032] Also provided is a pharmaceutical composition comprising the MSC-like cells provided herein, the cell population provided herein, the DNA preparation provided herein, the cell-free conditioned medium provided herein, the secretome or a portion thereof provided herein, the extracellular vesicle (EV) population provided herein, or the composition provided herein, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant, excipient, diluent and / or carrier.

[0033] Provided is a pharmaceutical composition provided herein for use as a medicine.

[0034] Also provided is a method of treating a disease, disorder, and / or condition in a subject, comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition provided herein.

[0035] Also provided is a pharmaceutical composition provided herein for use in promoting tissue repair.

[0036] Also provided is a method of promoting tissue repair in a subject, the method comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition provided herein.

[0037] Suitably, the pharmaceutical composition may be used to treat or prevent a disease or condition associated with cartilage damage.

[0038] Suitably, the method of promoting tissue repair in a subject may be used to treat or prevent a disease or condition associated with cartilage damage.

[0039] Suitably, the disease or condition associated with cartilage damage may be arthritis, optionally the arthritis may be selected from the group consisting of juvenile idiopathic arthritis, rheumatoid arthritis, osteoarthritis, spondyloarthritis and psoriatic arthritis.

[0040] Suitably, the pharmaceutical composition may be used for wound healing and / or tissue regeneration.

[0041] Suitably, the method of promoting tissue repair in a subject may be used for wound healing and / or tissue regeneration.

[0042] Also provided is a pharmaceutical composition provided herein for use in treating or preventing inflammation.

[0043] Also provided is a method of treating or preventing inflammation in a subject, the method comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition provided herein.

[0044] Suitably, the pharmaceutical composition may be used to treat or prevent an autoimmune disease or condition.

[0045] Suitably, the method of treating or preventing inflammation may be used to treat or prevent an autoimmune disease or condition.

[0046] Also provided are uses of the extracellular vesicle (EV) populations provided herein for delivering cargo to cells.

[0047] Provided herein is a method for screening a test compound for its ability to induce MSC-like cell differentiation, the method comprising: a) contacting the test compound with the MSC-like cells or cell populations described herein; and b) determining the effect of the test compound on at least one differentiation marker.

[0048] Suitably, the at least one differentiation marker may be selected from: an osteogenic differentiation marker and a chondrogenic differentiation marker, optionally wherein:

[0049] a) the osteogenic differentiation marker is selected from the group consisting of type I collagen, alkaline phosphatase, BMP2, osteopontin, osteonectin, osteocalcin, bone sialoprotein, and Runx2; and / or

[0050] b) The chondrogenic differentiation marker is selected from the group consisting of type II collagen, type X collagen, aggrecan, lubricin, cartilage oligomeric matrix protein, and Sox9.

[0051] Also provided is the use of the MSC-like cells described herein, or the cell population described herein, for screening the ability of a test compound to induce MSC-like cell differentiation.

[0052] Throughout the description and claims of this specification, the words "comprises" and "comprising" and variations thereof mean "including but not limited to", and they are not intended to (and do not) exclude other parts, additives, components, integers or steps.

[0053] Throughout the description and claims of this specification, the singular encompasses the plural unless the context requires otherwise. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity unless the context requires otherwise.

[0054] Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.

[0055] Various aspects of the invention are described in further detail below. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Embodiments of the present invention are further described below with reference to the accompanying drawings, in which:

[0057] Figure 1 The karyotype of Y201 MSCs is shown. Represents 20 single cells selected from a Y201 culture at passage 73, with independent interpretation of the Y201 karyotype.

[0058] Figure 2Shown are the morphology and migration profiles of Y201 cells compared to the comparator MSC line MSC#2. A) Crystal violet-stained MSC subsets (scale bar = 50 μm). B) Cell morphology calculated from time-lapse imaged CFU-Fs. i) Length:width ratio, ii) cell perimeter, and iii) cell area. Unpaired t-test, P < 0.0001, n = 2418 cells. C) Rose plot highlighting the different migration profiles between the Y201 and MSC#2 subsets. D) Migration metrics calculated from time-lapse images of CFU-Fs Y201 versus MSC#2: i) distance migrated, ii) cell velocity Y201 = 0.413 μm / s ± 0.1064, MSC#2 = 0.2536 μm / s ± 0.068. E) Immunofluorescence micrographs of representative Y201 and MSC#2 cells showing DAPI-stained nuclei (blue), phalloidin-stained actin and focal adhesion proteins to mark focal adhesions (green). F) Average focal adhesion area per cell for Y201 vs. MSC#2 (t-test, p<0.0001, n=10-12). G) Average focal adhesion length (t-test, p<0.0001, n=10-12), error bars = mean ± SD, * = p≤0.05, ** = p<0.01, *** = p<0.001, **** = p<0.0001.

[0059] Figure 3 Factors secreted by Y201 MSCs alter the morphology and migration of another MSC subtype (MSC#2). A) Representative images of the total colony morphology of MSC#2 cells cultured in unconditioned medium (no CM), Y201-conditioned medium, or MSC#2-conditioned medium. B) Average colony area of MSC#2 colonies treated with various conditioned media (ANOVA: F = 60.05, df = 1.12, 2.26, p = 0.0113). C) Length:width ratio of cells tracked during a single replicate and average length:width ratio across multiple replicates (n = 5). D) Average cell movement speed across a single experiment and average speed across multiple replicates (n = 5). E) Distance traveled from the tracking origin across a single replicate and average distance across multiple replicates (n = 5). F) Representative rose plots of cell migration pathways following exposure to Y201- or MSC#2-conditioned medium. G) Phase contrast images of representative colonies at the assay endpoint. H) Immunofluorescence images of MSC#2 cells treated with Y201-CM or MSC#2-CM for 24 hours. Cells were stained with DAPI for nuclear staining, phalloidin to visualize actin, and vinculin to mark focal adhesions.

[0060] Figure 4Demonstrating the enrichment of the Y201 MSC secretome in extracellular matrix components. A) Volcano plot of proteins identified by LC-MS / MS in conditioned medium from Y201 and the comparator MSC line MSC#2. Proteins identified as significantly enriched by ANOVA (n=3, p<0.05). B) KEGG pathway-enriched proteins identified as significantly enriched in i) Y201 and ii) MSC#2. C) Proteins significantly enriched in Y201 secretion compared to MSC#2, sorted by overall normalized abundance by LC-MS / MS. Graphs are split for ease of interpretation while maintaining a linear scale. Mean ± SEM. D) Proteins significantly enriched in MSC#2 secretion compared to Y201, sorted by normalized abundance by LC-MS / MS. Graphs are split for ease of interpretation while maintaining a linear scale. E) Effects of different substrates (Y201-derived ECM, MSC#2-derived ECM, or plastic) on MSC#2 migratory behavior. Mean ± SEM.

[0061] Figure 5 Figure 2 shows the characteristics of EVs isolated from Y201 MSCs. A) Nanoparticle tracking analysis was used to determine the size of the 10k and 100k EV fractions from Y201 MSCs. B) Quantification of Y201 EVs versus the comparator MSC subline MSC#2 using LM14 Nanosight 3.4 software. C) Negatively stained Y201 EV samples were imaged using TEM. D) Western blot analysis of EV markers (Flotillin-1, CD81, CD63) and negative control (BiP) Y201 and MSC#2 EVs and whole cells.

[0062] Figure 6Figure 2 shows the effect of Y201 EV on MSC#2 proliferation. A) Y201 EV was delivered to primary bone marrow-derived MSCs. Y201 EV was labeled with CFSE (green) and applied to MSC cultures. CFSE-labeled EV uptake was tracked once per hour by fluorescence microscopy for 9 hours. Magenta = F-actin, white = nucleus. The data show CFSE fluorescence in cells from 5 hours onwards. B) MSC#2 cells treated with 1X, 5X, and 10X concentrations of Y201 EV, and the number of cells determined within 72 hours (DNA content measured by fluorescence using the CyQuant assay). Livecyte image analysis was used to determine the effect of 10X Y201EV on C) MSC#2 cell count, D) MSC#2 doubling time, E) dry mass, F) dry mass doubling time, and G) MSC#2 confluence. T-test or two-way ANOVA, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0063] Figure 7 Figure 2 shows the effect of Y201 EV on MSC#2 cell migration. MSC#2 migration was monitored using a scratch wound assay and Livecyte image analysis with and without exposure to Y201 EVs. A) Micrographs of untreated control (left) and Y201 EV-treated (right) scratch wounds at 0 hours (top) and 24 hours (bottom). Effects of Y201 EV on B) gap area, C) MSC#2 track speed, D) area T1 / 2, E) MSC#2 collective migration, F) MSC#2 track length, G) cell velocity, and H) forward migration compared to untreated controls. T-test or two-way ANOVA, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0064] Figure 8 The effect of Y201 EV on primary MSC proliferation is shown. Primary MSCs were exposed to 1X, 5X, and 10X concentrations of Y201 100k EV, and cell number was measured using Alamar Blue for 3 days. Two-way ANOVA followed by Tukey's multiple comparisons, **p<0.01, ***p<0.001, ****p<0.0001.

[0065] Figure 9Figure 2 shows the effect of Y201 EV on the proliferation of primary articular chondrocytes. Primary chondrocytes were exposed to 10X and 20X concentrations of Y201 100k EVs, and cell number was measured by Livecyte image analysis for 72 hours, showing A) confluence, B) total dry mass, C) cell count, and D) doubling time. E) Western blot of MFG-E8 in Y201 EVs (100k fraction), MSC#2 EVs, Y201 cells, and MSC#2 cells. L = molecular weight ladder. F) Effect of Y201 EVs on the proliferation of primary osteoarthritis articular chondrocytes with and without RGD blocking peptide (GRGDSP-SEQ ID NO.16) or RAD control peptide (GRADSP-SEQ ID NO.17). Two-way ANOVA followed by Tukey's multiple comparisons, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0066] Figure 10 Figure 2 shows the effect of Y201 EV on chondrogenesis. Primary donor MSCs were placed in micromass pellets under basal or chondrogenic differentiation conditions for 7 days with or without exposure to Y201 EVs. Micromass pellets were fixed, sectioned, and stained with Safranin O. Red staining indicates chondrogenic differentiation. A) Day 0 control, B) Day 7, no EV control, C) Day 7 with Y201 EVs, D) Day 7, no EV control, basal non-differentiation conditions, E) Day 7 with Y201 EVs, basal non-differentiation conditions. Data show an increase in micromass size and red staining / chondrogenesis after treatment with Y201 EVs.

[0067] Figure 11 Figure 2 shows the immunomodulatory capacity of EVs isolated from Y201 MSCs. A) Activated CD4+ T cells were treated in vitro with Y201 cells and Y201-EVs, showing the effect on the proportion of proliferating T cells and the number of cell cycles reached (n=2, average count events>18,000). B) Representative images of the proliferation generations of activated T cells alone and those treated with Y201 cells or their EVs. C and D) Separate graphs of the proliferation cycle and proliferation index, respectively. E) Polarization of activated T cells in the absence and presence of Y201-EVs (n=2, average count events>32,000).

[0068] Figure 12A, B) Peritoneal exudate cell counts after stimulation with zymosan (A) or schistosome eggs (B) in the absence and presence of Y201-EVs. C, D) Examination of TCR+CD4+, naive, and central memory T cells in peritoneal inflammation induced by zymosan or schistosome eggs in the presence and absence of Y201-EVs (n=3). One-way ANOVA with Bonferroni post hoc test, *p<0.05, **p<0.01, ***p<0.001.

[0069] Figure 13 Figure 2 shows a comparison of the colony-forming ability of WT and FGFR3-KO MSCs. There were no significant differences in CFU efficiency (A), average colony surface area (B), and total colony surface area (C) between the lines. Error bars (bar) show mean ± SEM, ns = p > 0.05, determined by t-test (using Welch correction for B), n = 3 biological replicates.

[0070] Figure 14 Crystal violet staining of WT and FGFR3-KO MSC colonies is shown. WT (A) and FGFR3-KO (B) well views of CFU-F plates. Views of individual colonies of WT (C) and FGFR3-KO (D) cells.

[0071] Figure 15 Figure 2 shows a comparison of WT and FGFR3-KO MSC proliferation rates. Alamar blue cell viability assay fluorescence readings at 600 nm relative to WT cell fluorescence at day 0 (A). Cell counts of WT and FGFR3-KO MSCs (B). Error bars show mean ± SEM, n = 6 (A) and n = 3 (B). **** = p < 0.0001, determined by Sidak's multiple comparison test.

[0072] Figure 16 Proliferation of WT and FGFR3-KO MSCs during sustained culture is shown. Cumulative cell counts (A) and population doublings (B) of WT and FGFR3-KO MSCs over time. Mean ± SEM are plotted, n = 3 biological replicates.

[0073] Figure 17Comparison of WT and FGFR3-KO MSC morphology is shown. Crystal violet-stained brightfield images of WT (A) and FGFR3-KO (B) MSCs. Area (C) shows the median, quartiles, and minimum-maximum values. Aspect ratio (D) and circularity index (E) show mean + SEM. **** = p < 0.0001, determined by Mann-Whitney test, n = 1032 for WT and n = 345 for FGFR3-KO MSCs.

[0074] Figure 18 The top ten significantly enriched KEGG pathways for genes downregulated (A) and upregulated (B) in FGFR3-KO MSCs compared to WT are shown. The p-values for all pathways were < 0.05, and the red line indicates a q-value of 0.05.

[0075] Figure 19 The top ten significantly enriched cellular component gene ontology (GO) terms for genes downregulated (A) and upregulated (B) in FGFR3-KO MSCs compared to WT are shown. The Q values of all GO terms were < 0.05.

[0076] Figure 20 The top ten significantly enriched biological process gene ontology (GO) terms for genes downregulated (A) and upregulated (B) in FGFR3-KO MSCs compared to WT are shown. The Q values of all GO terms were < 0.05.

[0077] Figure 21 Shown are the top ten significantly enriched molecular function gene ontology (GO) terms for genes downregulated (A) and upregulated (B) in FGFR3-KO MSCs compared with WT.

[0078] Figure 22 Visualization of the actin cytoskeleton of WT and FGFR3-KO MSCs is shown. Representative confocal images of WT (A, B) and FGFR3-KO (C, D) MSCs were stained with Alexa Fluor 594-conjugated phalloidin to label actin (red) and DAPI to label nuclei (blue). Scale bar corresponds to 20 μm.

[0079] Figure 23 Comparison of actin cytoskeleton shape of WT and FGFR3-KO MSCs is shown. Roundness (A) and aspect ratio (B) of WT and FGFR3-KO MSCs. ****=p<0.0001; Mann Whitney test.

[0080] Figure 24Visualization of Arp3 protein in WT and FGFR3-KO MSCs is shown. Immunofluorescence of WT (A, C, E) and FGFR3-KO (B, D, F) MSCs, staining for Arp3 (green), actin (red), and nuclei (blue). Scale bar = 20 μm.

[0081] Figure 25 Shown are scratch closures of WT and FGFR3-KO MSCs after 24 hours of wound healing. Error bars show mean + SEM, * = p < 0.05, t-test, n = 5.

[0082] Figure 26 Figure 2 shows the migration characteristics of WT and FGFR3-KO MSCs. Gap closure (A) of WT and FGFR3-KO MSCs after migration for 24 hours. Total track length (B) and instantaneous velocity (C) of individual cells during the entire migration process. Number of cell divisions (D) in each visual field during the migration process. Area (E), sphericity (F) and linearity (directivity, directness) (G) of individual cells during the entire migration process. Static images of WT (H) and FGFR3-KO (I) MSCs at the end of 24 hours of migration, where the lines represent the initial gap space. Box plots show minimum, maximum and quartile values. Error bars show mean ± SEM. **** = p < 0.0001; ** = p < 0.01; * = p < 0.05, AC, E, F were determined by Mann Whitney test, and D, G were determined by t test.

[0083] Figure 27 Nanoparticle tracking analysis (NTA) of extracellular vesicles (EVs) from WT and FGFR3-KO MSCs is shown. Histogram overlay of EV size distribution of 2k (A), 10k (B), and 100k (C) fractions. Bars show mean ± SEM of 5 technical replicates. Lower bar = WT, upper bar = FGFR3-KO.

[0084] Figure 28 Representative transmission electron micrographs of 100k extracellular vesicles from WT and FGFR3-KO MSCs are shown. EVs isolated from WT (A, B) and FGFR3-KO (CF) MSCs. Scale bars are indicated in each figure.

[0085] Figure 29Figure 2 shows cell migration indices after wounding of WT MSCs treated with components of the FGFR3-KO MSC secretome. Percentage of wound closure (A), total track length (B), directness index (C), and average cell thickness (D) after 24 hours. Instantaneous velocity (E) over the entire time course. Error bars represent mean ± SEM. Lines represent mean values. **** = p < 0.0001; ** = p < 0.01; * = p < 0.05, Tukey's multiple comparison test (A), Dunn's multiple comparison test (B).

[0086] Figure 30 Shown are the effects of WT and FGFR3-KO conditioned medium (CM) on WT MSC wound healing compared to FGFR3-KO MSC healing. ****=p<0.0001; **=p<0.01; ns=p>0.05; Dunn's multiple comparison test. Error bars show mean+SEM.

[0087] Figure 31 Figure 22 shows the effect of conditioned medium (CM) on MSC morphology and proliferation.WT or FGFR3-KO (KO) MSC are processed with the CM derived from WT (+WT CM) or FGFR3-KO (+KO CM) MSC, and read the Alamar blue cell viability assay fluorescence readings at 600nm, and the fluorescence relative to the 0th day WT cells is shown, and the legend shows the order (A) of the bars on the chart. On the second day of treatment, cell area (B), length: width ratio (C) and circularity (D) were calculated. Error bars show mean + SEM, and box plots show 1-99 percentiles and each quartile. According to Tukey's multiple comparison test, there are no significant differences in A. According to Dunn's multiple comparison test, significant differences relative to each untreated control are shown for BD: ****=p<0.0001; *=p<0.05.

[0088] Figure 32 Figure 2 shows the effect of FGFR3-KO extracellular vesicles (EVs) on WT MSC proliferation. Alamar blue cell viability assay fluorescence readings at 600 nm are shown relative to the fluorescence of WT cells on day 0. The legend shows the order of the lines on the graph, from top to bottom. B shows the mean ± SEM of 3 biological replicates, with no significant differences according to the Sidak multiple comparison test.

[0089] Figure 33The proliferation and morphology of WT and FGFR3-KO MSCs on serum-free (0% FBS) culture medium are shown. Alamar blue cell viability assay (A) of WT and FGFR3-KO (KO) MSCs cultured in control or serum-free (SF) culture medium. Fluorescence relative to WT MSCs at day 0. Cumulative cell counts (B) of WT and FGFR3-KO MSCs, with arrows indicating expansion (amplification) to additional culture flasks. Points show mean ± SEM. The legend shows the order of the lines on the graph, from top to bottom. Bright field images of crystal violet-stained WT MSCs cultured in complete medium (C) or SF medium (D) and FGFR3-KO MSCs cultured in complete medium (E) or SF medium (F). Scale bar = 200 μm.

[0090] Figure 34 Functional enrichment analysis of the Y201 EV proteome (100k fraction) is shown. A) Enrichment analysis for biological processes, B) molecular functions, and C) cellular component gene ontology (GO) terms for the Y201 proteome. Only the most significant terms are shown, determined by the -log10 adjusted p-value (FDR) and the number of proteins associated with each term. Protein counts are shown. (D) BiNGO network of significant GO biological process terms for the Y201 proteome, annotated as common terms clustered by similar processes. Darker shading corresponds to higher significance (p-value threshold <0.05).

[0091] Figure 35 A) STRING PPI network details the relative abundance and strength of protein interactions in the Y201 core proteome (100k fraction) on the EV surface. Node size maps to protein relative abundance; edge width corresponds to the combined score of the interaction. Network visualization created using BioRender.com. B) Western blot analysis of fibronectin-1 (FN1) and MFG-E8 in Y201 (100k fraction) and MSC#2 EVs and cell lysates.

[0092] Figure 36Figure 2 shows the absorption (ingestion) of Y201 EV (100k fraction) by MSC#2 cells. A) MSC#2 cells were treated with 10X CFSE-Y201EV and the CFSE signal in the cells was monitored for 10 hours. The histogram (count vs. CFSE) signal was normalized to the peak value, and the dotted line represents the median value for quantifying the CFSE signal level relative to the control (cell). B) The quantification of the median CFSE intensity relative to the control is plotted as a bar graph. n=3, error bars=SEM, Kruskal-Wallis test, *p<0.05, **p<0.01, ***p<0.001.

[0093] Figure 37 Shown are the uptake of CFSE-labeled 201EV (100k fraction) by MSC#2 cells with and without RGD blocking peptide (GRGDSP - SEQ ID NO. 16) or RAD control peptide (GRADSP - SEQ ID NO. 17). A) Histogram of CFSE signal demonstrates population shift after 4 hours of exposure to Y201-labeled EV. B) Quantification of the fold change in CFSE median fluorescence of MSC#2 cells. n = 6, error bars = SEM, one-way ANOVA with Bonferroni correction.

[0094] Figure 38 The effect of Y201 EV (100k fraction) on disease activity in an in vivo adjuvant-induced arthritis model is shown. A) Reduction in joint size (mm), B) synovial infiltration score, C) joint effusion score, D) synovial hyperplasia score, E) arthritis index. Mice were sacrificed 3 days after treatment and sections were scored by two independent scorers. F and I) PBS control, G and J) Hematoxylin and eosin stained sections of the knee joints of mice treated with Y201EV. The boxed areas in F and G are magnified in I and J, respectively, showing examples of synovial infiltration (cell infiltration into the synovium; arrows) and synovial hyperplasia (thickened synovial lining (synovial lining); arrows). Scale bar = 500 mm. Mean ± SD (n = 4) are shown, unpaired t-test with Welch correction, *p < 0.05, **p < 0.01, ***p < 0.001.

[0095] The patents, scientific, and technical literature cited herein establish the knowledge available to those skilled in the art at the time the applications were filed. The entire disclosures of issued patents, published and pending patent applications, and other publications cited herein are incorporated by reference to the same extent as if each were specifically and individually indicated to be incorporated by reference. In the event of any inconsistency, the present disclosure controls.

[0096] Various aspects of the invention are described in further detail below.

[0097] Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure

[0098] The cell lines described in this application are deposited with the United Kingdom Health Security Agency Porton Down and the European Collection of Animal Cell Cultures (ECACC), an international collection located at the UK Heath Security Agency, Culture Collections, Porton Down, Salisbury, SP4 0JG, UK.

[0099] This deposit was made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. DETAILED DESCRIPTION

[0100] As described above, the inventors have identified a novel MSC-like cell line, termed Y201, which exhibits typical MSC properties, advantageously having potent tissue-forming and anti-inflammatory properties both in vitro and in vivo. The inventors have demonstrated that Y201 MSCs are highly reproducible and have thoroughly characterized these cells (e.g., their growth, transcriptomics, secretomes, surface omics, and marker expression).

[0101] The inventors have demonstrated that Y201 MSCs produce abundant and consistent EVs and have collected data on their size, morphology, EV markers, miRNA, and proteomics. Advantageously, the inventors have demonstrated that Y201 EVs can stimulate cell growth (e.g., of donor MSCs and chondrocytes from arthritis patients), cartilage formation, and inhibit inflammation.

[0102] Surprisingly, the inventors have demonstrated that further engineering of Y201 MSCs using CRISPR / Cas9 to target deletion of the FGFR3 gene advantageously increases proliferation, migratory activity and secretory behavior, thereby enabling growth in serum-free conditions.

[0103] Therefore, provided herein are mesenchymal stem cell (MSC)-like cells or derivatives thereof deposited under ECACC deposit number 22072103.

[0104] Mesenchymal stem cell (MSC)-like cells deposited under ECACC deposit number 22072103 may be referred to herein as "Y201 cells," "(Y201) WT MSCs," and / or "Y201 MSCs." Y201 cells (deposited under ECACC deposit number 22072103) were deposited on July 21, 2022, at the Health and Safety Executive, Porton Down, UK, and at the European Collection of Animal Cells, Porton Down, SP4 0JG, Salisbury, UK, under the Budapest Treaty of 1977.

[0105] Mesenchymal stem cells (MSCs) are multipotent stromal cells that have the potential to differentiate into various mesenchymal cell types of the adipocyte, chondrocyte and osteocyte lineages, including: osteoblasts, chondrocytes, neurons, muscle cells and adipocytes. This potential has been demonstrated in specific cells and tissues both in vivo and in vitro. Mesenchymal stem cells (MSCs) are located in the bone marrow, where they produce bone tissue and interact with the immune system. MSCs have potent repair and immunosuppressive functions, which have promoted their widespread clinical application as tissue regeneration and anti-inflammatory mediators. When plated at low seeding density (plating), MSCs can plastically adhere, migrate and form colonies (CFU-F). After immortalization, MSCs also exhibit robust growth and a stable phenotype. MSC cells can be phenotypically defined by gene or protein expression. MSCs have been characterized as expressing (and therefore being positive for) one or more of CD13, CD29, CD44, CD49a, b, c, e, f, CD51, CD54, CD58, CD71, CD73, CD90, CD102, CD105, CD106, CDwl 19, CD120a, CD120b, CD123, CD124, CD126, CD127, CD140a, CD166, P75, TGF-bIR, TGF-blIR, HLA-A, B, C, SSEA-3, SSEA-4, D7, and PD-L1. These cells are also characterized as not expressing one or more of CD3, CD5, CD6, CD9, CD10, CD11a, CD14, CD15, CD18, CD21, CD25, CD31, CD34, CD36, CD38, CD45, CD49d, CD50, CD62E, L, S, CD80, CD86, CD95, CD117, CD133, SSEA-1, and ABO (and are therefore negative for them). Thus, mesenchymal stem cells can be characterized by phenotype and / or functionality, for example, according to their differentiation potential and / or their functionality, such as their repair or immunosuppressive function.

[0106] " Mesenchymal stem cell (MSC) sample cells " used herein refer to cells that are immortalized cells selected for cloning and have one or more markers and / or behavioral characteristics associated with typical MSCs. For example, MSC sample cells may exhibit a stem cell-like phenotype, such as differentiation potential. As described elsewhere herein, the inventors have identified cells (i.e., Y201 cells) deposited with ECACC deposit number 22072103 that exhibit typical MSC characteristics in vivo and in vitro, particularly powerful tissue formation and anti-inflammatory properties, as demonstrated in vitro tri-lineage differentiation, proliferation, and T cell activation assays, in vivo subcutaneous implantation assays, and peritonitis models (see also Examples section below). Therefore, Y201 cells as described herein are examples of MSC sample cells. In another example, as described in more detail elsewhere herein, the inventors have identified that the cell (i.e., Y201 FGFR3 KO cell) deposited with ECACC deposit number 22072101 also shows some typical MSC characteristics in vitro, particularly their marker expression, plastic adherence and colony formation potentiality, as demonstrated by flow cytometry and image analysis (also referring to the Examples section below). Therefore, the Y201 FGFR3 KO cell described in more detail below is also an example of MSC sample cells. Those skilled in the art can easily identify mesenchymal stem cell (MSC) sample cells using conventional methods known in the art, for example, using the method described above and the method described in the Examples section below. Another example of MSC sample cells is the MSC#2 cell line, which is used as a comparison cell line in the Examples section below.

[0107] The term "derivative" used herein in the context of cell refers to the daughter cell derived from "parent (mother)" cell, wherein the daughter cell is genetically different from the parent cell. In other words, derivative is the modified form (improved form, modified form, modified version) of the original (parent) cell of the derivative. The derivative can be transformed (improved, modified) by any method known in the art, natural or non-natural method (including genetic engineering). Derivative cells as herein described can be derived from (for example, produced from) mesenchymal stem cell (MSC) sample cells deposited with ECACC deposit number 22072103. An example of a derivative derived from mesenchymal stem cell (MSC) sample cells deposited with ECACC deposit number 22072103 is mesenchymal stem cell (MSC) sample cells deposited with ECACC deposit number 22072101. In this case, the mesenchymal stem cell (MSC)-like cells deposited under ECACC deposit number 22072103 are the "parent" cells, and the mesenchymal stem cell (MSC)-like cells deposited under ECACC deposit number 22072101 are the engineered daughter cells.

[0108] Derivative cells as described herein can be derived from (e.g., produced from) mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101. In this case, the derivative cells can be a modified form (modified daughter cell) of the mesenchymal stem cell (MSC)-like cells (parent cells) deposited with ECACC deposit number 22072101.

[0109] In one example, a derivative (e.g., a derivative of the mesenchymal stem cell (MSC)-like cells deposited with ECACC Accession No. 22072103, or a derivative of the mesenchymal stem cell (MSC)-like cells deposited with ECACC Accession No. 22072101) can have reduced expression and / or activity of a particular protein compared to the cell from which the derivative was derived (e.g., the MSC-like cells deposited with ECACC Accession No. 22072103, or a derivative of the mesenchymal stem cell (MSC)-like cells deposited with ECACC Accession No. 22072101).

[0110] As discussed elsewhere herein, the inventors used CRISPR / Cas9 to engineer Y201 cells to target deletion of the FGFR3 gene and determine the effects on cell behavior. The inventors unexpectedly discovered that such further engineering of Y201 MSCs advantageously improved the proliferation, migration activity, and secretory behavior of the engineered cells and further enabled their growth under serum-free conditions.

[0111] Therefore, the present inventor has determined that it is advantageous to transform the Y201 cell to produce a knockout with FGFR3 as a target.Therefore, in some examples, compared with the MSC sample cell deposited with ECACC deposit number 22072103, derivative (i.e. derivative of mesenchymal stem cell (MSC) sample cell deposited with ECACC deposit number 22072103) has FGFR3 expression and / or activity of reduction.

[0112] In a further example, the derivative (ie, a derivative of the mesenchymal stem cell (MSC)-like cells deposited as ECACC deposit number 22072103) differs from the MSC-like cells deposited as ECACC deposit number 22072103 only in having reduced FGFR3 expression and / or activity.

[0113] Fibroblast growth factor receptor 3 (FGFR3; Gene ID 2261) is an example of a fibroblast growth factor receptor (FGFR) that is a high-affinity receptor for fibroblast growth factors. These factors play a variety of roles in cell growth, differentiation, and other biological processes, and their precise function depends on the target cell and developmental stage. The FGFR3 gene is located on the short arm of chromosome 4 and encodes a receptor tyrosine kinase. The FGFR3 protein has a transmembrane domain in the central portion, a tyrosine kinase domain at the carboxyl terminus, and an extracellular domain at the amino terminus. FGFR3 is known to have isoforms, including FGFR-IIIb and FGFR-IIIc, which are generated by alternative splicing at the amino terminus. FGF-1 and FGF-9 are ligands for FGFR3b (FGFR-IIIb), and FGF-1, FGF-2, FGF-4, FGF-8, FGF-9, FGF-17, FGF-18, and FGF-23 are ligands for FGFR3c (FGFR-IIIc).

[0114] As used herein, the term "FGFR3" can include mutant and wild-type forms, isoforms and variants thereof (e.g., human FGFR3 polypeptides (e.g., human FGFR3-IIIb isoform or human FGFR3-IIIc isoform). The italicized term "FGFR3" used herein generally refers to the FGFR3 gene.

[0115] The term "wild-type sequence" specifically encompasses naturally occurring truncated forms (e.g., extracellular domain sequences or transmembrane subunit sequences), naturally occurring variant forms (e.g., alternative splicing forms), and naturally occurring allelic variants. The term "wild-type FGFR3" generally refers to a gene or polypeptide comprising the amino acid sequence of a naturally occurring FGFR3 gene or protein. For example, in the context of the present invention, gene ID 2261 present in Y201 cells can be considered to be wild-type FGFR3. The term "mutation" as used herein refers to the difference in the amino acid or nucleic acid sequence of a specific protein or nucleic acid (e.g., gene or RNA), respectively, relative to a wild-type protein or nucleic acid. The mutated protein or nucleic acid can be expressed or found from one allele (heterozygote) or two alleles (homozygote) of a gene. Mutations can include sequence rearrangements, such as insertions, deletions, and point mutations (including single nucleotide / amino acid polymorphisms).

[0116] In some examples, compared with the MSC sample cell deposited with ECACC preservation number 22072103, FGFR3 expression and / or activity have been reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%. In some examples, compared with the MSC sample cell deposited with ECACC preservation number 22072103, FGFR3 expression and / or activity have been reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%. In some examples, compared with the MSC sample cell deposited with ECACC preservation number 22072103, FGFR3 expression and / or activity have been reduced by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100%. In another example, compared with the MSC sample cell deposited with ECACC preservation number 22072103, FGFR3 expression and / or activity have been reduced by at least 50%. In a further example, FGFR3 expression and / or activity is reduced by at least 70% compared to the MSC-like cells deposited as ECACC deposit number 22072103.

[0117] The reduction of FGFR3 expression in the cell can occur at the nucleic acid or protein level (for example, at gene, transcript (for example, precursor mRNA (pre-mRNA) transcript, mature mRNA transcript or cDNA transcript) and / or protein level). The method for determining FGFR3 expression is well known in the art, and includes, for example, Western blotting. The method for reducing FGFR3 expression in the cell is well known in the art, and includes, for example, using CRISPR / Cas9, genetic mutation or RNAi. In some examples, compared with the MSC-like cells deposited with ECACC deposit number 22072103, the amount of FGFR3 expression has decreased by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%. In some examples, compared with the MSC sample cell deposited with ECACC preservative number 22072103, the amount of FGFR3 expression has reduced by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100%.In another example, compared with the MSC sample cell deposited with ECACC preservative number 22072103, FGFR3 expression has reduced by at least 50%.In a further example, compared with the MSC sample cell deposited with ECACC preservative number 22072103, FGFR3 expression has reduced by at least 70%.

[0118] In some embodiments, the reduction of FGFR3 activity in the cell may occur due to the minimizing of the amount of FGFR3 protein in the cell (for example, due to the minimizing of FGFR3 expression, the increase of FGFR3 degradation and / or the FGFR3 mutation causing FGFR3 protein to reduce). In some embodiments, the reduction of FGFR3 activity in the cell may occur due to the minimizing of the amount of FGFR3 protein in the cell (for example, due to the FGFR3 mutation causing the minimizing of FGFR3 expression, the increase of FGFR3 degradation and / or the FGFR3 mutation causing the FGFR3 protein to reduce). In some embodiments, the reduction of FGFR3 activity in the cell may also occur due to the minimizing of the amount of functional FGFR3 protein in the cell (for example, due to FGFR3 interacting with its part or combining and / or activating the ability of FGFR3 signal transduction). It is well known in the art for determining that the method for FGFR3 activity is active, and includes, for example, measuring the phosphorylation of ERK1 / 2 by Western blotting. It is well known in the art for reducing the method for FGFR3 activity in the cell, and includes, for example, using the inhibitor of direct targeting FGFR3 (for example, by blocking the interaction of itself and its part). In some examples, compared with the MSC sample cell deposited with ECACC preservation number 22072103, the amount of FGFR3 activity has decreased by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%. In some examples, compared with the MSC sample cell deposited with ECACC preservation number 22072103, the amount of FGFR3 activity has decreased by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100%. In another example, compared with the MSC sample cell deposited with ECACC preservation number 22072103, FGFR3 activity has decreased by at least 50%. In a further example, the FGFR3 activity is reduced by at least 70% compared to the MSC-like cells deposited as ECACC deposit number 22072103.

[0119] In some examples, (e.g., wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited with ECACC Deposit No. 22072103, or the derivative differs from the MSC-like cells deposited with ECACC Deposit No. 22072103 only in having reduced FGFR3 expression and / or activity), the derivative may have increased levels of at least 10 different RNA transcripts selected from Table 5 compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited with ECACC Deposit No. 22072103. In other words, at least 10 different RNA transcripts selected from Table 5 may be upregulated in the derivatives (e.g., wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited with ECACC deposit number 22072103, or wherein the derivative differs from the MSC-like cells deposited with ECACC deposit number 22072103 only in having reduced FGFR3 expression and / or activity) compared to the same RNA transcript levels in the mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103.

[0120] In some examples, (e.g., wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Deposit No. 22072103, or wherein the derivative differs from the MSC-like cells deposited under ECACC Deposit No. 22072103 only in having reduced FGFR3 expression and / or activity), the derivative may have increased levels of at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different RNA transcripts selected from Table 5 as compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Deposit No. 22072103. For example, the derivative may have increased levels of at least 10, at least 20, at least 30, at least 40 or at least 50 different RNA transcripts selected from Table 5 compared to the levels of the same RNA transcripts in mesenchymal stem cells (MSC)-like cells deposited with ECACC deposit number 22072103.

[0121] In some examples, (e.g., wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited with ECACC Deposit No. 22072103, or wherein the derivative differs from the MSC-like cells deposited with ECACC Deposit No. 22072103 only in having reduced FGFR3 expression and / or activity), the derivative may have increased levels of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 different RNA transcripts selected from Table 5 compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited with ECACC Deposit No. 22072103. For example, the derivative may have increased levels of 10, 20, 30, 40 or 50 different RNA transcripts selected from Table 5 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as ECACC deposit number 22072103.

[0122] In some examples, (e.g., wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited with ECACC Deposit No. 22072103, or the derivative differs from the MSC-like cells deposited with ECACC Deposit No. 22072103 only in having reduced FGFR3 expression and / or activity), the derivative may have reduced levels of at least 10 different RNA transcripts selected from Table 6 compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited with ECACC Deposit No. 22072103. In other words, at least 10 different RNA transcripts selected from Table 6 may be down-regulated in the derivative (e.g., wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited with ECACC deposit number 22072103, or wherein the derivative differs from the MSC-like cells deposited with ECACC deposit number 22072103 only in that the derivative has reduced FGFR3 expression and / or activity) compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103.

[0123] In some examples, (e.g., wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Deposit No. 22072103, or wherein the derivative differs from the MSC-like cells deposited under ECACC Deposit No. 22072103 only in having reduced FGFR3 expression and / or activity), the derivative may have reduced levels of at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different RNA transcripts selected from Table 6, compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Deposit No. 22072103. For example, the derivative may have reduced levels of at least 10, at least 20, at least 30, at least 40 or at least 50 different RNA transcripts selected from Table 6 compared to the levels of the same RNA transcripts in mesenchymal stem cells (MSC)-like cells deposited with ECACC deposit number 22072103.

[0124] In some examples, (e.g., wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited with ECACC Deposit No. 22072103, or wherein the derivative differs from the MSC-like cells deposited with ECACC Deposit No. 22072103 only in having reduced FGFR3 expression and / or activity), the derivative may have reduced levels of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 different RNA transcripts selected from Table 6 compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited with ECACC Deposit No. 22072103. For example, the derivative may have reduced levels of 10, 20, 30, 40 or 50 different RNA transcripts selected from Table 6 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as ECACC accession number 22072103.

[0125] It will be clear to those skilled in the art that in some examples (e.g., wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited with ECACC deposit number 22072103, or wherein the derivative differs from the MSC-like cells deposited with ECACC deposit number 22072103 only in having reduced FGFR3 expression and / or activity), the derivative may have increased levels of multiple RNA transcripts (e.g., selected from the group consisting of RNA transcripts from Table 5) compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103, and may also have reduced levels of multiple RNA transcripts (e.g., selected from the group consisting of RNA transcripts from Table 6) compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103. In this context, it will be clear to the skilled person that the derivatives may have any combination of these characteristics (e.g., any combination of (i) increased levels of a plurality of RNA transcripts selected from Table 5 and (ii) decreased levels of a plurality of RNA transcripts selected from Table 6, compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited under ECACC deposit number 22072103).

[0126] Thus, in some examples (e.g., wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Deposit No. 22072103, or wherein the derivative differs from the MSC-like cells deposited under ECACC Deposit No. 22072103 only in having reduced FGFR3 expression and / or activity), the derivative may:

[0127] (a) having increased levels of at least 10 different RNA transcripts (e.g., 10 different RNA transcripts) selected from Table 5, compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as ECACC deposit number 22072103; and / or

[0128] (b) having reduced levels of at least 10 different RNA transcripts (e.g., 10 different RNA transcripts) selected from Table 6 as compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as ECACC deposit number 22072103.

[0129] For example, the derivative may:

[0130] (a) having increased levels of at least 20 different RNA transcripts (e.g., 20 different RNA transcripts) selected from Table 5, compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as ECACC deposit number 22072103; and / or

[0131] (b) having reduced levels of at least 20 different RNA transcripts (e.g., 20 different RNA transcripts) selected from Table 6 as compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as ECACC deposit number 22072103.

[0132] In another example, the derivative may:

[0133] (a) having increased levels of at least 30 different RNA transcripts (e.g., 30 different RNA transcripts) selected from Table 5, compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as ECACC deposit number 22072103; and / or

[0134] (b) having reduced levels of at least 30 different RNA transcripts (e.g., 30 different RNA transcripts) selected from Table 6 as compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as ECACC deposit number 22072103.

[0135] In another example, the derivative may:

[0136] (a) having increased levels of at least 40 different RNA transcripts (e.g., 40 different RNA transcripts) selected from Table 5, as compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as ECACC deposit number 22072103; and / or

[0137] (b) having reduced levels of at least 40 different RNA transcripts (e.g., 40 different RNA transcripts) selected from Table 6 as compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as ECACC deposit number 22072103.

[0138] In another example, the derivative may:

[0139] (a) having increased levels of at least 50 different RNA transcripts (e.g., 50 different RNA transcripts) selected from Table 5, compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as ECACC deposit number 22072103; and / or

[0140] (b) having reduced levels of at least 50 different RNA transcripts (e.g., 50 different RNA transcripts) selected from Table 6 as compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as ECACC deposit number 22072103.

[0141] Those skilled in the art can use conventional methods known in the art (such as qPCR) to easily measure the level (such as amount) of rna transcript in the cell.In addition, for example, using conventional methods known in the art, those skilled in the art can easily determine whether derivative has the specific rna transcript (such as being selected from table 5) of increase level compared with the level of same rna transcript in mesenchymal stem cell (MSC) sample cell preserved with ECACC deposit number 22072103 and / or whether has the specific rna transcript (such as being selected from table 6) of reduction level compared with the level of same rna transcript in mesenchymal stem cell (MSC) sample cell preserved with ECACC deposit number 22072103.For example, those skilled in the art can adopt the method (such as RNA-seq) described in the following examples part.

[0142] In a non-limiting example, can determine as shown in the Examples section below and compare the level (for example amount) of rna transcript in cell (for example Y201 FGFR3 KO cell) with reference cell (for example Y201WT cell).As described below, can draw a conclusion, when for example with reference cell (, Y201 WT cell), in the RNA-seq data of specific rna transcript in cell (for example Y201 FGFR3 KO cell), at least have>1 log2 times increase and<0.05 adjusted p value time, the level of specific rna transcript increases.In some examples, in two kinds of cell lines (for example Y201 FGFR3 KO cell and Y201 WT cell), the rna transcript of<5FPKM reading number (reads) is excluded from analysis, and is not accredited as raise or lower.For example, referring to the analysis carried out about the data in table 5 in the Examples section below.

[0143] In a non-limiting example, the level (e.g., amount) of rna transcripts in cells (e.g., Y201 FGFR3 KO cells) can be determined as shown in the Examples section below compared with reference cells (e.g., Y201 WT cells). As described below, when compared with reference cells (e.g., Y201 WT cells), in the RNA-seq data of specific rna transcripts in cells (e.g., Y201 FGFR3 KO cells), at least there are <-1 log2 times to reduce and <0.05 adjusted p-value, it can be concluded that the level of specific rna transcripts is reduced. In some examples, in two cell lines (e.g., Y201 FGFR3 KO cells and Y201 WT cells), there is <5 FPKM reading number of rna transcripts excluded from analysis, and is not accredited as raise or lower. For example, referring to the analysis carried out about the data in Table 6 in the Examples section below.

[0144] The terms "increased," "increase" or "up-regulated," "higher" used herein generally represent the increase of statistically significant amounts. For the avoidance of any doubt, the terms "increased" or "increase" refer to an increase compared to a reference level / control (e.g., the RNA transcript level in mesenchymal stem cell (MSC) sample cells deposited with ECACC deposit number 22072103). For the avoidance of any doubt, in the context of the present invention, the level of an RNA transcript (e.g., an RNA transcript selected from Table 5 being compared) may be increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190%, at least 200%, at least 210%, at least 220%, at least 230%, at least 240%, or at least 250% compared to the level of the same RNA transcript in the mesenchymal stem cell (MSC)-like cells deposited under ECACC deposit number 22072103. For example, the level of an RNA transcript (e.g., an RNA transcript selected from Table 5 being compared) can be increased by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240% or 250% compared to the level of the same RNA transcript in the mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103. For example, the level of an RNA transcript (e.g., an RNA transcript selected from Table 5, compared) can be increased by at least about 0.5-fold, or at least about 1.0-fold, or at least about 1.2-fold, or at least about 1.5-fold, or at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 10-fold, or any increase between 1.0-fold and 10-fold or more, compared to the level of the same RNA transcript in the mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103.

[0145] As used herein, the term "reduce", "reduce", "reduce", "reduce" or "down-regulated", "lower" generally refers to the reduction of statistically significant amount. However, for the avoidance of doubt, "reduce", "reduce", "reduce" or "reduction" refer to the reduction compared to a reference level / control (for example, the level of identical RNA transcript in mesenchymal stem cell (MSC) sample cells deposited with ECACC deposit number 22072103). For the avoidance of any doubt, in the context of the present invention, the level of an RNA transcript (e.g., an RNA transcript selected from Table 5 being compared) may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190%, at least 200%, at least 210%, at least 220%, at least 230%, at least 240% or at least 250% compared to the level of the same RNA transcript in mesenchymal stem cell (MSC)-like cells deposited under ECACC deposit number 22072103. In some examples, the level of an RNA transcript (e.g., an RNA transcript selected from Table 5 being compared) can be reduced by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, or 250% compared to the level of the same RNA transcript in mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103. For example, the level of an RNA transcript (e.g., an RNA transcript selected from Table 6 being compared) can be reduced by at least about 0.5-fold, or at least about 1.0-fold, or at least about 1.2-fold, or at least about 1.5-fold, or at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 10-fold increase, or any increase between 1.0-fold and 10-fold or more, compared to the level of the same RNA transcript in the mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103.

[0146] As used herein, the term "RNA transcript" is used in its conventional sense to refer to a single-stranded ribonucleic acid (RNA) synthesized by transcription from DNA. RNA transcripts include mature RNA products, such as mRNA, tRNA, and rRNA, as well as precursor RNAs, such as precursor mRNA (pre-mRNA), which are processed to become messenger RNA (mRNA).

[0147] As described above, the inventors used CRISPR / Cas9 to transform Y201 cells to target the deletion of the FGFR3 gene. Therefore, this article also provides a mesenchymal stem cell (MSC)-like cell or a derivative thereof deposited with ECACC deposit number 22072101. For the avoidance of doubt, the definition of "derivative" provided above also applies here.

[0148] Mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101 may be referred to herein as "Y201 FGFR3 KO cells" and / or "FGFR3 KO MSCs." FGFR3 KO MSCs (deposited with ECACC deposit number 22072101) were deposited on July 21, 2022, at the Health and Safety Executive, Porton Down, UK, and at the European Collection of Animal Cells, Porton Down, SP4 0JG, Salisbury, UK, in accordance with the Budapest Treaty of 1977.

[0149] The inventors have unexpectedly demonstrated that the cells provided herein have tissue-forming and anti-inflammatory properties. Thus, these cells can be used, for example, in therapeutic settings.

[0150] Thus, also provided is a cell population comprising a plurality of cells as provided herein.

[0151] As used herein, a "cell population" refers to a plurality of cells (i.e., 2 or more cells). Thus, it will be clear to those skilled in the art that, in the context of the present invention, "plurality" refers to "2 or more" (e.g., 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 20 or more, 40 or more, 60 or more, 80 or more, 100 or more, etc.).

[0152] The cell populations provided herein can be genetically homogeneous (i.e., have essentially the same genotype) or genetically heterogeneous (i.e., have genetic differences, which can be natural genetic variation or artificial mutations, such as those caused by mutagenesis and gene editing techniques).

[0153] It will be clear to those skilled in the art that the cell population may comprise any cell described herein (e.g., mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101 and / or derivatives thereof).

[0154] In some examples, the cell population provided herein can include a plurality of mesenchymal stem cell (MSC)-like cells deposited under ECACC deposit number 22072103.

[0155] In some examples, cell mass provided herein can include derivatives of multiple mesenchymal stem cells (MSC) sample cells deposited with ECACC deposit number 22072103. For example, the cell mass can include derivatives (for example, derivatives of mesenchymal stem cells (MSC) sample cells deposited with ECACC deposit number 22072103), and these derivatives are compared with the MSC sample cells deposited with ECACC deposit number 22072103, and the FGFR3 expression and / or activity with reduction are expressed. For example, the cell mass can include derivatives (for example, derivatives of mesenchymal stem cells (MSC) sample cells deposited with ECACC deposit number 22072103), and the difference between these derivatives and the MSC sample cells deposited with ECACC deposit number 22072103 is only in that the FGFR3 expression and / or activity with reduction is expressed.

[0156] In some examples, the cell population provided herein may comprise a plurality of cells, wherein the plurality of cells are composed of the following (a) and (b): (a) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC Deposit Number 22072103, and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited with ECACC Deposit Number 22072103 (e.g., wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cell deposited with ECACC Deposit Number 22072103, or wherein the derivative differs from the MSC-like cell deposited with ECACC Deposit Number 22072103 only in having reduced FGFR3 expression and / or activity).

[0157] In another example, the cell population provided herein can include a plurality of mesenchymal stem cell (MSC)-like cells deposited under ECACC deposit number 22072101.

[0158] In another example, the cell population provided herein can include a plurality of derivatives of mesenchymal stem cell (MSC)-like cells deposited under ECACC deposit number 22072101.

[0159] In another example, the cell population provided herein may comprise a plurality of cells, wherein the plurality of cells are composed of the following (a) and (b): (a) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072101, and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072101.

[0160] In some examples, the cell population provided herein may comprise a plurality of cells, wherein the plurality of cells consists of the following (a) and (b): (a) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072103, and (b) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072101.

[0161] Thus, the cell populations described herein can be mixed populations comprising at least two genetically distinct cell subpopulations described herein. The mixed populations can comprise any combination of two or more cell types described in detail elsewhere herein.

[0162] Those skilled in the art know how to produce a cell population (eg, a mixed cell population) as described herein, for example, using conventional cell culture techniques. Cell culture is described in detail elsewhere herein.

[0163] Cell described herein (for example, mesenchymal stem cell (MSC) sample cells deposited with ECACC deposit number 22072103, its derivative, mesenchymal stem cell (MSC) sample cells deposited with ECACC deposit number 22072101 and / or its derivative) can be used for obtaining genomic DNA preparations by DNA extraction methods. Therefore, the present invention further provides a DNA preparation comprising (for example, extracted from) the genomic DNA of any cell described herein.

[0164] It will be clear to those skilled in the art that any of the cells described herein can be subjected to genomic DNA extraction, for example, by DNA extraction methods well known in the art, such as using organic extraction, silica spin columns, and magnetic beads. Thus, the present invention further provides a DNA preparation comprising genomic DNA extracted from any of the cells described herein.

[0165] In some examples, the DNA preparation provided herein comprises the genomic DNA of a mesenchymal stem cell (MSC) sample cell deposited with ECACC deposit number 22072103. In another example, the DNA preparation provided herein comprises the genomic DNA of a derivative of a mesenchymal stem cell (MSC) sample cell deposited with ECACC deposit number 22072103 (for example, wherein the derivative is compared with the MSC sample cell deposited with ECACC deposit number 22072103 to have a FGFR3 expression and / or activity of reduction, or wherein the derivative is only distinguished from the MSC sample cell deposited with ECACC deposit number 22072103 in that the FGFR3 expression and / or activity of reduction is present).

[0166] In another example, the DNA preparations provided herein include the genomic DNA of mesenchymal stem cells (MSC)-like cells deposited with ECACC deposit number 22072101. In another example, the DNA preparations provided herein include the genomic DNA of a derivative of mesenchymal stem cells (MSC)-like cells deposited with ECACC deposit number 22072101.

[0167] As used herein, a "DNA preparation" refers to a sample comprising genomic DNA obtained or produced from a cell described herein, typically wherein the genomic DNA is mixed with a DNA-compatible buffer. Suitable buffers are well known in the art, such as buffers having a pH of about 7.5 to 8.0, such as Tris-EDTA (TE) buffer. As used herein, "genomic DNA (gDNA)" refers to chromosomal DNA (e.g., chromosomal DNA of a cell described herein).

[0168] As exemplified herein, the inventors have demonstrated that cell-free conditioned medium, secretomes, and / or EVs obtained from cultures of Y201 cells or Y201 FGFR3 KO cells have beneficial therapeutic effects. Thus, provided is a cell-free conditioned medium obtainable by cell culture of the cells described herein or the cell populations described herein.

[0169] For example, provided herein is a cell-free conditioned medium that can be obtained by culturing mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103.

[0170] For example, the present invention also provides a cell-free conditioned medium, which can be obtained by culturing a cell population comprising a plurality of mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103.

[0171] Also provided herein is a cell-free conditioned medium obtainable by culturing a derivative of the mesenchymal stem cell (MSC)-like cells deposited as ECACC Accession No. 22072103 (e.g., a derivative of the mesenchymal stem cell (MSC)-like cells deposited as ECACC Accession No. 22072103 having reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited as ECACC Accession No. 22072103, and / or a derivative of the mesenchymal stem cell (MSC)-like cells deposited as ECACC Accession No. 22072103 the only difference from the MSC-like cells deposited as ECACC Accession No. 22072103 being that the derivative has reduced FGFR3 expression and / or activity).

[0172] For example, a cell-free conditioned medium is also provided, which can be obtained by cell culture of a cell mass, the cell mass comprising a plurality of derivatives of mesenchymal stem cells (MSC) sample cells deposited with ECACC deposit number 22072103. The cell mass can include derivatives (e.g., derivatives of mesenchymal stem cells (MSC) sample cells deposited with ECACC deposit number 22072103), which have reduced FGFR3 expression and / or activity compared to the MSC sample cells deposited with ECACC deposit number 22072103. For example, the cell mass can include derivatives (e.g., derivatives of mesenchymal stem cells (MSC) sample cells deposited with ECACC deposit number 22072103), wherein the derivative differs from the MSC sample cells deposited with ECACC deposit number 22072103 in that the FGFR3 expression and / or activity is reduced.

[0173] In another example, a cell-free conditioned medium is provided, which can be obtained by cell culturing a cell population containing multiple cells, wherein the multiple cells are composed of the following (a) and (b): (a) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC Deposit Number 22072103, and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited with ECACC Deposit Number 22072103 (for example, wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cell deposited with ECACC Deposit Number 22072103, and / or wherein the derivative differs from the MSC-like cell deposited with ECACC Deposit Number 22072103 only in having reduced FGFR3 expression and / or activity).

[0174] In another example, a cell-free conditioned medium is provided, which can be obtained by culturing mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101.

[0175] In another example, a cell-free conditioned medium is provided, which can be obtained by culturing a cell population, wherein the cell population contains a plurality of mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101.

[0176] For example, a cell-free conditioned medium is also provided, which can be obtained by culturing a derivative of mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101.

[0177] For example, a cell-free conditioned medium is also provided, which can be obtained by culturing a cell population comprising a plurality of derivatives of mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101.

[0178] In another example, a cell-free conditioned medium is also provided, which can be obtained by cell culture of a cell population comprising multiple cells, wherein the multiple cells are composed of the following (a) and (b): (a) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072101, and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072101.

[0179] In some examples, a cell-free conditioned medium is also provided, which can be obtained by cell culture of a cell population comprising multiple cells, wherein the multiple cells are composed of the following (a) and (b): (a) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072103, and (b) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072101.

[0180] The synonymous terms "cell-free" and "cell-free" are generally well known in the art and, in the context of this article, may particularly indicate that a composition (e.g., a conditioned medium or composition as described herein) is substantially free of cells (e.g., mesenchymal stem cells (MSC)-like cells deposited with ECACC deposit number 22072103, derivatives thereof, mesenchymal stem cells (MSC)-like cells deposited with ECACC deposit number 22072101, and / or derivatives thereof). In particular, "cell-free" and "cell-free" in the context of this article may particularly indicate that a composition (e.g., a conditioned medium or composition as described herein) is substantially free of living cells (e.g., living mesenchymal stem cells (MSC)-like cells deposited with ECACC deposit number 22072103, living derivatives thereof, living mesenchymal stem cells (MSC)-like cells deposited with ECACC deposit number 22072101, and / or living derivatives thereof). The degree to which a composition (including conditioned medium) is free of cells is often determined in large part by the effectiveness of available methods for separating cells from the culture medium, such as centrifugation or filtration, or repetitions and / or combinations of such methods. For practical purposes, when a composition (including conditioned medium) contains 5 x 10 210 or less cells / ml, 100 or less cells / ml, 50 or less cells / ml, 25 or less cells / ml, 10 or less cells / ml, or 5 or less cells / ml, or no (i.e., 0) cells / ml, it can be considered to be cell-free; preferably, these counts represent viable cells. Conventional cell counting methods can be used to determine the number of cells present in a composition (e.g., conditioned medium), such as light microscopy, or flow cytometry, or inoculation and colony forming unit (CFU) determination. Methods for determining cell viability are well known to those skilled in the art, for example, conventional cell viability assays can be used, such as dye (e.g., trypan blue or propidium iodide) exclusion assays.

[0181] The cell-free conditioned medium provided herein can be obtained by the cell culture of cell described herein or the cell culture of cell mass described herein.As used herein, terms "cultivate" and "cell culture" are common in the art and are used interchangeably in this article.As used herein, terms "cultivate" and "cell culture" refer to that cell (such as a cell) (such as mesenchymal stem cell (MSC) sample cells, its derivative, mesenchymal stem cell (MSC) sample cells and / or its derivatives preserved with ECACC deposit number 22072103) are maintained and / or the process of growth (such as division) under controlled conditions, preferably in vitro or in vitro.

[0182] Cell culture generally requires cell culture medium.Term used herein " culture medium (medium)" (or " culture medium (media)") broadly encompasses and helps cell (for example, with mesenchymal stem cell (MSC) sample cell preserved by ECACC deposit number 22072103, its derivative, with mesenchymal stem cell (MSC) sample cell preserved by ECACC deposit number 22072101 and / or its derivative, as described herein) maintenance and / or any cell culture medium of propagation.Usually, culture medium can be liquid culture medium, and this is convenient to its simple operation (for example decant, pipetting, centrifugal, filtration etc.).Term used herein " culture medium (medium)", " culture medium (culture medium)", " culture medium (culture media)" and " culture medium (media)" are used interchangeably.

[0183] Those skilled in the art will understand various cell culture media, and they will also understand that the type of cell to be cultivated may determine the type of culture medium to be used.Preferably, cell described herein is cultivated in the defined culture medium (defined culture media with clear components, defined culture media) containing the minimum essential element necessary for maintaining the cell, wherein the component of culture medium is known and controlled. This type of minimum essential element (and corresponding defined culture medium) for MSC cultivation (and therefore cell provided herein) is known in the art. For example, the culture conditions used herein (for example, for Y201 cell and / or Y201 FGFR3 KO cell) can be included in 5% CO at 37 degrees Celsius Middle culturing cells. The following examples partly provide the example of the suitable cell culture medium used according to the present invention. For example, the presence or absence of serum-free culture medium and / or specific nutrients may be useful (for example, to keep conditioned culture medium as described herein substantially free of pollutants) when producing the cell-conditioned culture medium as described elsewhere herein.

[0184] Typically, culture medium will comprise basal culture medium formula as known in the art.Many basal culture medium formulas (can be obtained from, for example, the Invitrogen of American Type Culture Collection ATCC or Carlsbad, California) can be used to cultivate cell as herein described, include but not limited to Eagle minimum essential medium (MEM), Dulbecco's modified Eagle culture medium (DMEM), α-modified minimum essential medium (α-MEM), basic essential medium (BME), Iscove's modified Dulbecco's culture medium (IMDM), BGJb culture medium, F-12 nutrient mixture (Ham), Leibovitz L-15, DMEM / F-12, necessary modified Eagle culture medium (EMEM), RPMI-1640, culture medium 199, Waymouth MB 752 / 1 or Williams culture medium E and its modified version and / or combination.The composition of above-mentioned basal culture medium is well known in the art, and those skilled in the art can modify or regulate the concentration of culture medium and / or culture medium supplement according to the needs of cultured cells. A particularly preferred basal medium for culturing the cells described herein (e.g., mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103, their derivatives, mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101 and / or their derivatives) can be DMEM.

[0185] Such basal medium formulations contain the necessary ingredients for the maintenance and / or proliferation of mammalian cells, which are known per se. By way of example and not limitation, these ingredients may include inorganic salts (particularly salts containing Na, K, Mg, Ca, Cl, P and possibly Cu, Fe, Se and Zn), physiological buffers (e.g., HEPES, bicarbonate), nucleotides, nucleosides and / or nucleic acid bases, ribose, deoxyribose, amino acids, vitamins, antioxidants (e.g., glutathione), and carbon sources (e.g., glucose, sodium pyruvate, sodium acetate), and the like.

[0186] For use in culture, the basal medium may be provided with one or more further components. For example, in some cases, additional supplements may be used to provide the cells with the necessary trace elements and substances for optimal maintenance, growth, and / or expansion. In addition, an antioxidant supplement such as β-mercaptoethanol or N-acetyl-L-cysteine may be added at an appropriate concentration. Although many basal media already contain amino acids, some amino acids may be supplemented later, such as L-glutamine, which is known to be less stable in solution. In a further example, the culture medium may be further provided with antibiotic and / or antifungal compounds, for example, typically a mixture of penicillin and streptomycin, and / or other compounds, including but not limited to amphotericin, ampicillin, gentamicin, bleomycin, hygromycin, kanamycin, mitomycin, mycophenolic acid, nalidixic acid, neomycin, nystatin, paromomycin, polymyxin, puromycin, rifampicin, spectinomycin, tetracycline, tylosin, and zeocin.

[0187] In some cases, the culture medium is supplemented with penicillin / streptomycin (P / S).

[0188] Lipids and lipid carriers can also be used to supplement cell culture media. Such lipids and carriers can include, but are not limited to, cyclodextrins, cholesterol, linoleic acid conjugated to albumin, linoleic acid and oleic acid conjugated to albumin, unconjugated linoleic acid, linoleic acid-oleic acid-arachidonic acid conjugated to albumin, unconjugated and albumin-conjugated oleic acid, and the like. Albumin can similarly be used in fatty acid-free formulations.

[0189] In some examples, the cell culture medium can be supplemented with mammalian plasma or serum. Plasma or serum typically contains cytokines and components that promote cell viability and amplification. Alternatively, the plasma or serum can be heat-inactivated. Heat inactivation is mainly used in this area to remove complement. Heat inactivation typically involves incubating the plasma or serum at 56°C for 30 to 60 minutes (e.g., 30 minutes) and performing stable mixing, and then allowing the plasma or serum to gradually cool to ambient temperature. Those skilled in the art will understand any common modifications and requirements of the above procedures. Alternatively, the plasma or serum can be sterilized before storage or use. Common sterilization methods can include, for example, filtration through one or more filters having a pore size of less than 1 μm, preferably less than 0.5 μm, for example, less than 0.45 μm, 0.40 μm, 0.35 μm, 0.30 μm, or 0.25 μm, more preferably 0.2 μm or less, for example, 0.15 μm or less, 0.10 μm or less. Serum or plasma suitable for use in the culture media taught herein can include human serum or plasma, or serum or plasma from non-human animals, for example, non-human mammals, such as non-human primates (e.g., lemurs, monkeys, apes), fetal or adult bovine, horse, porcine, lamb, goat, dog, rabbit, mouse, or rat serum or plasma, or any combination thereof.

[0190] The culture medium taught herein may preferably comprise bovine serum or plasma, preferably fetal calf (calf) serum or plasma, more preferably fetal calf (calf) serum (FCS or FBS).

[0191] In some examples, the culture medium is supplemented with FBS and penicillin / streptomycin (P / S).

[0192] In some examples, serum or plasma can be replaced by serum substitutes (e.g., during cell culture), for example, to provide serum-free culture medium (i.e., culture medium with chemical composition determination). Therefore, serum-free culture medium can be used to culture cells described herein. Providing serum-free culture medium may be particularly beneficial for administering culture medium to a subject, especially a human subject (e.g., to improve biosafety). " Serum substitutes " used herein broadly refer to any composition that can be used to replace the animal serum in a cell culture medium. For example, serum substitutes can replace the function (e.g., cell maintenance and growth support function) of animal serum in a cell culture medium. Conventional serum substitutes can generally include vitamins, albumin, lipids, amino acids, transferrin, antioxidants, insulin, and trace elements. Many commercial serum substitute additives, such as knockout serum substitutes (KOSR, KnockOut Serum Replacement), N2, B27, insulin-transferrin-selenium supplements (ITS) and G5 are all well-known, and those skilled in the art can easily obtain. For example, DMEM (e.g., DMEM supplemented with P / S) can be used.

[0193] Plasma or serum or serum substitute can be included in the culture medium taught herein in any suitable ratio (volume of plasma or serum or serum substitute / volume of culture medium). For example, between about 0.5% v / v and about 70.0% v / v, preferably between about 10.0% v / v and about 60.0% v / v, for example, between about 10.0% v / v and about 55.0% v / v. For example, plasma or serum or serum substitute can be included in the culture medium taught herein at about 0.5% v / v to about 10% v / v. For example, plasma or serum or serum substitute can be included in the culture medium taught herein at about 10.0% v / v.

[0194] In some examples, the culture medium (e.g., conditioned medium, described in more detail below) can lack any serum or plasma, i.e., the culture medium (e.g., conditioned medium) can be a serum-free medium (e.g., serum-free conditioned medium). Providing these culture media can improve the biosafety and / or immunological properties of the culture medium (e.g., conditioned medium).

[0195] As an example, the culture medium for culturing the cells described herein can comprise Dulbecco's modified Eagle's medium (DMEM) (Cat. No. 41966, ThermoFisher Scientific) supplemented with 20% fetal bovine serum (FBS) and 1% penicillin / streptomycin (P / S) (Cat. No. 15140122, ThermoFisher Scientific). In some examples, the culture medium for culturing the cells described herein can comprise Dulbecco's modified Eagle's medium (DMEM) (Cat. No. 41966, ThermoFisher Scientific) supplemented with 20% fetal bovine serum (FBS) and 1% penicillin / streptomycin (P / S) (Cat. No. 15140122, ThermoFisher Scientific), wherein the culture medium has been centrifuged (e.g., at 10,000 g for 18 hours at 4° C.) to deplete serum-derived bovine EVs in the culture medium. In some examples, during cell expansion, the culture medium can be diluted with an equal volume of DMEM supplemented with 1% P / S.

[0196] A particularly preferred culture medium (especially a culture medium for culturing Y201 WT cells) may be a serum-free culture medium.

[0197] A particularly preferred culture medium, particularly for culturing Y201 FGFR3 KO cells, may comprise DMEM.

[0198] The term "conditioned medium" as used herein refers to a medium that has been exposed to (e.g., contacted with) at least one (at least one) cell for a sufficiently long time such that the medium is included in at least one additional component that was not present in the medium before the medium was exposed to the cells, wherein the at least one additional component is a cell product / metabolite. In other words, "conditioned medium" can be considered to be a medium comprising cell secretory products (e.g., especially cell secretory proteins and cell metabolites). The at least one cell can be grown in culture (i.e., in an appropriate culture medium) for a sufficiently long time such that the conditioned medium is included in at least one additional component that was not present in the medium before the medium was exposed to the cells, wherein the at least one additional component is a cell product / metabolite. Conditioned medium may be referred to as "CM" herein.

[0199] The time period for exposing the culture medium to (e.g., contacting) at least one cell to contain at least one additional component that was not present in the culture medium prior to exposing the culture medium to the cell (wherein the at least one additional component is produced by the cell) can specifically be a time period sufficient for at least one cell to achieve secretion of secretory products (including, for example, secreted proteins and extracellular vesicles) into the culture medium. For example, the time period can be at least about 1 hour, at least about 3 hours, at least about 6 hours, at least about 12 hours, at least about 18 hours, at least about 24 hours, at least about 36 hours, or at least about 48 hours. Typically, the time period will not exceed about 72 hours, more typically not exceed about 60 hours, and even more typically not exceed about 48 hours.

[0200] In some examples, the period of time for which the culture medium is exposed to (e.g., contacted with) at least one cell to comprise at least one additional component that was not present in the culture medium prior to exposing the culture medium to the cell (wherein the at least one additional component is produced by the cell) can be at least 24 hours. Thus, in some examples, the period of time for which the culture medium is exposed to (e.g., contacted with) at least one cell to comprise at least one additional component that was not present in the culture medium prior to exposing the culture medium to the cell (wherein the at least one additional component is produced by the cell) can be about 24 hours.

[0201] In some examples, the period of time during which the culture medium is exposed to (e.g., contacted with) at least one cell to comprise at least one additional component that was not present in the culture medium prior to exposure of the culture medium to the cell (wherein the at least one additional component is produced by the cell) can be at least 48 hours. Thus, in some examples, the period of time during which the culture medium is exposed to (e.g., contacted with) at least one cell to comprise at least one additional component that was not present in the culture medium prior to exposure of the culture medium to the cell (wherein the at least one additional component is produced by the cell) can be about 48 hours.

[0202] Therefore, by cultivating the cell that this paper provides or the cell mass that this paper provides in cell culture medium, thus conditioning (conditioning, regulation, modulation, condition) described culture medium, can obtain or directly obtain conditioned medium.Can obtain acellular conditioned medium by separating culture medium from described cell or cell mass, thus obtain the acellular conditioned medium as described in other places herein.Term " acellular " is defined above, and is equally applicable at this.Therefore, it will be clear to those skilled in the art that " acellular conditioned medium " is the conditioned medium (wherein conditioned medium is conditioned medium as defined herein) that does not contain cell (for example, mesenchymal stem cell (MSC) sample cell, its derivative, mesenchymal stem cell (MSC) sample cell and / or its derivative preserved with ECACC preservation number 22072103) substantially.

[0203] Typically, under conditions known in the art that are conducive to in vitro cell culture, such as a temperature of 37° C., 5% v / v CO 2 and>95% humidity, in a vessel or container (e.g., 96-, 24- or 6-well plate, T-25, T-75, T-150, T-175 or T-225 flask, or a cell factory (cell factory)) that is sufficiently suitable for experimental purposes, animal cells (e.g., mammalian cells, e.g., human cells) are exposed to (i.e., contacted with) a suitable cell culture medium to cultivate the animal cells. In some examples, cells described herein (e.g., mesenchymal stem cells (MSC)-like cells, derivatives thereof, mesenchymal stem cells (MSC)-like cells and / or derivatives thereof deposited with ECACC deposit number 22072103) and / or cell mass are cultured in a T175 flask.

[0204] As for cell culture conditions, those skilled in the art can easily select materials (e.g., plates, flasks, or bioreactors) suitable for cell culture. Other cell culture conditions that can be finely adjusted to obtain a conditioned medium described herein with the desired composition and properties include temperature, cell seeding density, and oxygen tension (oxygen partial pressure).

[0205] When preparing conditioned medium, the cells to be conditioned (conditioning, regulating, conditioning) the medium (e.g., mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101 and / or derivatives thereof) can be contacted with a medium having various initial cell densities. For example, the cells described herein (e.g., mesenchymal stem cell (MSC)-like cells deposited under ECACC deposit number 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited under ECACC deposit number 22072101 and / or derivatives thereof) or cell populations can be contacted with the culture medium at an initial cell confluence of at least about 50%, for example, at least about 55%, at least about 60%, for example, at least about 65%, or at least about 70%, at least about 75%, or at least about 80%, for example, at least about 85%, or at least about 90%, for example, at least about 95%, for example, 96%, 97%, 98%, 99% or even 100% initial cell confluence.

[0206] The term "confluence" refers to the density of cultured cells wherein the cells are in contact with one another and cover substantially all surfaces available for cell proliferation (ie, fully confluent).

[0207] In some examples, cell as described herein (such as mesenchymal stem cell (MSC) sample cell deposited with ECACC deposit number 22072103, its derivative, mesenchymal stem cell (MSC) sample cell deposited with ECACC deposit number 22072101 and / or its derivative) and / or cell mass can be contacted with culture medium with the initial cell confluence of at least about 80%.In another example, cell as described herein (such as mesenchymal stem cell (MSC) sample cell deposited with ECACC deposit number 22072103, its derivative, mesenchymal stem cell (MSC) sample cell deposited with ECACC deposit number 22072101 and / or its derivative) can be contacted with culture medium with the initial cell confluence of at least about 90%.

[0208] For example, the cells described herein (e.g., mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101 and / or derivatives thereof) and / or cell populations can be grown at a density of at least about 1000 cells / cm 2 The initial cell density of the growth surface area in contact with the culture medium is, for example, at least about 2000 cells / cm 2 , at least about 10,000 cells / cm 2 , at least about 25,000 cells / cm2 , at least about 50,000 cells / cm 2 Growth surface area, e.g., at least about 75,000 cells / cm 2 , at least about 85,000 cells / cm 2 Initial cell density. For example, the cells described herein can be grown at no more than about 100,000 cells / cm 2 The initial cell density in contact with the culture medium is usually no more than about 95,000 cells / cm 2 , more usually no more than about 90,000 cells / cm 2 Thus, for example, the cells described herein can typically be grown at an initial cell density of about 1000 cells / cm 2 and approximately 100,000 cells / cm 2 The initial cell density in contact with the culture medium is between 2,000 cells / cm 2 and approximately 100,000 cells / cm 2 between, for example, about 80,000 cells / cm 2 .

[0209] When preparing conditioned medium, the medium to be conditioned can be provided in a volume commonly used in tissue culture. Typically, the cells described herein can be conditioned at about 0.10 mL / cm 2 Growth surface area and about 0.20mL / cm 2 The medium contact between the growth surface area is more typically about 0.12 mL / cm 2 and about 0.18 mL / cm 2 between 0.13 mL / cm 2 and about 0.16mL / cm 2 Typically, the cells described herein can be grown with a flow rate of about 0.14 mL / cm 2 Growth surface area in contact with the culture medium.

[0210] A kind of method for producing acellular conditioned medium, can be included in cell culture medium and cultivate cell described herein or cell mass and by the step of culture medium and cell separation.Can be by using the cell culture medium as serum-free medium, by changing the specific conditions of cell culture and / or after cultivating described cell at given time point, cell culture medium and cell separation are carried out the method.In some examples, after being exposed to (for example contacting) cell or cell mass at least about 1 hour, at least about 3 hours, at least about 6 hours, at least about 12 hours, at least about 18 hours, at least about 24 hours, at least about 36 hours or at least about 48 hours, culture medium and cell as herein described (for example, mesenchymal stem cell (MSC) sample cell, its derivative, mesenchymal stem cell (MSC) sample cell and / or its derivative preserved with ECACC deposit number 22072103) or cell mass are separated.Usually, described time period will be no more than about 72 hours, more generally no more than about 60 hours, even more generally no more than about 48 hours. It will be clear to those skilled in the art that the relevant time point may be very short (e.g. 2 hours or less) or longer, such as 24 hours, 36 hours or more hours or intermediate time periods (e.g. 1 hour, 2 hours, 4 hours, 6 hours, 8 hours, 12 hours or 18 hours).

[0211] In some examples, the culture medium is separated from the cells described herein (e.g., mesenchymal stem cell (MSC)-like cells deposited as ECACC Accession No. 22072103, their derivatives, mesenchymal stem cell (MSC)-like cells deposited as ECACC Accession No. 22072101 and / or their derivatives) or cell populations after being exposed to (e.g., contacting) the cells or cell populations described herein for at least about 24 hours.

[0212] In some examples, the culture medium is separated from the cells described herein (e.g., mesenchymal stem cell (MSC)-like cells deposited as ECACC Accession No. 22072103, their derivatives, mesenchymal stem cell (MSC)-like cells deposited as ECACC Accession No. 22072101 and / or their derivatives) or cell populations after exposure to (e.g., contact with) the cells or cell populations described herein for at least about 48 hours.

[0213] In some examples, cell as herein described (for example, mesenchymal stem cell (MSC) sample cell deposited with ECACC deposit number 22072103, its derivative, mesenchymal stem cell (MSC) sample cell deposited with ECACC deposit number 22072101 and / or its derivative) or cell mass can be used for preparing (for example, producing) one or more (for example, two) discrete cell-free conditioned mediums.As discussed above, a method for producing cell-free conditioned medium can be included in cell culture medium, cultivates cell as herein described or cell mass and by the step of culture medium and cell separation.Can be by using the cell culture medium as serum-free medium, by changing the specific conditions of cell culture and / or after given time point cultivating described cell, cell culture medium and cell separation are carried out the method. In some examples, after being exposed to (e.g., contacting) a cell or cell population described herein for at least about 24 hours, the first culture medium can be separated from the cells described herein (e.g., mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101 and / or derivatives thereof) or cell population. Then, the cell culture medium can be replenished, and after further being exposed to (e.g., contacting) the cell or cell population for at least about 24 hours, the second culture medium can be separated from the cells used to prepare the first culture medium (e.g., mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101 and / or derivatives thereof) or cell population. In other words, cells as described herein (such as mesenchymal stem cells (MSC) sample cells deposited with ECACC deposit number 22072103, derivatives thereof, mesenchymal stem cells (MSC) sample cells deposited with ECACC deposit number 22072101 and / or derivatives thereof) or cell mass can be used for preparing the first and second culture media, wherein, after being exposed to (such as contacting) the cells or cell mass for at least about 24 hours, the first culture media can be separated from the cells or cell mass as described herein, and after being further exposed to (such as contacting) the cells or cell mass for at least about 24 hours, the second culture media can be separated from the cells or cell mass as described herein. In some examples, the first culture media and the second culture media can be gathered (such as after the first culture media and the second culture media are separated from the cells or cell colony as described herein).

[0214] In some examples, after being exposed to (e.g., contacting) a cell or cell population described herein for about 24 hours, the first culture medium can be separated from the cells described herein (e.g., mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101 and / or derivatives thereof) or cell population. The cell culture medium can then be replenished, and the second culture medium can be separated from the cells used to prepare the first culture medium (e.g., mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 2072101 and / or derivatives thereof) or cell population after being further exposed to (e.g., contacting) the cell or cell population for about 24 hours.

[0215] Those skilled in the art will appreciate that when cells or cell groups are at any appropriate confluence, culture medium can be separated from cells as described herein (e.g., mesenchymal stem cells (MSC)-like cells, derivatives thereof, mesenchymal stem cells (MSC)-like cells and / or derivatives thereof deposited with ECACC deposit number 22072101) or cell groups (e.g., to obtain cell-free conditioned medium). For example, when the confluence of cells or cell groups is about 80% to about 90%, culture medium can be separated from cells as described herein (e.g., mesenchymal stem cells (MSC)-like cells, derivatives thereof, mesenchymal stem cells (MSC)-like cells and / or derivatives thereof deposited with ECACC deposit number 22072101) or cell groups. In some examples, for Y201 cells, 80% confluence may be equivalent to about 24,000 cells / cm 2 .

[0216] Conditioned medium can be separated from the cell or cell mass for conditioning (conditioning) culture medium by any available technology.Conventional techniques include, for example, removing culture medium from culture vessel by decantation or pipetting, centrifugal culture medium is to make the cell, cell debris and particle pelleting (precipitation, pellet) present therein (for example, at about 100g to about 2,000g, for example, about 200g to about 1,500g, for example, centrifugal about 3 minutes to about 30 minutes at about 300g, for example, about 5 minutes to 20 minutes, for example, about 5 minutes), filter culture medium is to filter out the cell, cell debris and particle present therein (for example, by pore size, be about 1.0 μm or less, about 0.8 μm or less, about 0.6 μm or less, about 0.4 μm or less, for example, about 0.2 μm standard microbial filter filtration). It should be understood that the repetition and / or combination of such methods can be adopted to realize relatively more complete separation.The example of the technology of separating conditioned medium from the cell or cell mass for conditioning culture medium is well known in the art, and specific examples are provided in the following embodiments part.

[0217] In some examples, separation of the conditioned medium from the cells or cell populations described herein can be performed by simply transferring the supernatant of the cell culture vessel or cell population culture vessel (by decantation or pipetting) to a separate container, and optionally, repeated and / or combined filtration (e.g., filtration through a standard microbial filter having a pore size of about 1.0 μm or less, about 0.8 μm or less, about 0.6 μm or less, about 0.4 μm or less, such as about 0.2 μm) or centrifugation of the cell culture supernatant at low speed (e.g., at about 100 g to about 2000 g, such as about 200 g to about 1500 g, such as about 300 g for about 3 minutes to about 30 minutes, such as about 5 minutes to 20 minutes, such as about 5 minutes) to pellet any remaining cells, cell debris, or particles. In this way, a cell-free preparation is obtained (supernatant of centrifugation), which can then be used to determine the identity and concentration of the biomolecules present (soluble proteins or extracellular vesicles as defined below) and is performed according to commonly used techniques such as immunoassays, spectroscopic methods (e.g. LC-MS) or enzymatic assays.

[0218] In a specific example, the supernatant of the cell culture vessel or cell population culture vessel can be transferred (by decantation or pipetting) to a separate container and, optionally, centrifuged at low speed (e.g., at 300 g for about 5 minutes) to pellet any remaining cells, cell debris, or particles, thereby separating the conditioned medium from the cells or cell populations described herein. The supernatant obtained after centrifugation may be referred to herein as cell-free conditioned medium.

[0219] In a specific example, the conditioned medium can be separated from the cells or cell populations described herein by centrifuging the cell culture or cell population culture at low speed (e.g., at 300 g for about 5 minutes) to pellet any remaining cells, cell debris, or particles. The supernatant obtained after centrifugation can be referred to herein as cell-free conditioned medium.

[0220] Conditioned medium described herein can comprise any component secreted by the cell or cell group used to condition the medium. Typically, the conditioned medium described herein comprises soluble proteins and extracellular vesicles secreted by the cell or cell group used to condition the medium.

[0221] In a particular example, conditioned medium described herein can include the secretome (or the secretome of cell mass) of the cell for conditioned medium. Therefore, a secretome or its part is provided, which can be obtained by cell culture of cell as described herein (such as mesenchymal stem cell (MSC) sample cell, its derivative, mesenchymal stem cell (MSC) sample cell and / or its derivative deposited with ECACC deposit number 22072103) or cell mass as described herein.

[0222] As used herein, " secretome " refers to all (or collection) components that are secreted or released into the cell or cell group surrounding environment (e.g., culture medium) when culturing cells or cell groups. The components of the secretome can be organic and / or inorganic. Typically, the components of the secretome include proteins and extracellular vesicles (EVs) (including exosomes and microvesicles). Therefore, typically, the secretome described herein comprises soluble proteins and EVs secreted by cells or cell groups for conditioning (regulating) culture medium. The components of the secretome can also include lipids, cytokines (cellular messengers), hormone-like substances, and so-called immunomodulatory substances. ECM components are also typically components of the secretome, and therefore, as will be clear to those skilled in the art, ECM components are typically present in conditioned culture medium.

[0223] Provided herein is a secretome or a portion thereof, which can be obtained by culturing mesenchymal stem cell (MSC)-like cells deposited with ECACC accession number 22072103.

[0224] Also provided herein is a secretome or a portion thereof, which can be obtained by culturing a cell population comprising a plurality of mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103.

[0225] Also provided herein is a secretome or a portion thereof, which can be obtained by cell culturing a derivative of the mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103 (e.g., a derivative of the mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103 having reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited with ECACC deposit number 22072103, or a derivative of the mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103 that differs only in having reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited with ECACC deposit number 22072103).

[0226] Also provided is a secretome or portion thereof, which can be obtained by cell culture of a cell population comprising a plurality of derivatives of mesenchymal stem cells (MSC)-like cells deposited with ECACC deposit number 22072103. The cell population may comprise a derivative (e.g., a derivative of mesenchymal stem cells (MSC)-like cells deposited with ECACC deposit number 22072103) having reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited with ECACC deposit number 22072103. For example, the cell population may comprise a derivative (e.g., a derivative of mesenchymal stem cells (MSC)-like cells deposited with ECACC deposit number 22072103) wherein the derivative differs from the MSC-like cells deposited with ECACC deposit number 22072103 only in having reduced FGFR3 expression and / or activity.

[0227] In one example, a secretome or a portion thereof is provided, which can be obtained by cell culture of a cell population comprising a plurality of cells, wherein the plurality of cells are composed of the following (a) and (b): (a) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072103, and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072103 (for example, wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cell deposited with ECACC deposit number 22072103, and / or wherein the derivative differs from the MSC-like cell deposited with ECACC deposit number 22072103 only in having reduced FGFR3 expression and / or activity).

[0228] Also provided is a secretome or a portion thereof, which can be obtained by culturing mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101.

[0229] Also provided is a secretome or a portion thereof, which can be obtained by culturing a cell population comprising a plurality of mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101.

[0230] Also provided is a secretome or a portion thereof, which can be obtained by culturing a derivative of a mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072101.

[0231] For example, a secretome or a portion thereof is also provided, which can be obtained by culturing a cell population comprising a plurality of derivatives of mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101.

[0232] In another example, a secretome or a portion thereof is also provided, which can be obtained by cell culture of a cell population comprising a plurality of cells, wherein the plurality of cells are composed of the following (a) and (b): (a) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072101, and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072101.

[0233] In another example, a secretome or a portion thereof is also provided, which can be obtained by cell culture of a cell population comprising a plurality of cells, wherein the plurality of cells are composed of the following (a) and (b): (a) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072103, and (b) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072101.

[0234] As used herein, a "portion" of a secretome refers to a sample of a secretome, for example, which can be separated from the rest of the secretome. In one example, a portion of a secretome can be a specific fraction of the entire secretome (separated by, for example, the size of the secretome components therein). In other words, the portion can be enriched in certain components of the entire secretome (wherein the portion has a higher proportion of certain components compared to the entire secretome). In this context, the term "fraction" refers to the result of a separation process in which a mixture (e.g., a solid, liquid, solute, or suspension) is divided into (i.e., separated into) two or more smaller amounts ("fractions") in which the composition has changed. Thus, the composition of the fraction has changed compared to the composition of the fractionated mixture, i.e., is different from the composition of the fractionated mixture.

[0235] The secretome or a portion thereof can be obtained using conventional methods known in the art (e.g., from a cell culture medium as described herein). For example, the secretome can be obtained from a conditioned culture medium as described herein using methods such as centrifugation, filtration, or dialysis.

[0236] In some examples, the cell-free conditioned medium provided herein can be serum-free.

[0237] As discussed elsewhere herein, the conditioned medium and / or secretome provided herein can include any components secreted by the cells or cell populations used to condition the medium, such as extracellular vesicles (EVs). For certain purposes described herein, it may be advantageous to remove EVs from the conditioned medium and / or secretome described herein.

[0238] Thus, in some instances, the cell-free conditioned medium provided herein can be depleted of extracellular vesicles (EVs).

[0239] Similarly, in some examples, the secretomes or portions thereof provided herein can be depleted of extracellular vesicles (EVs).

[0240] As will be clear to those skilled in the art, the conditioned medium or secretome depleted of extracellular vesicles (EVs) provided herein has a minimum amount of contaminating EVs. In other words, the conditioned medium or secretome depleted of EVs provided herein may be composed primarily of components (e.g., cellular or extracellular proteins, lipids, carbohydrates, lipoproteins, etc.) that are unrelated to EVs. In this context, "minimum amount" may include less than 10% (by concentration) of EV contaminants, less than 5%, less than 2%, less than 1%, less than 0.5%, less than 0.25%, less than 0.1%, etc. (by concentration) of EV contaminants. The contamination level does not need to reach 0%. EM can be used to determine the contamination level.

[0241] Conditioned medium or secretome samples described herein may be substantially free of EVs. In a specific example, the cell-free conditioned medium provided herein may be substantially free of extracellular vesicles (EVs). Similarly, in a specific example, the secretome provided herein or a portion thereof may be substantially free of extracellular vesicles (EVs).

[0242] When referring to a conditioned medium or secretome that is substantially free of EVs, the term "substantially free" means that the percentage of EVs in the conditioned medium or secretome (as the case may be) is significantly lower than the percentage of EVs found in the starting conditioned medium or secretome (e.g., untreated conditioned medium or secretome) from which the conditioned medium or secretome that is substantially free of EVs is generated. Typically, the percentage of EVs in the conditioned medium or secretome that is substantially free of EVs is less than 5%, 4%, 3%, 2% or 1% of the total conditioned medium or secretome, preferably wherein the percentage of EVs in the conditioned medium or secretome that is substantially free of EVs is less than 0.5%, less than 0.25%, less than 0.1%, etc. of the total conditioned medium or secretome. The contamination level does not need to reach 0%.

[0243] EVs can be removed (e.g., extracted) from the conditioned medium or secretome provided herein by conventional methods known in the art (Brennan et al., 2020, A comparison of methods for the isolation and separation of extracellular vesicles from protein and lipid particles in human serum, Sci Rep 10, 1039). In other words, the conditioned medium or secretome provided herein can be depleted of EVs by any suitable method. Examples of suitable methods are described in the Examples section below. Preferably, (differential) ultracentrifugation is used to remove (e.g., extract) EVs from the conditioned medium or secretome described herein. The conditioned medium can be centrifuged at different relative centrifugal forces (ref) to obtain (e.g., remove) EVs of corresponding density. Typically, the vast majority of EVs can be obtained (and therefore removed) by 10,000g and 100,000g centrifugation steps. Preferably, the fractions obtained by 2,000g and 10,000g centrifugation steps are removed from the conditioned medium, and the fractions obtained by centrifugation at 100,000g are then collected (and removed).

[0244] In some examples, tangential flow filtration (TFF) is used to remove (e.g., extract) EVs from the conditioned media or secretome described herein.

[0245] Extracellular vesicles have been well characterized and have a clear meaning in the art (see review by Andaloussi et al., Nature Reviews Drug Discovery, Vol. 12, May 2013, pp. 347-357). As used herein, "extracellular vesicle" refers to any membrane-bound particle secreted from a cell. Extracellular vesicles have been isolated from a variety of body fluids. They have been shown to play a key role in regulating physiological processes, including stem cell maintenance, immune surveillance, and blood coagulation. They have also been shown to play a vital role in the pathology of a variety of diseases.

[0246] Extracellular vesicles are released from cells intact and can shed from multivesicular bodies (MVBs) from endosomes or can bud directly from the plasma membrane. When they are released (e.g., to the cell periphery, such as to the extracellular space), they are called exosomes or ectosomes (or microvesicles), depending on whether they are formed from the inner or outer cell membrane. EVs may be taken up by other cells through endocytosis or fusion.

[0247] Extracellular vesicles can be classified according to their cell origin, biological function or based on their biogenesis (reviewed by Andaloussi et al., 2013). As determined by their biogenesis, the three main categories of extracellular vesicles are exosomes, microvesicles and apoptotic bodies, of which the first two are the most prevalent in biological samples (and in EV samples derived therefrom). EV markers are well known in the art. Examples of exosome markers include tetraspanins (e.g., TSPAN29 and TSPAN30), ESCRT components, PDCD6IP, TSG101 and flotillin. Examples of microvesicle markers include integrins, selectins and CD40 ligands.

[0248] Despite recent advances, the terms “exosomes” and “microvesicles” are used interchangeably in many published studies. In this article, the term “extracellular vesicles” is used to refer to both vesicle types.

[0249] The inventors have also demonstrated that EVs obtained from cell culture of the cells or cell populations described herein have advantageous therapeutic properties.

[0250] Therefore, the present invention also provides an extracellular vesicle (EV) population, which can be obtained by cell culture of the cells provided herein or the cell population provided herein.

[0251] In one example, provided herein is a population of extracellular vesicles (EVs) obtainable by cell culture of mesenchymal stem cell (MSC)-like cells deposited with ECACC accession number 22072103.

[0252] This article also provides an extracellular vesicle (EV) population that can be obtained by cell culture of a cell population, wherein the cell population comprises a plurality of mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103.

[0253] In another example, the present invention also provides a population of extracellular vesicles (EVs), which can be obtained by culturing derivatives of mesenchymal stem cell (MSC)-like cells deposited with ECACC Accession No. 22072103 (e.g., derivatives of mesenchymal stem cell (MSC)-like cells deposited with ECACC Accession No. 22072103 having reduced FGFR3 expression and / or activity compared to MSC-like cells deposited with ECACC Accession No. 22072103, or derivatives of mesenchymal stem cell (MSC)-like cells deposited with ECACC Accession No. 22072103 that differ only in having reduced FGFR3 expression and / or activity compared to MSC-like cells deposited with ECACC Accession No. 22072103).

[0254] Also provided is an extracellular vesicle (EV) population that can be obtained by cell culture of a cell population, the cell population comprising a plurality of derivatives of mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103. The cell population may include a derivative (e.g., a derivative of mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103), the derivative having reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited with ECACC deposit number 22072103. For example, the cell population may include a derivative (e.g., a derivative of mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072103), wherein the derivative differs from the MSC-like cells deposited with ECACC deposit number 22072103 only in having reduced FGFR3 expression and / or activity.

[0255] In one example, a population of extracellular vesicles (EVs) is provided that can be obtained by cell culture of a cell population comprising a plurality of cells, wherein the plurality of cells are composed of the following (a) and (b): (a) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072103, and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072103 (for example, wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cell deposited with ECACC deposit number 22072103, and / or wherein the derivative differs from the MSC-like cell deposited with ECACC deposit number 22072103 only in having reduced FGFR3 expression and / or activity).

[0256] In a further example, a population of extracellular vesicles (EVs) is further provided, which can be obtained by culturing mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101.

[0257] Also provided is an extracellular vesicle (EV) population that can be obtained by cell culture of a cell population, wherein the cell population comprises a plurality of mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101.

[0258] Also provided is an extracellular vesicle (EV) population that can be obtained by culturing a derivative of mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101.

[0259] For example, an extracellular vesicle (EV) population is also provided, which can be obtained by cell culture of a cell population, wherein the cell population comprises a plurality of derivatives of mesenchymal stem cell (MSC)-like cells deposited with ECACC deposit number 22072101.

[0260] In another example, a population of extracellular vesicles (EVs) is also provided, which can be obtained by cell culture of a cell population comprising a plurality of cells, wherein the plurality of cells are composed of the following (a) and (b): (a) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072101, and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072101.

[0261] In another example, a population of extracellular vesicles (EVs) is also provided, which can be obtained by cell culture of a cell population comprising a plurality of cells, wherein the plurality of cells are composed of the following (a) and (b): (a) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072103, and (b) at least one mesenchymal stem cell (MSC)-like cell deposited with ECACC deposit number 22072101.

[0262] As used herein, a "population of extracellular vesicles (EVs)" refers to a plurality of extracellular vesicles (EVs) (i.e., 2 or more EVs, such as 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 20 or more, 40 or more, 60 or more, 80 or more, 100 or more EVs).

[0263] By culturing the cells provided herein or the cell groups provided herein in a cell culture medium, thereby conditioning (adjusting) the culture medium, it is possible to obtain or directly obtain an extracellular vesicle (EV) group as described herein. The conditioned medium provided herein (e.g., acellular conditioned medium) typically comprises extracellular vesicles (EVs) secreted by the cells or cell groups used to condition the culture medium. Therefore, EV groups can be obtained by separating a group (i.e., multiple) of extracellular vesicles from the conditioned medium provided herein (e.g., acellular conditioned medium provided herein), thereby obtaining EV groups. Therefore, the cell culture conditions and parameters provided above in the context of obtaining conditioned culture medium are equally applicable to obtaining EV groups.

[0264] EV populations can be isolated from cells or cell populations used for conditioning medium or conditioned medium that has been separated from such cells (i.e., cell-free conditioned medium provided herein) by one or more appropriate methods known in the art, such as described in the protocol of Thery et al. (See Thery, Clotilde, Sebastian Amigorena, Raposo, and Aled Clayton. 2006. “Isolation and Characterization of Exosomes from Cell Culture Supernatants and Biological Fluids.” Current Protocols in Cell Biology / Editorial Board, Juan S. Bonifacino... [et al.] Chapter 3). Furthermore, suitable methods include differential centrifugation, density gradient ultracentrifugation, and size exclusion chromatography. Differential centrifugation and density gradient ultracentrifugation are the most widely used methods for isolating EVs.

[0265] Differential ultracentrifugation can be used to separate different EV subpopulations based on density. For example, in some examples, EVs can be separated by differential centrifugation of conditioned medium at increasing centrifugation speeds to produce different fractions.

[0266] The following examples provide methods for obtaining EVs, but any suitable alternative method may be used. In one example, EVs can be obtained from serum-free cell-conditioned medium, where EVs are isolated according to the following main principles of the protocol of Thery et al. (see Théry, Clotilde, Sebastian Amigorena, Raposo, and Aled Clayton. 2006. "Isolation and Characterization of Exosomes from Cell Culture Supernatants and Biological Fluids." Current Protocols in Cell Biology / Editorial Board, Juan S. Bonifacino.. [et al.] Chapter 3).

[0267] In some examples, EVs can be obtained by a method in which cells are plated in a T175 flask in medium containing FBS until 80-90% confluence is reached, wherein the EVs within the FBS have been depleted. In this method, the medium is aspirated and the cells are washed with PBS, and then serum-free medium is added. Medium collection is performed and cell counts are performed. EVs are isolated according to the protocol of Thery et al. (as cited above) with slight modifications, wherein all steps are performed at 4°C. The conditioned medium is ultracentrifuged to separate the EV fraction. All EV pellets can be thoroughly washed and resuspended in particle-free PBS, and all centrifugations are performed at 4°C.

[0268] Those skilled in the art can easily obtain EV-depleted FBS. For example, to obtain EV-depleted FBS, FBS can be centrifuged at 100,000 g for 18 hours and the supernatant collected.

[0269] A detailed protocol for isolating EVs is shown in Example 2 provided below, however, as discussed above, any known method suitable for isolating EVs may be used alternatively. In a specific example, the cell-free conditioned medium described elsewhere herein can be centrifuged at 100,000g for 90 minutes at 4 degrees Celsius in a Ty45i rotor compatible ultracentrifuge tube (or equivalent), and the supernatant is then removed. The pellet can then be resuspended using cold-filtered PBS (e.g., 600 μl per ultracentrifuge tube), and the resuspended pellets are then pooled and aliquoted into 1.5 ml micro-ultracentrifuge tubes (or equivalent), with a minimum volume of at least 1 mL per tube. The micro-ultracentrifuge tubes (or equivalent) can then be centrifuged at 100,000g for 90 minutes at 4 degrees Celsius, and the supernatant is then removed. Each pellet can then be resuspended in 50-100 ul HQ-PBS to produce a 100K fraction.

[0270] The EV populations described herein may also be referred to as EV samples that can be obtained by cell culture of a cell or cell population, such as from a conditioned medium as described herein. An EV sample may be a processed sample enriched in EVs (i.e., having a higher concentration of EVs than the concentration of EVs in, for example, the conditioned medium from which it was generated). In the context of this article, "enriched" or "enrichment" refers to a sample or process in which the proportion of EVs is increased relative to other components in the sample. Enrichment can be measured by comparing the number of EVs before and after sample processing, wherein any increase in the relative number of EVs compared to other components of the sample is considered enrichment. Enrichment and / or purity can be measured by comparing the concentration with the conditioned medium from which the EV sample was generated (e.g., an untreated sample), wherein the concentration of EVs is at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more higher than the concentration of EVs in the conditioned medium (e.g., an untreated sample). Enrichment and / or purity can be measured by the number of EVs such that the EVs in the sample are enriched by about or at least about 2x, 3x, 4x, 5x, 10x, 15x, 20x, 25x, 30x, 35x, 40x, 45x, 50x, 55x, 60x, 65x, 70x, 75x, 80x, 85x, 90x, 95x, 100x, 110x, 120x, 130x, 140x, 150x, 160x, 170x, 180x, 190x, 200x, 210x, 220x, 230x, 240x, 250x, 260x, 270x, 280x, 290x, 300x, 310x, 320x, 330x, 340x, 350x, 360x, 370x, 380x, 390x, 400x, 410x, 420x, 430x, 440x 280x, 290x, 300x, 325x, 350x, 375x, 400x, 425x, 450x, 475x, 500x, 525x, 550x, 575x, 600x, 625x, 650x, 675x, 700x, 725x, 750x, 775x, 800x, 825x, 850x, 875x, 900x, 925x, 950x, 975x, 1000x, 1100x, 1200x, 1300x, 1400x, 1500x, 1600x, 1700x, 1800x, 1900x, 2000x (same as -times) - and all ranges derivable therein. Enrichment levels can be determined using EM and tunable resistive pulse sensing (TRPS).

[0271] EV samples (in other words, EV-rich samples) do not need to be 100% pure extracellular vesicles. Preferably, the EV sample has a minimum amount of contaminating cells or extracellular contents (e.g., cells or extracellular proteins, lipids, carbohydrates, lipoproteins, etc. that are not related to EVs). In other words, the EV sample can be mainly composed of EVs. In this context, the "minimum amount" can include less than 10% (by concentration) of pollutants, less than 5%, less than 2%, less than 1%, less than 0.5%, less than 0.25%, less than 0.1%, etc. (by concentration) of pollutants. The contamination level does not need to reach 0%. EM can be used to determine the contamination level.

[0272] The EV sample can be an isolated sample containing substantially pure EVs. The isolated sample can be isolated from any conditioned medium containing EVs. When referring to an isolated sample containing substantially pure EVs, the term "substantially pure" or "substantially pure" refers to a percentage of EVs in the population that is significantly higher than the percentage found in the conditioned medium (e.g., untreated sample) from which the EV sample was generated. Typically, the percentage of EVs in an isolated sample containing substantially pure EVs is at least about 50% of the total sample, preferably at least about 60%, 70%, 75%, and more preferably at least about 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%.

[0273] In some examples, the EV group is a 2K EV fraction, a 10K EV fraction, or a 100K EV fraction. As described in the Examples section below, and as known to those skilled in the art, a 2K EV fraction refers to an EV fraction (or portion) in a secretome or conditioned medium produced when the secretome or conditioned medium is centrifuged (e.g., 20 minutes) at 2,000 g. Similarly, a 10K EV fraction refers to an EV fraction (or portion) in a secretome or conditioned medium produced when the secretome or conditioned medium is centrifuged at 10,000 g (e.g., an EV fraction (or portion) in a secretome or conditioned medium produced when the secretome or conditioned medium is centrifuged at 10,000 g for 45 minutes, e.g., an EV fraction (or portion) in a secretome or conditioned medium produced when the secretome or conditioned medium is centrifuged at 10,000 g for 45 minutes). In addition, 100K EV fraction refers to the EV fraction (or portion) of the secretome or conditioned medium produced when the secretome or conditioned medium is centrifuged at 100,000 g (e.g., the EV fraction (or portion) of the secretome or conditioned medium produced when the secretome or conditioned medium is centrifuged at 100,000 g for 90 minutes, e.g., the EV fraction (or portion) of the secretome or conditioned medium produced when the secretome or conditioned medium is centrifuged at 100,000 g for 90 minutes twice). "Fraction" is defined elsewhere herein and is also applicable to this context. For example, centrifugation can be performed at 4 degrees Celsius.

[0274] As described in the Examples section below, the 100K EV fraction can also be identified by the presence of one or more EV markers selected from the group consisting of Alix, raft protein-1, CD81, and CD63. The 100K EV fraction is also characterized by the absence of the endosomal marker BiP. In other words, the 100K EV fraction can be identified by the presence of one or more positive markers selected from the group consisting of Alix, raft protein-1, CD81, and CD63 and / or the negative marker BiP. In one example, the 100K EV fraction can be identified by the presence of two or more, or three or more positive markers selected from the group consisting of Alix, raft protein-1, CD81, and CD63 and / or the negative marker BiP.

[0275] The inventors performed a full proteomic screen of Y201 conditioned medium and Y201 EVs. Table 2 below provides the top 200 identified proteins in Y201 conditioned medium (i.e., the entire secretome, including EVs). Table 3 below provides the top 200 identified proteins in Y201 EVs. Furthermore, the inventors performed a full microRNA screen of Y201 EVs. Table 4 below provides the identified miRNAs in Y201 EVs.

[0276] In some examples, the cell-free conditioned medium or secretome provided herein, or a fraction thereof (e.g., when obtained by culturing Y201 cells), can comprise at least 10 different proteins selected from Table 2. For example, the cell-free conditioned medium or secretome provided herein, or a fraction thereof, can comprise at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different proteins selected from Table 2. For example, the cell-free conditioned medium or secretome provided herein, or a fraction thereof, can comprise at least 10, at least 20, at least 30, at least 40, or at least 50 different proteins selected from Table 2.

[0277] In some examples, the cell-free conditioned medium or secretome provided herein, or a fraction thereof (e.g., when obtained by culturing Y201 cells), can comprise at least the top 10 different proteins selected from Table 2 (wherein proteins are listed in order of abundance). For example, the cell-free conditioned medium or secretome provided herein, or a fraction thereof, can comprise at least the top 10, at least the top 20, at least the top 30, at least the top 40, or at least the top 50 different proteins selected from Table 2.

[0278] In some examples, the cell-free conditioned medium or secretome provided herein, or a fraction thereof (e.g., when obtained by culturing Y201 cells), can comprise 10 different proteins selected from Table 2. For example, the cell-free conditioned medium or secretome provided herein, or a fraction thereof, can comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 different proteins selected from Table 2. For example, the cell-free conditioned medium or secretome provided herein, or a fraction thereof, can comprise 10, 20, 30, 40, or 50 different proteins selected from Table 2.

[0279] In some examples, the cell-free conditioned medium, secretome, or a portion thereof, or EV population provided herein (e.g., when obtained by culturing Y201 cells) can comprise at least 10 different proteins selected from Table 3. For example, the cell-free conditioned medium, secretome, or a portion thereof, or EV population provided herein can comprise at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different proteins selected from Table 3. For example, the cell-free conditioned medium, secretome, or a portion thereof, or EV population provided herein can comprise at least 10, at least 20, at least 30, at least 40, or at least 50 different proteins selected from Table 3.

[0280] In some examples, the cell-free conditioned medium, secretome, or fractions thereof, or EV populations provided herein (e.g., when obtained by culturing Y201 cells) can comprise at least the top 10 different proteins selected from Table 3 (wherein proteins are listed in order of abundance). For example, the cell-free conditioned medium, secretome, or fractions thereof, or EV populations provided herein can comprise at least the top 10, at least the top 20, at least the top 30, at least the top 40, or at least the top 50 different proteins selected from Table 3.

[0281] In some examples, the cell-free conditioned medium, secretome, or fractions thereof, or EV populations provided herein (e.g., when obtained by culturing Y201 cells) can comprise 10 different proteins selected from Table 3. For example, the cell-free conditioned medium, secretome, or fractions thereof, or EV populations provided herein can comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 different proteins selected from Table 3. For example, the cell-free conditioned medium, secretome, or fractions thereof, or EV populations provided herein can comprise 10, 20, 30, 40, or 50 different proteins selected from Table 3.

[0282] In some examples, the cell-free conditioned medium, secretome, or a portion thereof, or EV population provided herein (e.g., when obtained by culturing Y201 cells) can comprise at least 10 different miRNAs selected from Table 4. For example, the cell-free conditioned medium, secretome, or a portion thereof, or EV population provided herein can comprise at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different miRNAs selected from Table 4. For example, the cell-free conditioned medium, secretome, or a portion thereof, or EV population provided herein can comprise at least 10, at least 20, at least 30, at least 40, or at least 50 different miRNAs selected from Table 4.

[0283] In some examples, the cell-free conditioned medium, secretome, or fractions thereof, or EV populations provided herein (e.g., when obtained by culturing Y201 cells) can comprise at least the top 10 different miRNAs selected from Table 4 (wherein the miRNAs are listed in order of abundance). For example, the cell-free conditioned medium, secretome, or fractions thereof, or EV populations provided herein can comprise at least the top 10, at least the top 20, at least the top 30, at least the top 40, or at least the top 50 different miRNAs selected from Table 4.

[0284] In some examples, the cell-free conditioned medium, secretome, or a portion thereof, or EV population provided herein (e.g., when obtained by culturing Y201 cells) can comprise 10 different miRNAs selected from Table 4. For example, the cell-free conditioned medium, secretome, or a portion thereof, or EV population provided herein can comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 different miRNAs selected from Table 4. For example, the cell-free conditioned medium, secretome, or a portion thereof, or EV population provided herein can comprise 10, 20, 30, 40, or 50 different miRNAs selected from Table 4.

[0285] Methods for detecting the presence of miRNA and / or protein in a sample are well known and include ELISA, mass spectrometry (e.g., liquid chromatography-mass spectrometry (LC-MS)), Northern blotting, in situ hybridization, reverse transcription-qPCR, microarrays, and next generation sequencing, among others.

[0286] In some examples, miRNAs can be detected using the NanoString nCounter Human v3 miRNA Expression Assay Code Set (NanoString) (e.g., as described in the Examples section below). In this particular example, miRNA counts can be normalized using spike-ins from the NanoString program before filtering for analysis for miRNAs with counts >20 in ≥1 sample. LC-MS / MS can be used to detect EV proteins, and peptide identifications can be filtered using the Percolator algorithm to achieve a global 1% false discovery rate (FDR). Identification results can be imported back into Progenesis QI and mapped to MS1 peak areas. Peak areas can be normalized to the total ion intensity of all identified peptides. Relative protein quantification can be performed using the relative peak areas of non-conflicting peptides. If a protein is detected in at least one sample containing ≥2 peptides and ≥1 unique peptide, the protein can be accepted for analysis.

[0287] A composition comprising at least 10 different proteins selected from Table 2 is provided.

[0288] In one example, the composition can comprise at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different proteins selected from Table 2. For example, the composition can comprise at least 10, at least 20, at least 30, at least 40, or at least 50 different proteins selected from Table 2. In some examples, the composition can comprise 10 different proteins selected from Table 2. For example, the composition can comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 different proteins selected from Table 2. For example, the composition can comprise 10, 20, 30, 40, or 50 different proteins selected from Table 2.

[0289] Further provided is a composition comprising at least 10 different proteins selected from Table 3.

[0290] In one example, the composition can comprise at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different proteins selected from Table 3. For example, the composition can comprise at least 10, at least 20, at least 30, at least 40, or at least 50 different proteins selected from Table 3. In some examples, the composition can comprise 10 different proteins selected from Table 3. For example, the composition can comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 different proteins selected from Table 3. For example, the composition can comprise 10, 20, 30, 40, or 50 different proteins selected from Table 3.

[0291] Also provided is a composition comprising at least 10 different miRNAs selected from Table 4.

[0292] In one example, the composition can comprise at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different miRNAs selected from Table 4. For example, the composition can comprise at least 10, at least 20, at least 30, at least 40, or at least 50 different miRNAs selected from Table 4. In some examples, the composition can comprise 10 different miRNAs selected from Table 4. For example, the composition can comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 different miRNAs selected from Table 4. For example, the composition can comprise 10, 20, 30, 40, or 50 different miRNAs selected from Table 4.

[0293] In some examples, the composition is a cell-free composition. In other words, the composition is substantially free of cells (e.g., mesenchymal stem cell (MSC) sample cells, derivatives thereof, mesenchymal stem cell (MSC) sample cells and / or derivatives thereof deposited with ECACC deposit number 22072103, or deposited with ECACC deposit number 22072101). "cell-free" is defined in more detail elsewhere herein.

[0294] The inventors have demonstrated that the cells, cell populations, cell-free conditioned medium, secretome, and / or EV populations described herein have therapeutic utility.

[0295] Therefore, a pharmaceutical composition is provided, comprising the MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretome, or a portion thereof, extracellular vesicle (EV) population, or composition described herein, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant, excipient, diluent and / or carrier.

[0296] Thus, the MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretome, or fractions thereof, extracellular vesicle (EV) populations, or compositions described herein can be provided as part of a pharmaceutical composition.

[0297] Pharmaceutical compositions may routinely contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, supplemental immunopotentiators (such as adjuvants and cytokines), and optionally other therapeutic agents or compounds.

[0298] As used herein, "pharmaceutically acceptable" refers to a material (substance) that is not biologically or otherwise undesirable, i.e., the material can be administered to an individual along with the selected MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretome, or fractions thereof, extracellular vesicle (EV) populations, or compositions without causing any adverse biological effect or interacting in a deleterious manner with any other components of the pharmaceutical composition containing it.

[0299] An excipient is a natural or synthetic substance formulated with an active ingredient (e.g., MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretome, or a portion thereof, extracellular vesicle (EV) population, or composition as provided herein), including for the purpose of increasing the volume of the formulation or imparting therapeutic enhancement to the active ingredient in the final dosage form, such as promoting drug absorption or dissolution. Excipients are also useful in the manufacturing process, as they aid in handling the active substance in question, such as by promoting powder fluidity or non-stickiness, and in addition contribute to in vitro stability, such as preventing denaturation within the expected shelf life. Pharmaceutically acceptable excipients are well known in the art. Therefore, a person of ordinary skill in the art can readily identify suitable excipients. For example, suitable pharmaceutically acceptable excipients include water, saline, aqueous glucose solution, glycerol, ethanol, and the like.

[0300] Adjuvants are pharmacological and / or immunological agents that alter the effects of other agents in a formulation. Pharmaceutically acceptable adjuvants are well known in the art. Therefore, one of ordinary skill in the art can readily identify suitable adjuvants.

[0301] A diluent is a diluent (agent for dilution). Pharmaceutically acceptable diluents are well known in the art. Thus, one of ordinary skill in the art can readily identify a suitable diluent.

[0302] The carrier is nontoxic to the recipient at the dosage and concentration employed and is compatible with the other ingredients in the formulation. The term "carrier" refers to an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined for ease of application. Pharmaceutically acceptable carriers are well known in the art. Thus, one of ordinary skill in the art can readily identify suitable carriers.

[0303] Pharmaceutical compositions described herein can be administered to a subject as a monotherapy or as part of a combined therapy. For example, provided herein are MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretomes, or parts thereof, extracellular vesicle (EV) groups, or compositions and adriamycin combinations, which may be particularly useful, for example, for treating certain types of cancerous tumors. The administration of the combination can be performed in any order (preferably, the pharmaceutical composition is administered simultaneously with or after adriamycin, alternatively, the pharmaceutical composition is administered simultaneously with or before adriamycin).

[0304] The pharmaceutical compositions described herein can be advantageously used as medicines. The pharmaceutical compositions can be used to promote tissue repair, wound healing and / or tissue regeneration, or to treat or prevent inflammation.

[0305] Pharmaceutical compositions for use as medicine (e.g., to promote tissue repair or treat or prevent inflammation) may comprise the MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretome, or fractions thereof, extracellular vesicle (EV) populations, or compositions described herein and a pharmaceutically acceptable excipient, adjuvant, diluent and / or carrier.

[0306] In some examples, the pharmaceutical compositions provided herein can be used to promote tissue repair. It will be clear to those skilled in the art that the methods described herein for promoting tissue repair and / or regeneration can result in improved tissue repair in a subject.

[0307] As used herein, "tissue repair" refers to the restoration of the anatomical structure and / or function of the tissue state before being damaged (e.g., before being injured). In other words, tissue repair involves restoring the anatomical structure and / or function of the damaged tissue so that the repaired tissue is closer to the anatomical structure and / or function of the tissue before being damaged. As used herein, "tissue repair" may refer to the partial or complete restoration of the anatomical structure and / or function of the damaged tissue (e.g., compared to the anatomical structure and / or function of the tissue before being damaged). Undamaged (i.e., healthy) tissue of the same type as the damaged tissue may be used for anatomical structure and / or function comparison to determine the condition of the damaged tissue. Tissue repair may include restoring the physical continuity between separated (e.g., due to injury) tissue parts. Preferably, such repair of physical continuity includes resetting or reconnecting the tissue parts without significant separation of a type of tissue (e.g., scar tissue) that did not exist before the damage (e.g., before the injury). Thus, repair may include filling a tissue defect, for example, by resetting the tissue parts separated due to the defect and / or by growing new tissue of the type that was damaged or degenerated, rather than by developing scar tissue. Repair may include the growth or development of new tissue. Thus, tissue repair can include tissue regeneration, however, in some examples, repair can occur without signs of new tissue growth. Those skilled in the art can readily identify tissue repair using conventional methods known in the art. For example, at different time points after treatment with the pharmaceutical compositions provided herein, those skilled in the art can visually compare damaged tissue with healthy tissue of the same type.

[0308] In some examples, the pharmaceutical compositions provided herein can be used to promote tissue regeneration. It will be clear to those skilled in the art that the methods of promoting tissue regeneration described herein can result in improved tissue regeneration in a subject.

[0309] " Tissue regeneration " used herein includes any aspect of the anatomical structure and / or functional restoration of a state before tissue damage (such as damage caused by damage or degeneration or degeneration (degradation) process), which relates to the generation of new tissue (meaning cells or parts of cells). " Tissue regeneration " used herein can refer to the partial or complete regeneration of the anatomical structure and / or function of damaged tissue. The generation of new tissue can include the growth of existing cells. For example, in the case of chondrocytes, regeneration can include increased cell growth, increased chondrocyte differentiation speed and degree, increased cartilage tissue formation. For example, in the case of osteoblasts, regeneration can include increased cell growth, increased osteogenic differentiation speed and degree, increased bone tissue formation. For example, in the case of adipocytes, regeneration can include increased cell growth, increased adipogenic differentiation speed and degree, increased adipose tissue formation. New tissue can replace previously existing tissue. The generation of new tissue can include the division of existing cells. In some examples, regeneration results in the re-establishment of original tissue structure and function.

[0310] Tissue damage typically impairs the function and / or anatomy of a tissue. One skilled in the art can readily identify damaged (e.g., injured) tissue using conventional methods known in the art (e.g., visual methods, e.g., with the aid of a microscope). Tissue damage can occur as a result of injury (e.g., trauma), disease, disorder or condition, degenerative and / or degenerative processes.

[0311] As is known to those skilled in the art, a tissue is a group of cells that have a similar structure and function together as a unit. As used herein, "tissue" includes any external or internal body tissue. Examples of tissues include, but are not limited to, brain, skin, liver, pancreas, stomach, kidney, gastrointestinal tract, esophagus, heart, muscle, connective tissue, cartilage, nerves, fat, or bone marrow tissue. Tissues of particular relevance in the context of the present invention include cartilage, bone, and adipose tissue.

[0312] Thus, in some instances, the pharmaceutical compositions provided herein are used to treat or prevent diseases or conditions associated with cartilage, bone, and / or adipose tissue damage.

[0313] Thus, in some instances, the pharmaceutical compositions provided herein are used to treat or prevent diseases or conditions associated with cartilage damage.

[0314] Cartilage is a connective tissue found in many parts of the body. Cartilage has multiple functions, including holding bones together and supporting other tissues. One skilled in the art can easily identify cartilage damage in a subject, for example, using MRI or arthroscopy, and thereby identify a disease or condition associated with cartilage damage. Diseases or conditions associated with cartilage damage are well known to those skilled in the art. Non-limiting examples of diseases or conditions associated with cartilage damage include arthritis. Arthritis is defined as acute or chronic joint inflammation in a joint. Arthritis can cause a variety of symptoms, including pain, stiffness, reduced range of motion, and joint deformities. There are many different types of arthritis. Non-limiting examples of different types of arthritis include juvenile idiopathic arthritis, rheumatoid arthritis, osteoarthritis, spondyloarthritis, and psoriatic arthritis.

[0315] In some instances, the pharmaceutical compositions provided herein are used to treat or prevent arthritis.

[0316] A pharmaceutical composition provided herein that is particularly relevant to the treatment or prevention of arthritis is a pharmaceutical composition comprising the extracellular vesicle population described herein, particularly an extracellular vesicle (EV) population obtainable by cell culture of Y201 cells or a population thereof.

[0317] In some instances, the pharmaceutical compositions provided herein are used to treat or prevent inflammatory arthritis.

[0318] Inflammatory arthritis is a general term for a group of arthritis conditions that cause joint pain, stiffness, and damage, examples of which include, but are not limited to, rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, and juvenile idiopathic arthritis subtypes. Thus, in some examples, arthritis (e.g., inflammatory arthritis) is selected from: rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, and juvenile idiopathic arthritis. The main features of inflammatory arthritis include signs of inflammation, such as redness, swelling, and fever around the joints. Clinicians can look for specific markers in the blood, such as rheumatoid factor, C-reactive protein, or specific antibodies (e.g., anti-CCP), to identify inflammatory arthritis. Those skilled in the art can readily identify inflammatory arthritis.

[0319] In some examples, the arthritis is selected from the group consisting of rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, juvenile idiopathic arthritis, osteoarthritis, and spondyloarthritis.

[0320] In some examples, the arthritis is selected from the group consisting of juvenile idiopathic arthritis, rheumatoid arthritis, gout, osteoarthritis, spondyloarthritis, ankylosing spondylitis, post-traumatic osteoarthritis, reactive arthritis, and psoriatic arthritis.

[0321] In some examples, the arthritis is selected from the group consisting of juvenile idiopathic arthritis, rheumatoid arthritis, osteoarthritis, spondyloarthritis, and psoriatic arthritis. In some examples, the arthritis is juvenile idiopathic arthritis or psoriatic arthritis.

[0322] In some instances, the pharmaceutical compositions provided herein can be used for wound healing.

[0323] A wound occurs when the structure and / or integrity of one or more tissues is compromised, such as when the skin breaks, muscles tear, bones are broken, or tissue is burned. Therefore, it will be clear to those skilled in the art that a wound is an example of tissue damage. Therefore, it will be readily understood by those skilled in the art that wound healing is an example of tissue repair (and that wound healing may involve tissue regeneration). For example, a wound may be caused by an accident, trauma, or medical procedure, by an infectious disease or underlying disease condition, or by other causes. Wounds can be classified as closed or open depending on their location, extent, and severity. Wound healing occurs in three distinct phases. The inflammatory phase is characterized by inflammation at the site of the wound. This phase is crucial for healing and involves extensive cell migration. The second phase of wound healing is the proliferative phase, which is characterized by epithelialization, angiogenesis, granulation tissue formation, and collagen deposition. Angiogenesis involves the formation of new capillaries, which deliver nutrients and maintain granulation tissue. Without the formation of new capillaries, necessary nutrients cannot reach the wound, resulting in prolonged wound healing. The third and final phase of wound healing is the maturation phase, in which fibroblasts differentiate into collagen. The distribution of connective tissue matrix and collagen contracts, leading to scar tissue formation. While scar formation is essential for wound healing, excessive scarring may have additional cosmetic and / or pathological consequences, such as keloid and / or hypertrophic scars.

[0324] Wound healing can be determined using conventional methods known in the art, for example, wound healing can be conveniently measured by a decrease in wound area over a defined period of time (e.g., 5 days, 10 days, 15 days, or 20 days). In other words, wound healing can be measured by comparing the wound area at different time points after the wound appears, wherein a decrease in wound area over time indicates wound healing.

[0325] In some examples, the wound may be an acute wound or a chronic wound. Acute wounds are wounds that heal rapidly within 30 days (60 days for diabetic patients). Non-limiting examples of acute wounds that can be treated with the present invention include abrasions, avulsions, contusions, crush injuries, cuts, lacerations, projectile wounds, and puncture wounds. Chronic wounds include, but are not limited to, diabetic skin ulcers, pressure sores, surgical wounds, spinal injury wounds, burns, wounds caused by chemicals, and wounds caused by vascular diseases.

[0326] In some instances, the pharmaceutical compositions provided herein can be used to treat or prevent inflammation.

[0327] The methods for treating or preventing inflammation described herein generally result in a reduction of inflammation (e.g., a reduction of local inflammation). The reduction of inflammation can be determined using conventional methods known in the art, for example, the reduction of inflammation can be conveniently measured by reducing the symptoms of inflammation and / or reducing the area of inflammation over a specified time period (e.g., 5 days, 10 days, 15 days, or 20 days). For example, the reduction of inflammation can be measured by comparing the inflammation at different time points after the onset of inflammation. In some examples, the level of inflammation (e.g., the reduction in the level of inflammation) can be determined by measuring inflammatory biomarkers (e.g., C-reactive protein, IL-6, and / or TNF-α) in a subject known to those skilled in the art using conventional methods.

[0328] Inflammation generally refers to a protective response caused by tissue damage (e.g., tissue injury or destruction). Inflammation generally acts to destroy, dilute, or isolate (isolate) harmful substances and damaged tissues, and is significantly associated with the influx of leukocytes and / or neutrophil chemotaxis. Inflammation is generally characterized by classic signs and symptoms, including edema, erythema (redness), fever, pain, and functional impairment (stiffness and inability to move), as known to those skilled in the art. In healthy individuals, inflammation is self-limiting, and its resolution is controlled by the release of anti-inflammatory mediators and cytokines (such as interleukin 10 (IL-10)), which are produced by cells referred to as "inhibitory" or "regulatory" and are produced as part of a negative feedback loop. In fact, in the normal inflammatory process of the body, the initial pro-inflammatory response is followed by a pro-resolving response, which shuts down inflammation after the damage resolves, resulting in a reduction in pro-inflammatory cytokines such as TNFα and IL-12, while anti-inflammatory cytokines such as IL-10 and TGF-β increase in levels, leading to the generation of a so-called tolerogenic environment.

[0329] Inflammation is part of many disease states. For example, inflammation may be caused by pathogenic organisms and / or viral infections, may be caused by non-infectious factors (such as trauma, injury, toxic chemicals, overuse, detection of foreign antigens and / or autoimmune reactions). Therefore, it will be clear to those skilled in the art that administering compositions described herein to a subject may be beneficial in many different situations. For example, in any case where inflammation control may be beneficial, administering such compositions to a subject may be beneficial (for example, in treating persistent infections, wherein the persistent inflammation caused by infection may cause tissue damage). Non-limiting examples of situations where the pharmaceutical compositions provided herein may be beneficial to a subject include allergies, infections (such as persistent / chronic infections) lung diseases, diabetes, neurological diseases, cardiovascular diseases, intestinal diseases, trauma, graft versus host disease, periodontal disease, cancer. Therefore, in some examples, pharmaceutical compositions provided herein may be used to treat or prevent allergies, infections (such as persistent / chronic infections) lung diseases, diabetes, neurological diseases, cardiovascular diseases, intestinal diseases, trauma, graft versus host disease, periodontal disease and / or cancer. As described elsewhere herein, the pharmaceutical compositions provided herein can be used together with other treatments or therapeutic regimens (e.g., used in combination). Those skilled in the art can readily identify inflammation using conventional methods known in the art, and therefore identify diseases, conditions, and / or disorders that may benefit from the treatment of the pharmaceutical compositions provided herein.

[0330] Inflammation can be acute or chronic. Therefore, provided herein is a pharmaceutical composition that can be used to treat or prevent acute and / or chronic inflammation. For example, provided herein is a pharmaceutical composition that can be used to treat or prevent acute and / or chronic inflammation caused by a wound (this can promote wound healing and / or prevent tissue damage in the case of chronic inflammation).

[0331] In some instances, the pharmaceutical compositions provided herein can be used to treat and / or prevent infection.

[0332] Inflammation is associated with many autoimmune diseases and conditions, including arthritis discussed above.

[0333] In some examples, provided herein are pharmaceutical compositions that can be used to treat or prevent autoimmune diseases or conditions. It will be clear to those skilled in the art that administering such compositions to a subject may be beneficial in many different situations. For example, GvHD, multiple sclerosis, psoriasis, eczema, gastrointestinal autoimmune disorders (such as Crohn's disease), lupus (systemic lupus erythematosus), fibromyalgia, (inflammatory) arthritis. Therefore, in some examples, provided herein are pharmaceutical compositions that can be used to treat or prevent GvHD, multiple sclerosis, psoriasis, eczema, gastrointestinal autoimmune diseases (such as Crohn's disease), lupus (systemic lupus erythematosus), (inflammatory) arthritis and / or fibromyalgia. In a specific example, provided herein are pharmaceutical compositions that can be used to treat and / or prevent autoimmune diseases or conditions, wherein the autoimmune diseases or conditions are selected from: GvHD, psoriasis, systemic lupus erythematosus and arthritis, optionally wherein the arthritis is selected from: juvenile idiopathic arthritis, rheumatoid arthritis, osteoarthritis, spondyloarthritis and psoriatic arthritis. Notably, EVs have previously been systemically administered to therapy-refractive GvHD patients, resulting in improvement in their condition (Kordelas, L., Rebmann, V., Ludwig, AK. et al., MSC-derived exosomes: a novel tool to treat therapy-refractory graft-versus-host disease. Leukemia 28, 970-973 (2014)).

[0334] As used herein, the terms "treat," "treating," and "treatment" include interventions performed to prevent the development of a condition, disorder, or symptom (e.g., a condition, disorder, or symptom described herein) or to alter its pathology. Thus, "treat" refers to both therapeutic treatment and prophylactic or preventative measures, wherein the purpose is to prevent or slow down (mitigate) a target condition, disorder, or symptom. For example, treatment can refer to improving a condition, disorder, or symptom (e.g., inhibiting a condition, disorder, or symptom, or reducing the expression, range, or severity of at least one clinical symptom thereof). For example, "treating" or "treatment" can refer to improving at least one physical parameter, which may not be discernible by the subject. In some examples, "treating" or "treatment" refers to regulating a condition, condition, or symptom, whether physically (e.g., stabilizing a discernible symptom), physiologically (e.g., stabilizing a physical parameter), or both.

[0335] As used herein, the terms "preventing," "prevent," or "prevention" refer to reducing the risk of acquiring or developing a condition, disorder, or symptom, such as a condition, disorder, or symptom described herein (e.g., preventing at least one symptom of a condition or disorder in a subject who may be exposed to a disease-causing agent or who is otherwise susceptible to the disease or condition prior to onset).

[0336] As used herein, the term "subject" refers to an individual, such as a human, who has or is at risk of having a particular condition, disorder, or symptom (e.g., as described herein). The subject can be a patient, i.e., a subject in need of treatment according to the present invention. The subject may have already received treatment for the condition, disorder, or symptom. Alternatively, the subject has not received treatment prior to treatment according to the present invention. Preferably, the subject is a human subject.

[0337] The pharmaceutical compositions described herein can be administered to a subject by any conventional route, including injection or gradual infusion over time. Administration can be, for example, by infusion or by intramuscular, intravascular, intracavitary, intracerebral, intralesional, rectal, subcutaneous, intradermal, epidural, intrathecal, or transdermal administration. For example, administration can be intra-articular.

[0338] The pharmaceutical compositions described herein may be in any form suitable for the above-described modes of administration. For example, the composition comprising the cells may be in any form suitable for infusion. As a further example, forms suitable for parenteral injection (including subcutaneous, intramuscular, intravascular, or infusion) include sterile solutions, suspensions, or emulsions; forms suitable for topical administration include ointments or creams; and forms suitable for rectal administration include suppositories. Alternatively, the route of administration may be direct injection into the target area, or by regional delivery or by local delivery. It is well within the routine capabilities of those skilled in the art to determine the appropriate dosage of the pharmaceutical compositions of the present invention.

[0339] Preferably, the pharmaceutical composition comprises or consists of an amount of active ingredient constituting a drug dosage unit (e.g., MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretomes, or portions thereof, extracellular vesicle (EV) groups, or compositions as described herein). A drug dosage unit is defined herein as the amount of active ingredient applied to a subject at a given time point (i.e., for example, the total amount of MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretomes, or portions thereof, extracellular vesicle (EV) groups, or compositions as described herein in a vaccine). It should be understood herein that the individual volumes of a drug dosage may differ in composition, i.e., may contain active ingredients and / or adjuvants of different types or compositions.

[0340] The pharmaceutical compositions described herein are used to be administered in an effective amount. An "effective amount" refers to the amount that produces the desired (therapeutic or non-therapeutic) response, either alone or in combination with other dosages. For example, the effective amount to be used will depend on the treatment (or non-therapeutic) purpose, route of administration, and the condition of the patient / subject. For example, for a given patient / subject, the appropriate dosage of the compositions of the present invention will be determined by the attending physician (or the personnel administering the pharmaceutical composition), while considering various factors known to change the effect of the compositions of the present invention, such as the severity and type of hematologic malignancies, body weight, sex, diet, time and route of administration, other drugs, and other relevant clinical factors. Dosage and schedule can vary depending on the specific condition, disease, or overall condition of the patient / subject. The effective dose can be determined by in vitro or in vivo methods.

[0341] The pharmaceutical compositions of the present invention may advantageously be presented in unit dosage form.

[0342] Provided herein are uses of the extracellular vesicle (EV) populations provided herein for delivering cargo to cells.

[0343] Suitably, the EVs in the EV population may contain a cargo. The cargo may be any entity, such as, but not limited to, a chemical compound, a combination of compounds, a supramolecular complex of synthetic or natural origin, genetic material, a portion thereof, or a derivative thereof, that possesses a useful property or exerts a useful activity. The cargo may be hydrophilic or hydrophobic.

[0344] Suitably, the load may be an active pharmaceutical ingredient, optionally wherein the active pharmaceutical ingredient is selected from: small molecules, peptides, proteins, inorganic nanoparticles, oligonucleotides, or any combination thereof. Where compatible, the terms "active pharmaceutical ingredient" and "drug" are used interchangeably herein.

[0345] Suitably, the cargo may be an imaging agent, optionally wherein the imaging agent is selected from: MRI contrast agents (e.g. Gd), PET / SPECT radioactive imaging agents (e.g. 111In, 64Cu), paramagnetic nanoparticles (e.g. iron oxide), fluorescent probes, bioluminescent probes, quantum dots, gold nanoparticles, optical coherence tomography agents (e.g. gold nanorods, fluorescent proteins, fluorescent / radioactive latex beads / polymers, photoacoustic imaging agents (e.g. carbon nanotubes), Raman spectroscopy agents (e.g. AuNPs), nanobubbles, or any combination thereof.

[0346] Those skilled in the art will appreciate that any active pharmaceutical ingredient or any imaging agent may be used in the context of the present invention. Non-limiting examples are provided below. For the avoidance of doubt, EVs may contain a variety of cargoes, such as two or more active pharmaceutical ingredients, two or more imaging agents, or a mixture of active pharmaceutical ingredients and imaging agents.

[0347] A cargo (e.g., an imaging agent) can be bound to (or adsorbed or tethered to) the outer surface of an EV. This can be advantageous, for example, if they are to be used in diagnostic methods, or for targeted delivery using antibodies or aptamers. Alternatively, the cargo can be incorporated into the EV. For example, the cargo can be encapsulated within the EV and / or covalently bound to the EV.

[0348] In some examples, the cargo may be siRNA. This may be advantageous in the context of gene therapy, particularly in the delivery of gene therapy, which has historically been a major hurdle to the success of gene therapy.

[0349] The cargo can be encapsulated by at least one lipid bilayer of the EV so that it is located within the aqueous core. It is expected that although most of the active pharmaceutical ingredient or imaging agent will be encapsulated in the EV, a portion may not be encapsulated therein. References to substances contained "inside" the EV are intended to include substances that can be completely encapsulated within the EV structure (e.g., within the lipid bilayer wall, or within an area enclosed within the lipid bilayer wall). Alternatively, the substance can be covalently bound to one or more components of the EV particle, such as the lipid bilayer structure in the case of EV.

[0350] EVs can be prepared to contain a desired cargo. The process of incorporating a desired cargo into an EV is often referred to as "loading." The EV-incorporated cargo can be completely or partially located within the interior space of the EV, within the bilayer membrane of the EV, or associated (bound) to the outer surface of the EV membrane. Incorporating a cargo into an EV is also referred to as encapsulation or entrapment (capture), and these three terms are used interchangeably herein and have the same meaning.

[0351] The purpose of cargo EV encapsulation is generally to protect the cargo from damaging environments while providing the encapsulated cargo with an opportunity to exert its activity primarily in sites or environments where activity is favorable and less so in other sites where such activity may be useless or undesirable.

[0352] This phenomenon is called delivery. For example, a drug substance within an EV can be protected from destruction by enzymes in the body but is released from the EV and delivers treatment at the site of disease.

[0353] EV and its cargo can be delivered to recipient (receptor) cells through a series of mechanisms, for review, see Gurung et al., 2021, The exosome journey:from biogenesis to uptake and intracellular signalling.Cell Commun Signal 19,47 (2021). In some examples, EV is absorbed by cells, and its contents are released therein. EV can interact with the plasma membrane of recipient cells, such as through integrins and adhesion molecules, and is internalized (internalized) by clathrin-mediated endocytosis, phagocytosis, lipid rafts-mediated endocytosis, caveolin-mediated endocytosis and / or pinocytosis to deliver its cargo.

[0354] In some examples, EVs and their cargo can be delivered to recipient cells via integrin-mediated endocytosis (e.g., RGD-integrin-mediated endocytosis). It is routine for those skilled in the art to test whether EVs are taken up by integrin-mediated endocytosis, and suitable tests are described in the Examples below.

[0355] The recipient cell may be any suitable cell. It will be clear to those skilled in the art that the recipient cell may depend on the cargo of the EV population.

[0356] In some examples, the recipient cell can be selected from the group consisting of: MSC cells, MSC-like cells, osteosarcoma cells, macrophages, T cells, B cells, NK cells, neutrophils, monocytes, mast cells, and eosinophils.

[0357] In some examples, the recipient cell can be selected from the group consisting of: MSC cells, MSC-like cells, and osteosarcoma cells. In some examples, the recipient cell can be MSC cells or MSC-like cells.

[0358] The term "in vitro" generally refers to outside or external to an animal or human body. The term "ex vivo" generally refers to tissues or cells removed from an animal or human body and maintained or propagated outside the body (e.g., in a culture vessel). As used herein, the term "in vitro" should be understood to include "ex vivo." The term "in vivo" generally refers to within, on, or in an animal or human body.

[0359] Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. For example, Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d Ed., John Wiley and Sons, NY (1994); and Hale and Marham, The Harper Collins Dictionary of Biology, Harper Perennial, NY (1991) provide those skilled in the art with a general dictionary of many of the terms used in the present invention. Although any methods and materials similar or equivalent to those described herein can be used to practice the present invention, preferred methods and materials are described herein. Therefore, the terms defined below will be more fully described by reference to the entire specification. In addition, as used herein, the singular terms "a," "an," and "the" include plural references unless the context clearly indicates otherwise. Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' orientation; amino acid sequences are written from left to right in an amino to carboxyl orientation, respectively. It is to be understood that the present invention is not limited to the particular methodology, protocols, and reagents described, as these may vary depending on the context in which they are used by one skilled in the art.

[0360] Aspects of the present invention are demonstrated by the following non-limiting examples.

[0361] Example 1

[0362] As mentioned above, to address the challenges associated with using MSCs in therapy, the inventors initiated an immortalization and cloning program to generate a panel of MSC lines representing different bone marrow stromal subtypes, including stem cells of varying potency. From these initial clones, eight were selected for in-depth characterization based on their robust in vitro growth properties. Advantageously, the inventors specifically identified a cell line, designated Y201, that exhibited typical MSC characteristics, with robust tissue-forming and anti-inflammatory properties both in vitro and in vivo.

[0363] The inventors have demonstrated that Y201 MSCs are highly reproducible and have thoroughly characterized these cells (e.g., their growth, transcriptomics, secretomes, surface omics, and marker expression). The inventors have demonstrated that Y201 MSCs can produce abundant and consistent EVs and have collected their size, morphology, EV markers, miRNA, and proteomics data. Advantageously, the inventors have demonstrated that Y201 EVs can stimulate cell growth (donor MSCs and chondrocytes from arthritis patients), cartilage formation, and inhibit inflammation. Surprisingly, further engineering of Y201 MSCs using CRISPR / Cas9 to target the deletion of the FGFR3 gene increased proliferation, migratory activity, and secretory behavior, enabling growth under serum-free conditions.

[0364] Some of the properties of the Y201 cell line and derivatives claimed herein have been previously described in the literature (James et al., 2015; Kay et al., 2022). Now, the cell line itself is disclosed herein for the first time.

[0365] method

[0366] Y201 cells and Y201-EVs

[0367] Y201 cells

[0368] Y201 MSCs were generated by immortalization with human telomerase reverse transcriptase (hTERT) and characterized as previously described (James et al., 2015; Kay et al., 2022).

[0369] Cell culture and preparation of EV-depleted medium

[0370] Dulbecco's modified Eagle's medium (DMEM) (Cat. No. 41966, ThermoFisher Scientific) supplemented with 20% fetal bovine serum (FBS) and 1% penicillin / streptomycin (P / S) (Cat. No. 15140122, ThermoFisher Scientific) was centrifuged at 10,000 g for 18 hours at 4°C to deplete the culture medium of serum-derived bovine EVs. During cell expansion, the culture medium was diluted with an equal volume of DMEM supplemented with 1% P / S. Y201 cells and the comparative MSC line MSC#2 were grown at 37°C in a 5% CO2 / 95% air atmosphere. Human articular chondrocytes (ACs) were isolated from primary donors after obtaining fully informed ethical consent (LREC 07 / Q1105 / 9). ACs were cultured in DMEM-F12 supplemented with 10% FBS and 1% P / S.

[0371] Conditioned media collection for secretome analysis and functional assays

[0372] Conditioned medium was collected from 2x T175 flasks of Y201 and MSC#2 lines. The cells were grown to 80% confluence, then washed 2x with PBS, 17 ml of serum-free DMEM was added to the flasks, and incubated at 37°C and 5% CO2 for 24 hours. The culture medium was collected and then centrifuged at 300 g to remove any larger cell debris. For functional assays, the culture medium was stored at -80°C until needed. For proteomic analysis, the culture medium was concentrated at 4500 g in 3kD MWCO tubes (GE Healthcare) until the volume was concentrated to 1 ml. The culture medium was stored at -80°C until needed.

[0373] Ptychography (electron ptychography), cell tracking, and image analysis

[0374] Live cell tracking analysis was performed using stacked imaging using the PhaseFocus VL21 Livecyte imaging platform. Images were acquired every 20–26 minutes for 96 hours, starting 4 days after seeding, depending on colony location. Cell morphology and migration were quantified using the PhaseFocus analysis platform and statistical tests performed in Graphpad Prism. Rose plots were generated using the mTrackJ plugin in ImageJ. Flowcharts were generated using the image analysis program CellProfiler to assess MSC morphological characteristics.

[0375] Colony formation assay and image analysis

[0376] For colony-forming unit-fibroblast (CFU-F) assays, all cell types were plated at 10 cells / cm 2The density of 100 μg / ml of cells was seeded in 6-well plates using DMEM supplemented with 20% Hyclone FBS (containing 100 units / ml penicillin, 100 μg / ml streptomycin). By incubating for 24 hours at a confluence of 80% in serum-free medium, the culture medium was then collected, centrifuged at 300 g to remove cell debris, and the number of cells was counted to collect the conditioned medium for CFU-F determination from Y201 and MSC#2 cells. The conditioned medium was then diluted with additional serum-free DMEM to obtain 12 ml of conditioned medium per million cells. Hyclone FBS was then added to the culture medium at a final concentration of 20% for CFU-F determination. For CFU-F, primary cells and cell lines were seeded in unconditioned (unregulated) Hyclone culture medium, and then, the culture medium was replaced every 4 days after inoculation, and the cell lines were plate-fixed and stained on the 10th day, and the primary cells were plate-fixed and stained on the 14th day. Plates were stained with (0.05% crystal violet + 1% formaldehyde + 1% methanol in PBS) for imaging or washed 1x with PBS, and cells were lysed with 350 μL RA1 cell lysis buffer + 3.5 μL β-mercaptoethanol per 3 wells. Lysates were stored at -80°C for subsequent qRT-PCR analysis. The plates were air-dried and then scanned at 1200 dpi on an Epson Perfection 4990 photo scanner. The CellProfiler pipeline was subsequently developed to accurately detect and measure colonies.

[0377] Focal adhesion assessment

[0378] Cells were seeded (plated) at low density onto glass coverslips and left to adhere for 24 hours. The cells were briefly fixed in 4% methanol-free PFA in PBS and then washed 3x with PBS. The cells were permeabilized in 0.1% Triton X-100 in PBS for 30 minutes and washed 3x with PBS. The cells were then blocked with 10% goat serum in PBS for 30 minutes. Anti-focal adhesion protein antibody (1:400 dilution) was added to 1% BSA and incubated at room temperature for 1 hour. The cells were washed 3x with PBS, followed by goat anti-mouse and Alexafluor 488-conjugated secondary antibodies (1:2300, ThermoFisher) and Cruzfluor 594-conjugated phalloidin (1 to 1000, Santa Cruz) for 45 minutes in PBS and then washed 3x again. The nuclei were counterstained with 0.2μg / ml DAPI for 10 minutes, then briefly rinsed in distilled dH2O water and air-dried. Coverslips were mounted onto microscope slides using Prolong Gold Antifade Reagent (ThermoFisher).

[0379] Slides were imaged on a Zeiss LSM880 or LSM780 microscope. Focal adhesion size was quantified using ImageJ.

[0380] Gene set enrichment analysis (GSEA)

[0381] A list of gene names for significantly upregulated proteins or enriched miRNA targets was compiled and evaluated using the Broad Institute GSEA molecular signature database (V7.0). The list was analyzed against the KEGG pathway database for significant enrichment.

[0382] Isolation of EVs by continuous differential ultracentrifugation

[0383] 5x10 5 Y201 cells were seeded in T175 flasks containing EV-depleted medium until they reached 80-90% confluence. The medium was aspirated and the cells were washed three times with PBS, and then serum-free medium was added. Two culture medium collections were performed every 24 hours and stored at -70°C for EV isolation. Cells were counted at the end of the second collection. The protocol of Thery et al. (see Théry, Clotilde, Sebastian Amigorena, Raposo, and Aled Clayton. 2006. "Isolation and Characterization of Exosomes from Cell Culture Supernatants and Biological Fluids." Current Protocols in Cell Biology / Editorial Board, Juan S. Bonifacino... [et al.] Chapter 3) was slightly modified to isolate EVs, and all steps were performed at 4 ° C. The conditioned medium was centrifuged at 300g for 5 minutes to remove dead cells and debris, and then spun (centrifuged) a second time at 2000g for 20 minutes. The supernatant was transferred to a Ty45i thick-walled ultracentrifuge tube (Catalog Number: 355655, Beckman-Coulter) and centrifuged at 10,000g for 45 minutes in a L100-XP Beckman-Coulter ultracentrifuge. The 10K fraction was collected by vigorous resuspending with PBS and transferred to a thick-walled micro-ultracentrifuge tube (Catalog Number: 357448, Beckman-Coulter). The supernatant was centrifuged again at 100,000 g for 90 minutes, and the 100K fraction was collected into thick-walled micro-ultracentrifuge tubes. The 10K and 100K fractions were centrifuged in a Beckman-Coulter TL100 ultracentrifuge at 10,000 g for 45 minutes and 100,000 g for 90 minutes, respectively. The EV pellet was resuspended in PBS, and the EV suspension was transferred to a Protein LoBind tube.

[0384] Determining the concentration and size range of EVs using nanoparticle tracking analysis (NTA)

[0385] EV concentration and size were determined using NTA3.4 software, and videos were acquired using a Nanosight LM14 equipped with a green laser (532 nm). 10K and 100K Y201 EV fractions were diluted in PBS to a concentration of 20–120 particles per frame. A script was used to acquire 5 x 60 s video recordings of all events for further analysis. Experimental conditions were as follows: i) measurement time: 5 x 60 s, ii) blur: automatic, iii) detection threshold: 4–5, iv) blur size: automatic, and iv) number of frames: 1499.

[0386] Transmission electron microscopy (TEM)

[0387] 10 μl of EV suspension was deposited on a 200-mesh copper grid with a polyvinyl formal (Formvar) / carbon support film and allowed to air dry for 3 minutes. The grid was washed with three drops of dH2O to remove salt from PBS. Negative staining was achieved by adding 10 μl of 1% uranyl acetate.

[0388] Western blotting

[0389] Cell lysates and EVs were separated on 12% SDS-PAGE gels. The separated proteins were transferred to nitrocellulose membranes using the iBlot2 dry blotting system (20V for 1 minute, 23V for 4 minutes, and 25V for 2 minutes). The membranes were blocked for one hour with 5% bovine serum albumin (BSA) in PBST and incubated with the following mouse monoclonal antibodies for one hour at room temperature or overnight at 4°C: i) raft protein-1 (1:500; Santa Cruz: 133153), ii) CD63 (1:1000; Santa Cruz: 365604), iii) CD81 (1:1000; Santa Cruz: 23962), iv) Alix (Santa Cruz: 166952), v) GRP78BiP (Abcam: 21685), vi) MFG-E8 (1:200; proteintech: 67797-1-Ig). After incubation, the membrane was incubated with anti-mouse horseradish peroxidase-conjugated secondary antibody at a dilution of 1: 1500. Protein bands were visualized using the iBright Western Blot Imaging System and ECLPicoPlus Chemiluminescent Substrate (Cat. No. 34577, ThermoFisher Scientific).

[0390] Proteomic analysis of the Y201 whole secretome and Y201 EVs

[0391] The concentrated whole secretome sample was added to 8M urea containing 20mM HEPES, 1mM sodium orthovanadate, 1mM β-glycerophosphate and 2.5mM sodium pyrophosphate. The protein was reduced and alkylated in solution and then digested with a combination of Lys-C and trypsin proteases. The resulting peptides were analyzed by 1h LC-MS acquisition using Orbitrap Fusion. The peptides were eluted from a 50cmC18 EN PepMap column into the mass spectrometer. Three biological replicates were performed for each cell line. Tandem mass spectra were searched against the human subset of the UniProt database using Mascot, and peptide identifications were filtered by the Percolator algorithm to achieve a global false discovery rate (FDR) of 1%. The identification results were imported back into Progenesis QI and mapped to MS1 peak areas. The peak areas of all identified peptides were normalized to the total ion intensity. Relative protein quantification was performed using the relative peak areas of non-conflicting peptides. The relative fold difference and associated p-value of differential abundance were calculated in Progenesis QI.

[0392] EVs isolated from 8xT175 cells were added to 8M urea and a phosphatase inhibitor cocktail containing 1mM sodium orthovanadate, 1mM β-glycerophosphate, and 2.5mM sodium pyrophosphate in 20mM HEPES. The proteins were reduced and alkylated in solution and then digested with a combination of Lys-C and trypsin proteases. The resulting peptides were analyzed by LC-MS acquisition for 1 hour using an Orbitrap Fusion (Thermofisher). The peptides were eluted from a 50cm C18 EN PepMap column into the mass spectrometer. Three biological replicates were performed for each cell line. Tandem mass spectra were searched against the human subset of the UniProt database using Mascot, and peptide identifications were filtered by the Percolator algorithm to achieve a global false discovery rate (FDR) of 1%. The identification results were imported back into Progenesis QI and mapped to MS1 peak areas. The peak areas of all identified peptides were normalized to the total ion intensity. Relative protein quantification was performed using the relative peak areas of non-conflicting peptides. Proteins were accepted for analysis as long as they were detected in at least one sample with ≥2 peptides and ≥1 unique peptide. Relative fold differences and associated p-values for differential abundance between pairwise comparisons of cell lines were calculated by analysis of variance in Progenesis QI.

[0393] Analysis of EV microRNA

[0394] EVs from Y201 cells were thawed and allowed to reach room temperature. RNA was extracted using a total exosomal RNA and protein isolation kit (Invitrogen) according to the manufacturer's instructions. In brief, the samples were thawed and diluted to a total volume of 200 μL with 1x PBS in an RNAse-free tube. Then, 200 μL of preheated denaturing solution was added and mixed, and the samples were incubated on ice for 5 minutes. 400 μL of acid-phenol:chloroform was then added to each sample and they were vortexed for 60 seconds and then centrifuged at 13,000g for 5 minutes at room temperature. The aqueous phase (upper phase) was then transferred to a fresh RNAse-free tube, the recovered volume was recorded, and then used for purification. The aqueous phase was diluted with 1.25x volume of 100% ethanol and mixed. The aqueous phase / ethanol mixture was loaded into a filter cartridge in a new tube and centrifuged at 10,000g for 15 seconds. The effluent was discarded and the filter cartridge was washed by centrifugation at 10,000g for 15 seconds with 700μL miRNA Wash Solution 1. The effluent was discarded and then washed 2x with 500μL miRNA Wash Solution 2 / 3 at the same settings. The filter cartridge was dried at a spin speed of 10,000g for 1 minute. The filter cartridge was then removed and placed in a new collection tube, and the RNA was eluted using 50μL preheated elution solution and centrifuged at 10,000g for 30 seconds. The eluate was then passed through the filter cartridge a second time to increase the yield. After RNA purification, the sample was first filled to 400μL with RNAse-free water and concentrated using an Amicon Ultra 0.5ml centrifugal filter (Sigma-Aldrich). The sample was centrifuged at 14,000g for 88 minutes, then inverted and centrifuged at 8000g for 2 minutes to collect the RNA into a new tube. Total RNA was then quantified on a Bioanalyzer 2100 (Applied Biosystems) using a Pico chip. 5–3 μL of RNA was used in the NanoString miRNA ligation reaction. NanoString was performed using the nCounter Human v3 miRNA Expression Assay Code Set (NanoString) following the manufacturer's miRNA sample preparation protocol. Before filtering for analysis, miRNA counts were normalized using an internal standard from the NanoString program, with >20 counts in ≥1 sample. Comparison of EV miRNAs was performed in the R programming language.

[0395] CyQuant Proliferation Assay

[0396] Cells were plated at 9,000 cells / cm 2The density of 100 μg / ml was seeded in a 96-well plate and allowed to adhere overnight. The next morning, MSC#2 cells were treated with Y201 EV at 1X, 5X and 10X concentrations. The treatment was calculated using the following formula: (Ni / Nt) / vX, where Ni is the number of donor cells, Nt is the number of recipient cells (recipient cells), v is the volume of EV suspension, and X is the required number of treatments. Cells were treated with EV every day and the microplates were frozen. In order to evaluate the proliferative effect of EV, a CyQuant proliferation assay kit (catalog number: C7026, Invitrogen) was used. Working CyQuant solution was prepared by diluting the cell lysis buffer stock solution 20 times using dH2O, and CyQuant GR stock solution was added 400 times over 5-10 minutes. By soaking the microplate at 300 rpm for 2 minutes and measuring the fluorescence at 480 / 502 nm (excitation / emission) using a CLARIOstar plate reader, the quantification of cell DNA in each well was achieved.

[0397] Proliferation assay using LiveCyte microscope

[0398] Cells were plated at 4,500 cells / cm 2 Cells were seeded at a high density in 24-well plates and allowed to adhere overnight. MSC#2 cells were treated with a 10X concentration of Y201 EV. The microplates were mounted on a LiveCyte microscope, and cell proliferation was monitored for 72 hours using quantitative multi-layer phase imaging and analyzed using PhaseFocus software v3.5.

[0399] Articular chondrocytes (AC) isolated from OA donors were cultured at a density of 3,000 cells / cm 2 Cells were seeded at a density of 100kEV in 24-well plates and allowed to adhere overnight. Cells were treated with 10X and 20X concentrations of Y201 100kEV and cell proliferation was monitored for 72 hours using a LiveCyte microscope as described above.

[0400] Inhibits integrin-mediated transfer of EV cargo to recipient cells

[0401] AC cells were plated at 3,000 cells / cm 2Cells were seeded at a density of 100 μM in 24-well plates and left to adhere overnight at 37°C, 5% CO2. For inhibition studies, cells were treated with 200 μM Gly-Arg-Gly-Asp-Ser-Pro (GRGDSP-SEQ ID NO: 16) or Gly-Arg-Ala-Asp-Ser-Pro (GRADSP-SEQ ID NO. 17) peptides (Sigma-Aldrich, SCP0157, SCP0156) for 6 hours. The cells were washed twice with PBS and treated with Y201 100K EVs at 20X. Proliferation rates were monitored for 72 hours using a LiveCyte microscope.

[0402] Scratch assay

[0403] MSC#2 cells were cultured at 30,000 cells / cm 2 Density was seeded in 24-well plates and allowed to adhere for 6-8 hours. The cells were washed with PBS and serum starved overnight. In order to simulate wounds, 10 μl pipette tips were used to scratch the confluent cell monolayer and washed with PBS to remove dead cells and debris. MSC#2 cells were treated with 10X Y201 100K EV and wound closure was monitored for 24 hours using LiveCyte microscope using quantitative stacking phase imaging technology. Images were analyzed using Phasefocus software v3.5, single cell analysis was performed using the MTrackJ plug-in in ImageJ, and the measured values were imported into the chemotaxis tool to calculate cell speed, total track length, Euclidean distance, directness, and forward migration index.

[0404] Cartilage formation

[0405] Primary MSCs were isolated from femoral heads donated by three osteoarthritis patients after ethical approval (LREC 07 / Q1105 / 9). 2.35 x 10 5 MSCs were exposed to 6 Afterwards, cells were plated in EVs of Y201 MSCs for 6 h. Afterwards, cells were plated in 100 μl of growth medium in a microcentrifuge tube by centrifugation at 300 g for 5 min and then incubated overnight at 37 °C to a density of 2.35 x 10 5 A trace amount of cells / pellet was used.

[0406] The pellet was isolated and initially filled to 1.2 ml with growth medium, taking care not to disrupt the pellet. Negative controls received basal medium consisting of DMEM with sodium pyruvate and L-glutamine, supplemented with 1% ITS+3, 40 μg / ml L-proline, and 1% non-essential amino acids. Chondrogenic medium consisted of basal medium plus 0.1 μM dexamethasone, 50 μg / ml L-ascorbic acid, and 10 ng / ml TGF-β1.

[0407] The tubes were incubated at 37°C and the medium was changed every 3-4 days. 6 EVs of Y201 MSCs were treated once. The pellets were removed on days 0, 7, 14, and 21 and rinsed twice with 1 ml of PBS, then fixed with cold paraformaldehyde for 10 minutes. The pellets were washed twice with PBS and embedded in paraffin using a Leica tissue processor in a small biopsy procedure within 48 hours of fixation. The pellets were then cut into sections of 5 μm thickness. The paraffin-embedded sections were clarified and rehydrated (rehydrated), then stained with 0.02% Fast Green (Fast Green) for 5 minutes and then stained with 0.1% Safranin O for 15 minutes. After staining, the sections were dehydrated and mounted with DPX mounting medium (mounting medium) and then imaged at 20X resolution using Z-stack imaging on an Axio Scan.Z1 slide scanner.

[0408] T cell activation assay

[0409] MSC-derived EV immunomodulation for inactivation and inhibition of T cell proliferation

[0410] 1.0x 10 5 Primary human peripheral blood-derived CD4+ T cells (Stem Cell Technologies) were cultured in suspension with 2.0 x 10 cells collected during 24 h of culture. 6 EVs isolated from serum-free conditioned medium of Y201 MSCs were pretreated for 6 h. For the positive control, 1.0 x 10 4 Y201 MSCs were seeded into 96-well U-bottom plates and cultured at 37°C, 5% CO2 for 24 hours before the addition of T cells.

[0411] The sustained proliferation capacity was assessed by measuring T cell proliferation. CD4+ T cells were stained with 1 μM VPD450 Violet proliferation dye (eBioscience, Inc.) at 37°C for 10 minutes. T cells were activated using anti-CD3ε / CD28 Dynabeads (ThermoFisher) at a 1:1 bead to cell ratio and then incubated at 1.0×10 5 T cells were seeded at a density of 1.0 x 10 cells / well (ratio 10:1) in 200 μl RPMI-1640 containing 10% FBS, 0.05 μg / mL IL-2 (Peprotech, Inc). 4 T cells on Y201 MSCs were used as negative and positive controls, respectively, and all conditions were tested with and without activation. Plates were incubated at 37°C for 6 days, after which Dynabeads were removed using DynaMag-2 according to the manufacturer's recommendations. T cell proliferation was assessed using flow cytometry, with the reduction in peak signal intensity visualized using FCS Express 7.0 proliferation assay. Proliferation was assessed by VPD450 dilution (diminished staining intensity) and described by the proliferation index (PI) calculated from the fluorescence intensity of each cell division, as previously described (Kay et al., 2022). Proliferation cycles were calculated based on the 50% reduction in peak fluorescence intensity, based on the fluorescence intensity of the first and final divisions detected.

[0412] MSC immunomodulation guides effector T cell polarization

[0413] To assess T helper cell differentiation, T cells were activated and cultured with MSC-derived EVs or MSC monolayers as described above. The following reagents and antibodies for reactivation, trafficking inhibition, and staining were from eBioscience. After 6 days of culture, T cells were restimulated using a combination of phorbol 12-myristate 13-acetate (PMA) (50 ng / ml) (Sigma Aldrich) and ionomycin (1 μg / ml) (Invitrogen), and intracellular cytokines were retained using a trafficking inhibitor cocktail containing 10 μg / ml brefeldin A and 2 μM monensin (Invitrogen). T cells were cultured at 37°C for 4 hours and then stained for the surface marker CD4. Intracellular staining of CD4+ helper T cells was performed against anti-human IFN-γ (Th1), IL-4 (Th2), or IL17a (Th17), or CD4 and CD25, followed by fixation / permeabilization and staining for the nuclear protein FOXP3 for regulatory T cells. All cells were measured using a Cytoflex LX flow cytometer and analyzed with FCS Express 7. The percentage of T helper cell differentiation within the CD4+ cell population and the signal intensity (median) for each antibody tested were compared.

[0414] In vivo evaluation of the immunomodulatory capacity of Y201 MSCs in a mouse peritonitis model

[0415] An in vivo peritonitis model was used in 8-10 week old C57BL / 6J mice using zymosan and schistosome egg stimulants to induce inflammation. These experiments were performed under the Animals and Scientific Procedures Act 1986 under a UK Home Office license (Project License No. PPL PFB579996, approved by the Animal Welfare and Ethical Review Committee of the University of York). On day 0, mice were intraperitoneally infused with 1 mg of zymosan A (Merck) or 5000 schistosome eggs in 200 μl PBS. Immediately after administration of the stimulant, test conditioned mice were intraperitoneally infused with EVs isolated from serum-free conditioned medium that had been conditioned for 24 hours from 4.0x10 7 Y201MSCs were collected from 100 μl of PBS to treat zymosan-induced inflammation, or 2.0 x 10 7 The negative control mice were given PBS medium only.

[0416] After 24 hours, mice were euthanized using an overdose of CO and cervical dislocation. 4 ml of ice-cold RPMI-1640 was injected intraperitoneally for peritoneal lavage. The process was repeated with a second 4 ml RPMI-1640 wash, and the wash solution was pooled to form peritoneal exudate cells (PEC). For each animal tested, erythrocytes were lysed from PEC using erythrocyte lysis buffer (Merck) and cell counting was performed. Ly6C (APC), Ly6G (FITC), F4 / 80 (PE-Cy7) CD45 (PerCP-Cy5.5) (BioLegend) and Ly6G (FITC), CD11b (BUV395) and SiglecF (BV421) (BD) staining were initially performed on PEC samples. PEC samples were then stained for TCRb (AF488), CD3 (APC-Cy7), CD4 (PerCP-Cy5.5), CD62L (APC), and CD44 (PE) (BioLegend). For all assays, Zombie Aqua (BioLegend) was used to exclude dead cells.

[0417] Statistical analysis

[0418] Statistical analysis of all experiments was performed using GraphPad Prism v9.0.2. Statistical significance between treatments and controls (DMEM) was assessed by T-test and two-way ANOVA with Bonferroni correction. n = 3, error bars are SEM, and asterisks represent the following P values: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0419] Fibroblast growth factor receptor 3 (FGFR3) knockout cells

[0420] Generation of FGFR3 cell lines using CRISPR / Cas9

[0421] Single guide RNA (sgRNA) constructs were designed using the CRISPR design tool (crispr.mit.edu). Potential sequences were ranked based on specificity and off-target effects, and the sequence with the least off-target effects was selected. The selected sgRNA sequences were as follows: (5'-3')

[0422] sgRNA forward: CACCGCATCCGGCAGACGTACACGC (SEQ ID NO: 1)

[0423] sgRNA reverse: AAACGCGTGTACGTCTGCCGGATGC (SEQ ID NO: 2)

[0424] Single-stranded oligonucleotides (ssODNs) are designed to introduce specific base mutations into the FGFR3 sequence via homologous recombination. The ssODNs are designed so that the double-strand break introduced by Cas9 is within 100 base pairs of the mutation, and to prevent the Cas9 enzyme from targeting the ssODN, the antisense strand of the desired sequence is used. The ssODN sequence is as follows: (5'-3')

[0425] ssODN:

[0426]

[0427] All primers were ordered from Integrated DNA Technologies and purified by desalting.

[0428] Y201 hTERT MSCs were electroporated using previously optimized parameters and single colonies were isolated using serial dilutions as described elsewhere herein. Throughout the results, Y201 hTERT MSCs were used as a WT control for comparison with CRISPR / Cas9-treated cells, which are referred to herein as WT hTERT MSCs.

[0429] CRISPR / Cas9 on-target and off-target sequencing

[0430] PCR amplification was performed as described elsewhere herein, and the products were sent for Sanger sequencing using a unique forward primer at a concentration of 3.2 μM. The primers used for amplification and sequencing are shown in Table 1.

[0431]

[0432]

[0433] Table 1: Primers used in on-target and off-target sequencing

[0434] Population Doubling Time calculation

[0435] Population doubling time was determined by seeding equal numbers of WT and FGFR3-KO MSCs in T25 flasks and counting the cells daily for 4 consecutive days. Cells were counted using a Countess II automated cell counter (Invitrogen) using trypan blue cell exclusion dye to exclude dead cells. Doubling time was calculated using the following formula: t*log(Nf / Ni)

[0436] Where t is the time between counts in days, Nf is the final number of cells counted, and Ni is the initial number of cells.

[0437] For cumulative population doublings, cells were counted throughout the 50 days of continuous culture, and the number of population doublings between each count was calculated using the following formula: log(Nf / Ni)

[0438] Where Nf is the final cell number counted and Ni is the initial cell number seeded. After each count, WT and FGFR3-KO MSCs were reseeded with 500,000 cells.

[0439] Morphological analysis

[0440] Cell seeding and treatment

[0441] WT and FGFR3-KO cells were plated at 4000 cells / cm 2 Cells were seeded at a density of 100 μg / ml in 24-well plates and allowed to adhere overnight before being washed with PBS and stained with crystal violet.

[0442] Phalloidin staining of the actin cytoskeleton

[0443] WT and FGFR3-KO cells were plated at 4000 cells / cm 2 Cells were seeded onto 10 mm round glass coverslips in 24-well plates and allowed to adhere overnight. The coverslips were washed with PBS and fixed with 4% paraformaldehyde for 20 minutes at 37°C and 5% CO2. The cells were washed again with PBS and treated with Alexa Fluor 594 phalloidin (Invitrogen) diluted 1:1000 in PBS for 1 hour at room temperature in the dark. The cells were washed three times with PBS and then counterstained with DAPI for 5 minutes and then washed three more times with PBS. The coverslips were mounted onto slides using Vectashield mounting medium (Vector Laboratories) and sealed with nail polish, and then imaged the next day using a Zeiss 710LSM confocal microscope.

[0444] Anti-Arp3 immunofluorescence

[0445] Cells were plated and fixed as described elsewhere herein, then permeabilized with 0.1% Triton X-100 for 30 minutes and washed three times with PBS. Cells were blocked with 1% bovine serum albumin for 1 hour, and then anti-Arp3 (Sigma) was applied at a 1:200 dilution in 1% BSA for 2 hours at room temperature. Cells were washed with PBS. Goat anti-mouse Alexa Fluor 647 conjugated secondary antibody (Thermofisher) was applied at a 1:200 dilution in PBS for 1 hour in the dark at room temperature, while Alexa Fluor 594 phalloidin was applied at a 1:1000 dilution in PBS. Cells were washed in PBS, counterstained with DAPI, mounted, and imaged as described elsewhere herein.

[0446] Characterization of extracellular vesicles (EVs)

[0447] Conditioned media collection and EV isolation

[0448] FBS-EV-depleted medium was generated by centrifuging DMEM containing 20% FBS and 1% P / S at 100,000 g for 18 hours at 4°C in a Beckman Coulter Optima L-100XP ultracentrifuge using a Ty45i rotor. This FBS-EV-depleted medium was then diluted with serum-free medium containing 1% P / S to a final concentration of 10% FBS.

[0449] WT and FGFR3-KO cells were seeded in FBS-EV-depleted medium at 500,000 and 400,000 cells / T175 flask, respectively, and cultured until a confluence of approximately 90% was reached. The cells were washed three times with PBS and the FBS-EV-depleted medium was replaced with serum-free medium. After 24 hours, the medium was collected, fresh serum-free medium was added, and the conditioned medium (CM) was collected again after 24 hours. The conditioned medium (CM) was stored at -70°C.

[0450] CM was centrifuged at 300g for 5 minutes to remove cells and debris. The supernatant was used for CM treatment or for isolating EVs. For EV isolation, the culture medium was centrifuged at 2000g for 20 minutes, the supernatant was transferred to a Ty45i tube, and the pellet was resuspended in PBS. The resuspended pellet was transferred to a protein low binding tube and centrifuged again at 2000g for 20 minutes. The supernatant was discarded and the pellet was the separated 2k fraction. The transferred supernatant from the first 2000g spin (centrifugation) was centrifuged at 10,000g for 45 minutes, and the new supernatant was transferred to a fresh Ty45i tube. The pellet was resuspended and transferred to a micro ultracentrifuge tube and centrifuged at 10,000g for 45 minutes in a TLA 100.3 rotor to separate the 10k fraction. The transfer supernatant from the first 10,000 g spin was centrifuged at 100,000 g for 90 minutes, and the supernatant was retained (used as EV-negative medium). The pellet was resuspended, transferred to a micro-ultracentrifuge tube, and centrifuged again at 100,000 g for 90 minutes to separate the 100k fraction. All pellets were fully resuspended in particle-free PBS, and all centrifugations were performed at 4 ° C.

[0451] Nanoparticle tracking analysis

[0452] Nanoparticle tracking analysis (NTA) was performed using Nanosight NTA software 3.4 Build 3.4.003 (Malvern Panalytical). Images were captured using a sCMOS camera and a 532 nm laser wavelength.

[0453] Transmission electron microscopy

[0454] EV isolation was performed as described elsewhere in this article, but instead of resuspending the final pellet in PBS, the pellet was resuspended in 2% PFA and stored at 4°C overnight. EVs were then placed on glow-discharged polyvinyl acetate / carbon-coated grids for 20 minutes and fixed with 1% glutaraldehyde for 5 minutes. The grids were washed eight times with PBS and then incubated with 2% uranyl acetate for 5 minutes in the dark. The methylcellulose was centrifuged at 100,000g for 95 minutes, and the grids were then incubated with methylcellulose-uranyl acetate on ice for 10 minutes. Excess liquid was blotted onto filter paper, and the samples were allowed to dry before imaging.

[0455] Migration assay

[0456] Scratch wound assay

[0457] WT and FGFR3-KO MSCs were plated at 42,500 cells / cm 2Cells were seeded in 48-well plates and allowed to adhere overnight. The wells were checked for confluence and even distribution of cells, then washed with PBS and the medium was replaced. A scratch was created using a 200 μl pipette tip, ensuring even, consistent pressure was applied to the wells, followed by washing with PBS and replacement of the medium with fresh medium. Cells were imaged 0 and 24 hours after the scratch, and the plates were marked to ensure the same field of view was captured. The resulting images were overlaid to mark the initial size of the wound on each image in each field of view. The initial and final wound areas were then quantified using ImageJ, and the percentage of healing was calculated.

[0458] Laminography analysis

[0459] Cells were seeded into Ibidi Culture-Insert Plates according to the manufacturer's instructions and allowed to adhere overnight. The inserts were then removed, creating a space in the center of each well for the cells to migrate into. The plates were stored at 37°C and 5% CO2 and imaged for 24 hours using a Livecyte microscope (Phasefocus). Images were captured every 5 minutes and analyzed using Cell Analysis Toolbox (CAT) software (Phasefocus). This software uses an advanced fuzzy thresholding algorithm to segment cells and track individual cell metrics.

[0460] Secretome-treated scratches

[0461] Cells were seeded and streaked as described elsewhere herein. Treatments were performed immediately after streaking. Control wells were treated with DMEM supplemented with 1% P / S and (where specified) 10% FBS. CM, EV, and EV-ve culture media were collected as described elsewhere herein. The 1x EV treatment dose was calculated using the following formula:

[0462]

[0463] where Ni is the number of cells from which EVs were isolated, and N t is the number of cells treated, and v is the volume in which EVs were resuspended. Single cell measurements were collected using LiveCyte microscopy, with images captured every 30 minutes for 24 hours and analyzed using CAT software. Subsequent CM-treated scratches were analyzed in ImageJ.

[0464] RNA-seq analysis

[0465] RNA isolation, cDNA library preparation, and sequencing

[0466] Y201 and FGFR3 KO MSCs were centrifuged at 400 g for 5 minutes to isolate total RNA for transcriptome analysis and then resuspended in 350 μL RA1 lysis buffer (Nucleospin RNA II kit) and 3.5 μL β-mercaptoethanol. After lysis, RNA was extracted using Nucleospin RNA II columns (Macherey-Nagel, Germany) according to the manufacturer's instructions. In brief, the lysate was first clarified by passing it through the column and then adjusted to obtain optimal RNA binding by mixing it with 350 μL 70% ethanol. The RNA was then bound to the column and desalted using membrane desalting buffer. The column was then treated with DNAse I for 15 minutes and washed and dried to remove the buffer present. The RNA was then eluted into 30 μL RNAse-free H2O and quantified by spectroscopy using Nanodrop. RNA quality was assessed using an Agilent 2100 bioanalyzer. The mRNA is then captured using Oligo-dT beads, which bind to the unique poly-A tail on the mRNA, thereby removing other RNA species (such as ribosomal RNA) that may contaminate the sample. The mRNA is then fragmented and these fragments are used as templates for cDNA synthesis, which are then ligated to aptamers. The library is then amplified and sequenced using a HiSeq 2500 sequencer.

[0467] Read count (read length, read) mapping

[0468] Reads were mapped using the STAR splice-aware read mapper (https: / / github.com / alexdobin / STAR) with the following options: "--outSAMstrandFieldintronMotif", "--outFilterType BySJout", "--outFilterIntronMotifsRemoveNoncanonical", and "--outSAMtype BAM SortedByCoordinate". Reads were mapped to the pre-calculated index GRCh38 Gencode 24 version of the human genome provided by the STAR authors.

[0469] Quantification and differential expression analysis

[0470] Cufflinks (http: / / cole-trapnell-lab.github.io / cufflinks / ) was used to quantify the number of mapped reads and perform differential expression analysis. The associated GTF annotation files from Gencode version 24 were compiled with the "-g" option, and cDNA fasta sequences were compiled with the "-b" option. The GTF files generated by Cufflinks were merged with Cuffmerge and used for differential expression analysis with Cuffdiff.

[0471] RNA-seq analysis

[0472] RNA-seq data generated a list of differentially expressed transcripts between WT and FGFR3-KO MSCs, defined as those transcripts with log2 fold change>±1 and adjusted p-value<0.05. Transcripts were then divided into two gene lists, corresponding to: up- or down-regulation in FGFR3-KO compared to WT, and transcripts with <5 FPKM reads in both cell lines were excluded. GO term analysis was performed in STRING (Szklarczyk et al., 2019), and KEGG pathway analysis was performed using Enrichr (Chen et al., 2013) and KEGG mapper (Kanehisa and Sato, 2020). Data were exported and graphed using ggplot2 (Wickham, 2016) in RStudio (RStudio Team, 2020).

[0473] Alamar blue cell viability assay

[0474] WT and FGFR3-KO cells were seeded in 96-well plates, one plate at each time point, and allowed to adhere overnight. Alamar blue cell viability agent (Invitrogen) was then added to the day 0 plate at a final concentration of 10% in fresh culture medium. After 4 hours, fluorescence was measured using a Clariostar plate reader. For all experiments, treatment was applied on day 0 and Alamar blue readings were taken at the same time every day for the next 3 days. For preliminary comparison of WT and FGFR3-KO, cells were plated at 9375 cells / cm 2 For all subsequent experiments, cells were plated at 7812 cells / cm 2 The plates were plated to ensure that cells did not reach full confluence before the end of the time course. On day 2, Alamar Blue plates were used for morphological analysis of CM-treated and U0126-treated MSCs. After obtaining fluorescence readings, the plates were washed with PBS and stained with crystal violet. All results were normalized to the fluorescence of the control treatment at day 0 and reported as relative fluorescence.

[0475] Additional Methods

[0476] Y201 EV proteome gene ontology term enrichment and clustering

[0477] Gene Ontology (GO) enrichment was performed using the ClueGO plugin of the Cytoscape software package (Bindea et al., 2009; Shannon et al., 2003). Gene list enrichment was assessed for biological process and molecular function GO gene sets using Benjamini-Hochberg false discovery rate (FDR)-corrected p-values. Before automatically clustering important GO terms, the redundancy of GO terms was reduced (FDR-corrected p < 0.05) by using the GO-fusion setting in ClueGO. Cluster plots were generated from the ClueGO results using the AutoAnnotate plugin to facilitate organization and labeling of similar terms, and titles were generated for clusters based on common words (Kucera et al., 2016). Clusters were moved to aid visualization.

[0478] CFSE-EV labeling

[0479] EVs were isolated by differential ultracentrifugation and labeled with carboxyfluorescein diacetate succinimidyl ester (CFSE) (Invitrogen, catalog number: C34554). EVs were incubated with 20 μM CFSE in a final volume of 300 μl PBS at 37°C for 120 minutes. Labeled EVs were pooled by ultracentrifugation at 100,000 x g for 90 minutes and resuspended in PBS to remove unbound CFSE dye. Labeled EVs were transferred to Protein LoBind Eppendorf tubes for storage.

[0480] Analysis of EV uptake by flow cytometry

[0481] MSC#2 cells were detached from the plastic using 0.05% trypsin-EDTA and resuspended in pre-primed DMEM in a 37°C, 5% CO2 incubator. Cells were counted using an automated cell counter and transferred to LoBind protein tubes at 100,000 cells / tube. MSC#2 cells were treated with 10X concentrations of Y201CFSE-EVs and unlabeled EVs for 1, 2, 4, 6, 8, and 10 hours, respectively.

[0482] To determine whether EV uptake is RGD-dependent, cells were treated with 200 μM Gly-Arg-Gly-Asp-Ser-Pro (GRGDSP-SEQ ID NO: 16) or Gly-Arg-Ala-Asp-Ser-Pro (GRADSP-SEQ ID NO: 17) peptides (Sigma-Aldrich, SCP0157, SCP0156) for 6 hours, then pelleted to remove the peptides and resuspended in fresh DMEM medium. 10X concentrations of CFSE-EV and unlabeled EV were introduced into the cells for 4 hours. The cells were centrifuged at 300 g for 5 minutes at 4 ° C, pelleted, and then washed twice with ice-cold PBS to remove any EV that was not taken up. The cells were resuspended in 200 μl of flow buffer (1% FBS in PBS) and the uptake of EV by MSC#2 cells was determined by flow cytometry using LX375 CytoFlex. Gains were adjusted as follows: i) forward scatter at 20, ii) side scatter at 40, and iii) fluorescein isothiocyanate at 40 for CFSE fluorescence.

[0483] Antigen-induced arthritis (AIA) model of inflammatory arthritis

[0484] AIA was induced in male C57Bl / 6 mice (7-8 weeks) as described previously (Kehoe et al., Arthritis Res Ther 16, R148 (2014)). Swelling was assessed by measuring the difference in diameter (in mm) between the arthritic (right) and non-arthritic (left) knee joints using a digital micrometer.

[0485] One day after arthritis induction, treatments containing 15 μL of 100 μg / mL EVs suspended in PBS or a control of PBS alone were injected intra-articularly into the right knee joint via the patellar ligament. Joint diameters were measured one, two, and three days after injection. Four independent experiments were performed to assess the effects on joint swelling and histopathology.

[0486] On day 3 after arthritis induction, animals were sacrificed for histological analysis. The joints were fixed in 10% neutral buffered formalin in saline and decalcified in formic acid at 4°C for 4 days before paraffin embedding. Sections (5 μm) were stained with hematoxylin and eosin and mounted. H&E sections were scored by two independent observers who were blinded to the experimental groups to assess synovial intimal hyperplasia (0 = normal to 3 = severe), cellular exudate (0 = normal to 3 = severe) and synovial infiltration (0 = normal to 5 = severe). The scores were summed to obtain the mean arthritis index.

[0487] result

[0488] Y201 characterization

[0489] Y201 MSCs were generated by immortalization with human telomerase reverse transcriptase (hTERT) and characterized as previously described (James et al., 2015, Kay et al., 2022). In addition, the inventors observed that Y201 MSCs had a unique karyotype. All 20 cells examined contained an additional chromosome 8 and a chromosomal translocation (Q21 band) between the long arm of chromosome 1 and the short arm of chromosome 13. Figure 1 Y201 cells are usually elongated and migratory ( Figure 2 ), and the inventors have demonstrated that the entire secretome produced by Y201 MSCs, including their constitutive extracellular matrix (ECM) components, can alter the morphology and migratory behavior of the comparator MSC subline MSC#2, causing it to exhibit behavioral characteristics of Y201 MSCs ( Figure 3 and 4 These findings suggest that factors secreted by Y201 cells can induce functional changes in other cell types that may have therapeutic applications, such as increased migration and tissue regeneration. Overall, the secretome positively impacted the comparator MSC line, inducing functional changes in the comparator MSC line that resulted in the cells becoming more similar to stem-like MSCs in terms of morphology and migratory behavior. Most MSCs found in situ do not possess stem-like properties; therefore, administering the secretome to the wound site could stimulate proliferation by reprogramming resident MSCs to exhibit stem-like behavior.

[0490] EV characterization

[0491] Size, morphology, protein and microRNA cargo

[0492] EVs were initially isolated using differential ultracentrifugation, which separates different EV subpopulations based on their density. Serum-free medium was conditioned with Y201 cells and centrifuged at different speeds (10,000 g and 100,000 g) to generate two fractions, designated 10k and 100k, respectively.

[0493] Nanoparticle tracking analysis (NTA) was used to characterize the yield and size distribution of EVs, transmission electron microscopy (TEM) and image analysis were used to characterize the morphology of EVs, and Western blotting was used to characterize EV-specific markers. The present inventors observed peak EV sizes of 100 nm, 112 nm, 141 nm, and 211 nm in the Y201 10K fraction. The Y201 100k fraction showed reproducible peak mean diameters of 104 nm and 112 nm, with typical morphology observed by TEM. The EV yield for the Y201 10k and 100k fractions was approximately 2.5 x 10 8 and 4.5x 10 9 EV / million cells. Y201 EVs were positive for the specific markers Alix, raftin-1, CD81, and CD63 in the 100k fraction and negative for the endosomal marker BiP ( Figure 5 No EV markers were detected in the 10k fraction, and its size was also more variable based on NTA data, so future work will focus on the 100k EV fraction.

[0494] The inventors performed a complete proteomic and microRNA screen of the EV cargo from the Y201 100k EV fraction and performed subsequent bioinformatics analysis (Tables 2, 3, and 4).

[0495]

[0496]

[0497] Table 2. Top 200 identified proteins in Y201 conditioned media. Conditioned media were analyzed by LC-MS and searched against the human subset of the UniProt database. Abundance was quantified using relative peak areas of non-conflicting peptides and Progenesis QI.

[0498]

[0499]

[0500] Table 3. Top 200 identified proteins in Y201 EVs. Isolated EVs were analyzed using LC-MS and searched against the human subset of the UniProt database. Abundance was quantified using relative peak areas of non-conflicting peptides and Progenesis QI.

[0501]

[0502]

[0503]

[0504] Table 4. miRNAs identified in Y201 EVs. Y201 EV miRNA content was analyzed by NanoString array. Abundance was quantified relative to baseline readings (no probe detected).

[0505] Analysis of Y201 EV protein cargo

[0506] To further understand the nature of the enhanced Y201 EVome (EV group), GO analysis targeting biological process, molecular function, and cellular component gene sets was performed. In terms of biological process, the Y201 EVome was mainly enriched in the organization and structure of the extracellular matrix, immunomodulatory activity mediated by neutrophils, and various adhesion and migration processes ( Figure 34 A). The molecular functions of these proteins are mainly related to the binding of cadherins to various nucleic acids (including GDP, nucleoside triphosphates (nucleic triphosphates) and RNA) ( Figure 34 B). Enrichment for the cellular component gene set showed that these proteins were significantly present in focal adhesions and cell-substrate junctions to a relatively large extent ( Figure 34 C). To gain a broader understanding of the potential functions of Y201 EVs in vivo, the Y201 EVome was enriched against the GO biological process gene set in the BiNGO plugin of Cytoscape, which developed a clustering network of significantly enriched processes ( Figure 34 D) Considerable clustering was formed around similarly important processes related to the immune system, regulation of cellular processes, developmental processes, and organization of cellular components.

[0507] Considering that the most abundant Y201 EV proteins are associated with ECM organization, the inventors attempted to model the vesicle outer corona by constructing a protein-protein interaction (PPI) network in STRING ( Figure 35 A). We identified numerous PPIs between ECM components and cognate vesicle membrane integrins and tetraspanins. Fibronectin (FN1) and milk fat globule epidermal growth factor 8 (MFGE8) were among the putatively most abundant Y201 EV corona proteins, which we confirmed by Western blot analysis relative to MSC#2 EVs ( Figure 35 B).

[0508] EV bioactivity

[0509] Load delivery

[0510] Using membrane-specific fluorescent dye (CFSE)-labeled EVs and fluorescence microscopy, the inventors demonstrated that Y201 EVs were taken up by primary bone marrow MSCs, with intracellular EVs first appearing within 5 h of treatment, demonstrating the potential of EV-mediated cargo delivery ( Figure 6 A). The inventors also demonstrated that Y201EV can be loaded with the anticancer drug doxorubicin and delivered to an osteosarcoma cell line (U2OS) to inhibit proliferation (data not shown).

[0511] EV uptake by different MSC subtypes

[0512] MSC#2 cells were treated with Y201 CFSE-labeled EVs, and EV uptake was quantified using flow cytometry. A gating strategy using a Cytoflex LX375 was set up using the following parameters. An FSC vs. SSC plot was created to distinguish cells from debris in suspension. After excluding debris, individual cells were distinguished by plotting FSC-H vs. FSC-A. Cells not treated with stained EVs were used to identify cellular autofluorescence by plotting SSC vs. CFSE signal. Finally, cells treated with CFSE-EVs were used to measure successful detection of EV uptake.

[0513] The time course of EV uptake was determined by flow cytometry. Cells were treated with unlabeled or CFSE-labeled EVs for up to 10 h, and then flow cytometry was performed on live cells. MSC#2 cells exposed to CFSE-Y201 EVs showed increased fluorescence within the first 4 h, and levels remained elevated for up to 10 h ( Figure 36 A and B).

[0514] RGD integrin-mediated uptake and function of Y201 EVs

[0515] Given the evidence of enrichment of ECM-based coronae in Y201 EVs, in particular the abundance of RGD-containing proteins (FN1 and MFGE8), without wishing to be bound by theory, the inventors propose that these EV subtypes are preferentially taken up by integrin-mediated endocytosis. MSC#2 cells were used as model target cells and treated with GRGDSP (SEQ ID NO: 16) integrin blocking peptide or GRADSP (SEQ ID NO: 17) peptide control for 6 hours and then exposed to CFSE-stained Y201 EVs. Using flow cytometry, the inventors demonstrated that the RGD blocker (GRGDSP (SEQ ID NO: 16)) significantly inhibited the uptake of Y201 EVs compared to the control ( Figure 37 ).

[0516] Y201 EV's regenerative effect

[0517] EV functionality was initially tested on another MSC subline (MSC#2) using Y201 EVs. Dosage was determined by proportional EV production per cell and multiplied by factors of 1 (1X), 5 (5X), and 10 (10X), such that each cell was exposed to EVs from 1-fold, 5-fold, or 10-fold more cells. Y201 EVs significantly increased the proliferation of MSC#2 ( Figure 6 BG). In addition, Y201 EV enhanced the migration of MSC#2 ( Figure 7 ). This supports the regenerative therapy application of Y201 EV by stimulating cell proliferation and migration.

[0518] The inventors translated these findings to primary cells by treating human bone marrow MSCs from osteoarthritis patients (derived from spent bone after total joint replacement) with Y201 EVs. Compared to untreated controls, the inventors observed a dose-dependent increase in proliferation, confirming that Y201 EVs can enhance cell proliferation, even in primary cells from elderly donors. Figure 8 ).

[0519] In conditions such as juvenile idiopathic arthritis, as well as other conditions including rheumatoid arthritis or osteoarthritis, the cartilage tissue in the joints is gradually destroyed. Therefore, the inventors determined the effect of Y201 EV on the proliferation of articular chondrocytes. Chondrocytes are the only specialized cell type found in cartilage tissue and are responsible for the function and structural integrity of the cartilage. Articular chondrocytes were removed from the surface of discarded joint tissue after total joint replacement surgery. The results showed that treatment with Y201EV achieved a significant dose-dependent increase in chondrocyte proliferation and a decrease in chondrocyte doubling time ( Figure 9 ).

[0520] Proteomic EV analysis showed that MFG-E8 protein was highly enriched in Y201EV compared with MSC#2EV, which was further confirmed by Western blotting ( Figure 9 ). MFG-E8 is able to bind to phosphatidylserine-rich EVs and interact with target cells via α and through phosphatidyl integrin- and RGD-binding motifs. The inventors hypothesized that Y201-derived EVs could be taken up by cells through integrin-mediated endocytosis. AC cells were treated with the RGD-containing blocking peptide GRGDSP (SEQ ID NO.16) or the control peptide GRADSP (SEQ ID NO.17), and the effect of Y201 EVs on their proliferation rate was monitored over 72 hours. The inventors confirmed that Y201 EVs increased AC proliferation compared to untreated controls, and this effect was blocked by exposure to GRGDSP (SEQID NO.16) but not GRADSP (SEQ ID NO.17) peptide ( Figure 9 ).

[0521] The inventors investigated the effect of Y201 EV on chondrocyte differentiation using bone marrow MSCs from osteoarthritis patient donors. The inventors demonstrated that treatment with Y201 EVs enhanced chondrocyte differentiation of MSCs, as observed by Safranin O staining ( Figure 10 ). This indicates that Y201 EVs have tissue regeneration capacity.

[0522] Immunosuppressive effects of Y201 EV

[0523] The inventors further investigated the effects of Y201 EVs in an in vitro inflammatory model. The inventors demonstrated that EVs from Y201 cells modulate adaptive immune responses, such as those associated with inflammatory diseases, by inactivating CD4+ effector T cells in vitro, resulting in a decrease in the proportion of proliferating immune cells (index) and a decrease in the ability of immune cells to proliferate (cycle). In addition, Y201 EVs have the potential to counteract pro-inflammatory IFN-γ (Th1) responses by increasing IL4 (Th2) differentiation ( Figure 11 ).

[0524] The inventors have extended this work to an in vivo inflammatory model, simulating an infectious immune response. Infectious pathogens may also play a role in initiating or perpetuating the inflammatory process in autoimmune diseases. Y201 EV mitigates the pathogen response to peritoneal infection in vivo by inhibiting immune cell recruitment and reducing T cell differentiation. Figure 12 ).

[0525] Y201 was modified using CRISPR / Cas9 to target deletion of the FGFR3 gene and determine the effects on cell behavior. Characterization data for the Y201 FGFR3 KO cell line are described below.

[0526] In vivo evaluation of the potential therapeutic effects of Y201 EVs in a murine arthritis model

[0527] The inventors tested the bioactivity of Y201 EVs in a disease-relevant in vivo model of adjuvant-induced arthritis following intra-articular EV injection. After histological examination and blinded scoring, the inventors demonstrated that Y201 MSC-derived EVs induced a significant reduction in all disease activity indicators, including joint swelling, synovial infiltration, joint effusion, synovial hyperplasia, and overall arthritis index ( Figure 38 AE). Representative hematoxylin and eosin-stained sections provide evidence of synovial infiltration and proliferative changes in control and Y201 EV-treated samples ( Figure 38 FI).

[0528] Clonogenic and proliferation abilities of wild-type (WT) Y201 versus FGFR3 knockout (KO) cells

[0529] Both WT and FGFR3-KO MSCs were able to form colonies, and there was no significant difference in their colony formation efficiency ( Figure 13 A, p = 0.9665), indicating similar adhesion and survival rates among MSC lines. There was no significant difference in mean colony surface area ( Figure 13 B, p = 0.6760), indicating that FGFR3-KO has equivalent clonogenic capacity to WT MSCs. Thus, the total surface area covered by colonies of the two cell lines is similar ( Figure 13 C, p = 0.5940). However, within individual colonies, there were significant differences in cell density. FGFR3-KO colonies were near or confluent, while WT colonies were composed of sparsely distributed cells. This was demonstrated by the darker, more pronounced color of crystal violet staining in FGFR3-KO colonies, but was particularly evident when imaging at the individual colony level ( Figure 14 ).

[0530] The proliferation rates of the cell lines were compared. Equal numbers of WT and FGFR3-KO cells were seeded and an Alamar Blue cell viability reagent was used to give an indication of the number of cells within 3 days. Fluorescence readings were taken every day, with increases in fluorescence indicating an increase in cell number and, thus, proliferation. FGFR3-KO showed an increase in fluorescence from day 1, although this was not significant. On days 2 and 3, FGFR3-KO showed a significant increase in fluorescence compared to WT cells ( Figure 15 ).

[0531] Cell counts were also used as a measure of population growth. This allowed the population doubling time of each cell line to be determined. Within 24 hours after inoculation, FGFR3-KO showed a 75% increase in cell number, compared to an 18% increase in WT cell number, indicating that FGFR3-KO began to proliferate earlier after inoculation. At each time point, FGFR3-KO MSCs showed a greater increase in cell number than WT MSCs. After four days, FGFR3-KO had a significantly higher cell number than WT cells ( Figure 15 During the fastest growth phase, the average population doubling time for FGFR3-KO cells was 18.6 hours, compared to 25.0 hours for WT cells. Cumulative population doublings and cell numbers were also counted during long-term culture to show that FGFR3-KO MSCs maintained this increased proliferation rate over time ( Figure 16 At each time point, FGFR3-KO cells underwent more population doublings than WT cells, further supporting an increased proliferation rate of FGFR3-KO cells.

[0532] Morphological changes of FGFR3-KO versus WT MSCs

[0533] As noted in the CFU-F assay, FGFR3-KO cells appeared to have a different morphology than WT cells. However, these cells were at different density levels, with FGFR3-KO cells near confluence and WT cells more sparsely distributed. For comparative morphological analysis, cells were plated at 4000 cells / cm 2 of equal density, stained with crystal violet, and then imaged ( Figure 17 A, B). Cell shape metrics were then calculated using CellProfiler. Although cell volume did not change between lines, FGFR3-KO MSCs showed a significantly reduced cell area ( Figure 17 C). This may indicate that WT cells have a lower sphericity index, so they cover a larger area by being more flat against the growth surface. However, a much wider range of cells was observed in FGFR3-KO, with a large number of large scattered cells that appeared to have broad lamellipodia. FGFR3-KO showed a reduced aspect ratio and an increased roundness index ( Figure 17 D, E). A higher aspect ratio is seen in WT cells, showing a typical elongated fibroblast morphology.

[0534] RNA sequencing of WT versus FGFR3-KO MSCs

[0535] RNA-seq analysis was bioinformatically interrogated. A total of 641 transcripts were significantly differentially expressed between WT and FGFR3-KO MSCs, of which 274 transcripts were upregulated and 367 transcripts were downregulated in FGFR3-KO (Tables 5 and 6).

[0536]

[0537]

[0538] Table 5. Top 200 RNA transcripts upregulated in FGFR3 KO MSCs. RNA-seq data generated a list of differentially expressed transcripts between WT and FGFR3-KO MSCs, defined as transcripts with a log2 fold change >1 and an adjusted p-value <0.05. Transcripts were then divided into two gene lists corresponding to upregulation or downregulation in FGFR3-KO versus WT, and transcripts with <5 FPKM reads in both cell lines were excluded.

[0539]

[0540]

[0541]

[0542] Table 6. Top 200 RNA transcripts downregulated in FGFR3 KO MSCs. RNA-seq data generated a list of differentially expressed transcripts between WT and FGFR3-KO MSCs, defined as transcripts with a log2 fold change <-1 and an adjusted p-value <0.05. Transcripts were then divided into two gene lists corresponding to upregulation or downregulation in FGFR3-KO versus WT, and transcripts with <5 FPKM reads in both cell lines were excluded.

[0543] Gene ontology (GO) and KEGG pathway analysis were performed on the differentially expressed transcripts to explore whether genes involved in specific pathways or cell behaviors were enriched. A clear result from the KEGG analysis was that the gene expression changes in FGFR3-KO overlapped with genes altered in cancers including lung cancer and bladder cancer ( Figure 18 A). Consistent with this, and consistent with the increased proliferation rate observed in FGFR3-KO, the GO term 'regulation of cell population proliferation' was highly significantly enriched. Of the 641 genes differentially expressed in FGFR3-KO, 103 belonged to this GO term, suggesting that a large number of pathways regulating cell cycle and proliferation were affected by FGFR3 loss. In addition, transcripts encoding proteins involved in inflammation were significantly upregulated in FGFR3-KO. The most significant KEGG enrichment among the upregulated genes was 'complement and coagulation cascades' ( Figure 18 B) As expected, signaling pathways known to be downstream of FGFR3, such as the PI3K pathway, were also severely disrupted.

[0544] GO term analysis of cellular components showed that actin cytoskeleton was significantly enriched ( Figure 19 A), indicating that a large number of transcripts encoding cytoskeletal proteins have altered expression in FGFR3-KO MSCs. This is consistent with the altered morphology of FGFR3-KO MSCs and may be due to changes in cytoskeletal protein expression. Transcripts encoding extracellularly expressed proteins are also significantly enriched ( Figure 19 B). Finally, GO term biological process analysis showed enrichment of processes primarily related to migration and tissue morphogenesis, as well as the broader “developmental process” ( Figure 20 ).

[0545] Many proteoglycan binding genes were differentially expressed, with 'proteoglycan binding' being the eighth most enriched molecular function GO term among the downregulated genes in FGFR3-KO ( Figure 21 ).

[0546] Phalloidin staining of the actin cytoskeleton

[0547] Due to the morphological changes in FGFR3-KO and the enrichment of actin cytoskeleton genes, fluorescent staining of the actin cytoskeleton was performed to image the cells in more detail. Actin fibers in WT cells were arranged in a striped pattern, with stress fibers extending from the leading edge to the tail, and some branching fibers at the leading edge ( Figure 22 In FGFR3-KO, stress fibers appear as thicker bundles, particularly at the dorsal edge behind the lamina ( Figure 22 C, D). In addition, FGFR3-KO cells have a nearly round shape with prominent broad transverse arcs and lamellipodia.

[0548] Fluorescence images were also used to quantify cell shape metrics because the distinct contrast of the actin cytoskeleton against the background and high magnification allowed for more precise measurement of individual cells. WT MSCs had a significantly increased aspect ratio and a significantly decreased circularity index ( Figure 23 ).

[0549] Arp3 immunofluorescence

[0550] Due to its role in generating branched actin filaments, Arp3 protein is typically enriched in lamellipodia. Therefore, we hypothesized that FGFR3-KO MSCs might display stronger localization or increased levels of Arp3 protein, thereby allowing the formation of broad lamellipodia. However, there was extensive staining of Arp3 in FGFR3-KO MSCs, which may contribute to the overall rounded shape of the cells, and no obvious enrichment of lamellipodia ( Figure 24 WT cells showed fewer and more densely packed Arp3 staining puncta, many of which colocalized with actin.

[0551] Increased scratch wound healing ability

[0552] Since the migration genes differentially expressed in FGFR3-KO were enriched in RNA-seq analysis, their migration capacity was compared with that of WT MSCs. WT and FGFR3-KO cells were seeded into well plates and scratches were created with a pipette tip. Images were taken at 0 and 24 hours, and scratch closure was calculated as the percentage of the original wound size covered by cells. FGFR3-KO had significantly increased closure relative to WT MSCs, indicating increased migration capacity ( Figure 25 ).

[0553] Single cell migration indicators

[0554] FGFR3-KO and WT MSCs were seeded in cell culture plates using removable inserts to create space that enabled analysis of migration without creating wounds in the cells. Cells were allowed to migrate for 24 hours, and single cell migration metrics were collected throughout the time course.

[0555] Although at the single cell level, FGFR3-KO had reduced track length and speed during migration, they covered a larger area at the end of the time course ( Figure 26 AC). In addition, FGFR3-KO MSCs showed less cell division over the time course, suggesting that increased proliferation was not responsible for wound healing ( Figure 26 D). However, despite generally having a smaller cell area than WT cells, FGFR3-KO cells displayed a significantly larger cell area during migration, as well as significantly reduced sphericity ( Figure 26 E, F). This suggests that FGFR3-KO cells flatten themselves out and spread out more during migration than WT cells, which helps them cover a larger surface area. In addition, FGFR3-KO cells showed a higher average directness, meaning they meandered less during migration than WT cells, although this increase was not statistically significant ( Figure 26 G).

[0556] Image tracking of each well showed that WT MSCs underwent collective cell migration, in which the leader cell protruded into the gap and the other cells followed. This created a clear arc, maintaining cell:cell interactions ( Figure 26 H). In contrast, FGFR3-KO cells appear to migrate independently of each other, rather than following the leader cells and thus influx into space ( Figure 26 I). This ability to move unhindered and independently of other cells may influence the direction of migration and may contribute to increased gap closure.

[0557] Characterization and functional analysis of the FGFR3-KO MSC secretome

[0558] Characterization of extracellular vesicle size, yield, and morphology

[0559] Nanoparticle tracking analysis

[0560] Nanoparticle tracking analysis (NTA) was performed to assess the size and number of EVs secreted by WT and FGFR3-KO MSCs. EVs were separated by differential centrifugation to obtain fractions designated as 2k, 10k, and 100k, with each fraction collected at increasing centrifugation speeds. In the 2k fraction, FGFR3-KO EVs had a wider size distribution than WT EVs, and the diameters tended to be larger ( Figure 27A). WT 2kEVs have a primary population with a diameter of 119 nm, while FGFR3-KO have a broader primary population ranging between 127 and 150 nm. EV yields per million cells were 1.23 x 10 for WT and FGFR3-KO MSCs, respectively. 8 and 3.10x10 8 Thus, FGFR3-KO showed a 2.52-fold increase in EV secretion in its 2k fraction. In the 10k fraction, both lines showed a peak at 101 nm, and WT MSCs showed a second peak at 147 nm, and FGFR3-KO showed a second peak at 141 nm ( Figure 27 B). Again, FGFR3-KO cells produced significantly more WT MSCs. WT MSCs secreted 2.98x10 8 EV / million cells, and FGFR3-KO secreted 9.29x10 8 EV / million cells, which means that the secretion of FGFR3-KO increased by 3.12 times. For the 100k fraction, a significant increase in EV size was again observed. The modal population of WT EVs was at 105.7nm, compared to the modal population of FGFR3-KO EVs at 128nm ( Figure 27 C). Interestingly, a small peak was observed at 72 nm in the WT 100k fraction. EVs with a diameter <100 nm are generally classified as exosomes, although this is much debated in the literature. By this definition, 14% of the WT 100k fraction could be classified as exosomes, compared to less than 1% in the FGFR3-KO fraction. Again, this supports a shift towards secretion of larger EVs due to FGFR3 depletion. Per million cells, the 100k fraction contained 1.70 x 10 9 and 4.85x10 9 EV. Thus, the yield was 2.85-fold higher in FGFR3-KO.

[0561] EV size was further investigated by TEM, showing the typical EV morphology ( Figure 28). However, some EVs remained intact, allowing their true spherical shape to be captured. FGFR3-KO EVs were much more abundant than WT EVs, which was expected given the higher yields obtained in the NTA calculations. Nevertheless, the number of WT EVs visualized by TEM was particularly low compared to FGFR3-KO EVs. The higher number of FGFR3-KO EVs per field of view allowed the heterogeneity of EV size and shape to be clearly observed. Vesicles <50 nm as well as >500 nm were observed in the FGFR3-KO 100k fraction. Fewer EVs were observed in the 10k and 2k fractions for both WT MSCs and FGFR3-KO MSCs. However, once again, WT EVs were consistently smaller than FGFR3-KO EVs. It is clear from this TEM and NTA data that FGFR3-KO EVs are larger than WT EVs, implying a novel role for FGFR3 in EV biogenesis. This could be indirect, due to alterations in morphology and the cytoskeleton, or by directly altering the secretory pathway. Next, the functional effects of EVs and the broader secretome were investigated.

[0562] Functional effects of extracellular vesicles / conditioned medium

[0563] FGFR3-KO conditioned medium increases the migration of WT cells

[0564] WT MSCs were used in a scratch wound assay and treated with FGFR3-KO derived EVs, conditioned medium (CM), or EV negative conditioned medium (EV-ve CM). Individual cell parameters were tracked for 24 hours throughout the wound healing process. CM and EV-ve CM significantly increased scratch wound closure relative to untreated controls ( Figure 29 A). EV at 1x, 5x, or 10x doses had no effect on closure. None of the treatments significantly affected track length relative to control, but track length was significantly reduced in 1x and 10x EV treatments compared to EV-ve CM ( Figure 29 B). The directness index varied slightly in different treatments ( Figure 29 C). CM significantly increased directness, while 5x EV significantly decreased directness relative to control. This is a parameter that may contribute to the improved percentage of wound healing. In addition, CM-treated cells showed a significant decrease in thickness ( Figure 29 D) and sphericity index, meaning they lay flatter on the surface to which they adhere. In contrast, cells treated with 5x and 10x EVs showed significantly increased thickness and sphericity. This may indicate that EV uptake is associated with cells detaching from the growth surface and becoming more spherical.

[0565] Increased velocity may be the main factor contributing to the increased migration of MSCs treated with CM and EV-ve CM. Both treatments showed a significant increase in transient velocity over time, especially after 12 h ( Figure 29 E). The 5x EV dose showed a significant decrease in velocity relative to the control, whereas the 1x and 10x doses did not show a significant decrease in velocity.

[0566] These data suggest that the FGFR3-KO secretome, but not EVs, can promote MSC migration. This is due to changes in MSC morphology, velocity, and directness. Given their known regenerative properties, improved scratch wound healing may be a general feature of MSC-CMs. Therefore, it is necessary to confirm that the FGFR3-KO secretome is clearly the driving force behind these changes.

[0567] FGFR3-KO, but not WT CM, improved scratch wound healing of WT MSCs

[0568] To confirm that the FGFR3-KO secretome specifically leads to increased migration, another scratch wound assay was performed using WT CM as a control. FGFR3-KO MSCs themselves were also used as a positive control to understand whether WT MSCs treated with FGFR3-KO CM could recapitulate the wound healing ability of mutant cells.

[0569] WT cells treated with WT CM showed increased mean scratch closure, but this was not significant relative to untreated controls (p=0.0769) ( Figure 30 In contrast, WT cells treated with FGFR3-KO CM showed a 2.4-fold increase in wound closure, significantly greater than untreated and WT-CM-treated controls. In fact, treatment with FGFR3-KO CM achieved wound healing comparable to that of FGFR3-KO cells alone (p=0.8476).

[0570] Effects of MSC secretome on MSC proliferation and morphology

[0571] Next, WT and FGFR3-KO MSCs were treated with CM derived from WT or FGFR3-KO MSCs. Proliferation was assessed using an Alamar Blue cell viability assay, but no CM treatment had a significant effect on the number of viable cells at any time point ( Figure 31 This suggests that the FGFR3-KO secretome can increase the migration of WT MSCs but is not sufficient to drive the increased proliferation seen in FGFR3-KO MSCs.

[0572] Cell morphology was also analyzed after CM treatment to elucidate whether the secretome contributes to the differential cell shape between cell lines. WT cells showed a significant increase in cell area ( Figure 31 B). This increase in area was not accompanied by any significant changes in aspect ratio or circularity, indicating that the cells grew larger without any changes in shape ( Figure 31 C, D). FGFR3-KO CM had no effect on the area or shape of WT MSCs. However, treatment of FGFR3-KO MSCs with either WT or KO CM resulted in a significant decrease in cell area, particularly when treated with WT CM.

[0573] The effect of FGFR3-KO EVs on WT MSC proliferation was also evaluated. On day 2, different EV doses showed little effect at any dose. On day 3, there was a dose-dependent decrease in the number of viable cells. Cells treated with 10x EVs had 31% less fluorescence than controls. This experiment was repeated using EV-depleted FBS and applying 10x EV treatment. This treatment had no significant effect, indicating that neither FGFR3-KO CM nor EVs modulate MSC proliferation ( Figure 32 ).

[0574] Survival and proliferation of MSCs in the absence of serum supplementation

[0575] During CM collection, MSCs were cultured in serum-free medium to avoid contamination by FBS EVs. Cultivation in serum-free medium typically results in growth arrest, however, it was noted that FGFR3-KO MSCs appear to continue to proliferate. Thus, the growth of WT and FGFR3-KO MSCs in complete medium (10% FBS) and serum-free medium (0% FBS) was compared using Alamar Blue Viability Assay. In complete medium, FGFR3-KO showed significantly higher growth than WT MSCs by day 2. By day 3, both WT and FGFR3-KO MSCs cultured in serum-free medium had significantly lower growth than their complete medium counterparts ( Figure 33 A). Interestingly, there was no significant difference between WT MSCs in complete medium and FGFR3-KO MSCs in serum-free medium at any time point. This suggests that FGFR3-KO MSCs proliferate at a similar rate to WT cells even in the absence of serum.

[0576] To understand whether FGFR3-KO MSCs can maintain growth in the absence of serum, cells were cultured in serum-free medium for 21 consecutive days, and cell counts were performed at each passage. WT MSCs showed no significant change in cell number over time, indicating a stable growth phase in the absence of serum ( Figure 33B). In contrast, FGFR3-KO MSCs showed a significant increase in cell number over time. When cells reached confluence, they were equally passaged into another culture flask, as indicated by the arrows ( Figure 33 B). This prompts rapid cell growth, but growth begins to slow when the cells reach near confluence again. This increased survival and proliferation in the absence of serum may indicate an enriched secretome containing anti-apoptotic factors that enable FGFR3-KO MSCs to survive.

[0577] In the absence of serum, both WT and FGFR3-KO MSCs underwent significant morphological changes ( Figure 33 (CF) After 48 hours of culture in serum-free medium, WT MSCs became narrower and spindle-shaped, and their size appeared smaller. FGFR3-KO MSCs showed a shift toward this narrow morphology, but still contained many round cells and several cells with large lamellipodia.

[0578] Overall, FGFR3 KO cells produced good-quality EVs with a very low serum requirement, making the cells and EVs suitable for engineering applications. This is supported by the fact that EVs did not adversely affect cells treated with them. The FGFR3-KO secretome may be useful for wound healing applications, where stimulation of migration may promote improved healing due to enhanced migration to the wound site.

[0579] Table 7 below provides non-limiting examples of properties of different MSC clonal lines.

[0580]

[0581]

[0582] Table 7: Non-limiting examples of properties of different MSC clonal lines.

[0583] Example 2

[0584] EVs can be isolated following the protocol used to generate the 100K fraction described in Example 1 above.

[0585] The night before EV isolation, cool the Ty45i rotor in a cold room (4°C) and slowly thaw a jar of medium containing conditioned medium (e.g., prepared as described elsewhere herein, e.g., using Y201 cells or FGFR3 KO cells) overnight at 4°C. On the morning of the isolation, place the TLA100.3 rotor at 4°C.

[0586] 1. All steps should be completed quickly and efforts should be made to keep the culture medium cool at all times. Always transport tubes on ice, and set all centrifuges at 4 °C before starting the separation. Some of these steps can be omitted if all fractions or culture medium with or without EVs (to be used as controls in functional assays) are not collected.

[0587] 2. Transfer the culture medium from the culture tank to a 50 ml falcon tube and centrifuge at 300 g for 5 minutes using a centrifuge (e.g., a standard benchtop centrifuge) to remove any large cells or debris.

[0588] 3. At this stage, an appropriate amount of CM can be collected and used as a control for functional assays.

[0589] 4. Transfer the remaining supernatant to 6 new falcon tubes and centrifuge again at 2000 g and 4°C for 20 minutes using a centrifuge (e.g., a standard benchtop centrifuge).

[0590] 5. Transfer the supernatant to an ultracentrifuge tube compatible with a Ty45i rotor and retain the pellet (precipitate). Use 600 μl of cold-filtered HQ PBS to resuspend the pellet in each tube. Finally, pool the resuspended pellets from the six tubes in pairs (total volume of each pair is 1200 μl) in 3X 1.5ml eppendorf tubes. It may be necessary to pipette vigorously (vigorous pipetting) and take some time to ensure that the pellet is completely resuspended.

[0591] 6. Centrifuge the resuspended pellet from the 2,000 g spin (centrifugation) again at 2,000 g, 4° C. on a benchtop centrifuge and aspirate / decant the supernatant, taking care not to disturb the pellet. Any benchtop centrifuge with a temperature control system can be used.

[0592] 7. Resuspend the pellet in 50-100 μl of cold HQ-PBS (e.g. GIBCO brand PBS purchased in 1x bottles, as this is "pellet-free") and transfer the suspension to a low-binding protein tube. Freeze the resuspended pellet at -70°C (2K fraction).

[0593] 8. The supernatants previously transferred into 6X Ty45i ultracentrifuge tubes must be paired and the tubes must be balanced to within 0.01 g of each other (if the difference is less than 0.009, a small piece of autoclave tape can be used to balance the tubes). Before use, the tubes should be inspected for signs of excessive wear and damage, and all O-rings must be in place. The tubes should be weighed with all caps, O-rings, and metal caps on, as they all have slight differences in weight; this can be done, for example, on an AND FX300i balance. The tubes must be filled to at least 2 / 3 of their maximum capacity. The culture medium should be centrifuged at 10,000 g (9,000 rpm in a Ty45i rotor) for 45 minutes at 4°C in a floor-standing ultracentrifuge (e.g., with the text on each tube facing outward to make it easier to identify the pellet) (Machine 100XP, Beckman).

[0594] 9. Transfer the supernatant to a fresh Ty45i ultracentrifuge tube and collect the pellet. Resuspend the pellet in 600 μl of cold-filtered HQ-PBS per tube. Finally, pool the resuspended pellets from the six Ty45i tubes in pairs (total volume of 1200 μl per pair) into 3 x 1.5 ml micro-ultracentrifuge tubes (Beckman Microfuge Tube Polyallomer, catalog number: 357448). You may need to pipette vigorously and take some time to ensure that the pellet is completely resuspended.

[0595] 10. Centrifuge the resuspended pellet from the 10,000 g spin again in a TL100 ultracentrifuge using a TLA100.3 rotor at 10,000 g (TLA100.3 rotor, 16,000 rpm) for 45 minutes at 4°C and aspirate / decant the supernatant, taking care not to disturb the pellet.

[0596] 11. Resuspend the pellet in 50-100 μL HQ-PBS and transfer the suspension to a low protein binding tube. Store at -70°C (10K fraction).

[0597] 12. The supernatants transferred to 6 fresh Ty45i ultracentrifuge tubes must be balanced to within 0.01 g of each other and filled to at least 2 / 3 of their maximum capacity. Centrifuge the culture medium at 100,000 g (30,000 rpm in a Ty45i rotor, Machine 100XP, Beckman) in a floor-standing ultracentrifuge at 4°C for 90 minutes (e.g., with the text on each tube facing outward to make it easier to identify the pellet). A small pellet may be visible; try to move the tube gently to avoid disturbing the pellet.

[0598] 13. Gently discard the supernatant to avoid disturbing the pellet. If you are performing a functional assay and wish to use the supernatant as a negative control, collect an appropriate amount of supernatant in a new 50 ml falcon tube and store at -70°C. Use a pipette to remove any residual material.

[0599] 14. Resuspend the pellet in 600 μl of cold-filtered PBS per tube. Finally, pool the resuspended pellets from the six Ty45i tubes into pairs (1200 μl total volume per pair) in 3 x 1.5 ml micro-ultracentrifuge tubes. You may need to pipette vigorously and take some time to ensure the pellets are completely resuspended.

[0600] 15. Micro-ultracentrifuge tubes should contain at least 1 mL before spinning.

[0601] 16. Spin the micro-ultracentrifuge tubes at 100,000 g (TLA100.3 rotor, 45,000 rpm) for 90 minutes.

[0602] 17. Aspirate / decant the supernatant, taking care not to disturb the pellet.

[0603] 18. Resuspend the pellet in 50-100 μL HQ-PBS and transfer the suspension to a protein low binding tube (100k fraction).

[0604] 19. Freeze the resuspended pellet at -70°C.

[0605] The reader's attention is drawn to all papers and documents which are related to this application and which are open to public inspection with this specification, filed concurrently with or prior to this specification, and the contents of all such papers and documents are incorporated herein by reference.

[0606] All features disclosed in this specification (including any accompanying claims, abstract and drawings) and / or all steps of any method or process so disclosed may be combined in any combination, except combinations in which at least some of such features and / or steps are mutually exclusive.

[0607] Each feature disclosed in this specification (including any accompanying claims, abstract and drawings) may be replaced by alternative features serving the same, equivalent or similar purpose, unless expressly stated otherwise. Accordingly, unless expressly stated otherwise, each feature disclosed is one example only of a generic series of equivalent or similar features.

[0608] The invention is not limited to the details of any foregoing embodiments. The invention extends to any novel feature or any novel combination of features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel step or any novel combination of steps in any disclosed method or process.

[0609] References

[0610] ·James S,Fox J,Afsari F,Lee J,Clough S,Knight C,Ashmore J,Ashton P,Preham O,Hoogduijn M,Ponzoni Rde A,Hancock Y,Coles M,Genever P.MultiparameterAnalysis of Human Bone Marrow Stromal Cells Identifies DistinctImmunomodulatory and Differentiation-Competent Subtypes.Stem CellReports.2015Jun 9;4(6):1004-15.doi:10.1016 / j.stemcr.2015.05.005.

[0611] ·Wilson AJ, Rand E, Webster AJ, Genever PG. Characterization of mesenchymal stromal cells in clinical trial reports: analysis of published descriptors. Stem Cell Res Ther. 2021Jun 22; 12(1):360.doi:10.1186 / s13287-021-02435-1.

[0612] ·Alasdair G Kay,James M Fox,James Hewitson,Andrew Stone,SophieRobertson,Sally James,Xiao-nong Wang,Elizabeth Kapasa,Xuebin Yang,Paul GGenever Identification of CD317-Positive Pro-inflammatory Immune StromalCells in Human Mesenchymal Stromal Cell Preparations.bioRxiv2022.02.10.479972;doi:https: / / doi.org / 10.1101 / 2022.02.10.479972

[0613] sequence

[0614] SEQ ID NO:1-CACCGCATCCGGCAGACGTACACGC

[0615] SEQ ID NO:2-AAACGCGTGTACGTCTGCCGGATGC

[0616] SEQ ID NO:3-

[0617] CAGCACCGCCGTCTGGTTGGCCGGCAGCCCCGCCTGCAGGATGGGCCGGTGCGGGG

[0618] AGCACTCCAGCACGTCCAGCGTGTACGTCTGCCGGATGCTGCCAAACTTGTTCTCCAC

[0619] GACGCA

[0620] SEQ ID NO:4-CAC GGC CCA GCT CTG AGA AAG

[0621] SEQ ID NO:5-ACC CAA ATC CTC ACG CAA CC

[0622] SEQ ID NO:6-CAT CAA GCC ATC CAC TAT ACA GAGG CGT CTG GGA GAC ATA CA

[0623] SEQ ID NO:7-CTA CAC TGT CCA CCA TACTTA TGC TGG ATG TAT GGG GCT

[0624] SEQ ID NO:8-CCT GTC CTC CAT TCA CCC ACA C

[0625] SEQ ID NO:9-GAG TTC AGT GAA GGG GAG CC

[0626] SEQ ID NO:10-CTG AGA AAG AGG TCA GGA G

[0627] SEQ ID NO:11-CTG CTA GAG CAG GAG TGA GG

[0628] SEQ ID NO:12-CGG GTC CCA CTC CTA GAC AC

[0629] SEQ ID NO:13-CGG CCC TTA CCG ATA CTT CAT

[0630] SEQ ID NO:14-CAA TAA ACG TTG GGT GCC GC

[0631] SEQ ID NO:15-CTC AGT AAG TGC TGG CCT CTG

[0632] SEQ ID NO:16-GRGDSP

[0633] SEQ ID NO:17-GRADSP

Claims

1. A mesenchymal stem cell (MSC)-like cell or a derivative thereof deposited with the European Collection of Animal Cells under the accession number 22072103.

2. The MSC-like cell according to claim 1, wherein Compared to the MSC-like cells deposited with the European Collection of Animal Cells under the accession number 22072103, the derivatives have reduced FGFR3 expression and / or activity.

3. The MSC-like cell according to any preceding claim, wherein Said derivatives differ from the MSC-like cells deposited under the European Collection of Animal Cells accession number 22072103 only in having reduced FGFR3 expression and / or activity.

4. The MSC-like cell according to any one of claims 2 or 3, wherein The derivatives: (a) having increased levels of at least 10 different RNA transcripts selected from Table 5 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as European Collection of Animal Cells deposit number 22072103; and / or (b) having reduced levels of at least 10 different RNA transcripts selected from Table 6 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited as European Collection of Animal Cells accession number 22072103.

5. A mesenchymal stem cell (MSC)-like cell or a derivative thereof deposited with the European Collection of Animal Cells under the accession number 22072101. A cell population comprising a plurality of cells according to any one of claims 1 to 5. A DNA preparation comprising the genomic DNA of the cell according to any one of claims 1 to 5. 8 . A cell-free conditioned medium obtainable by culturing the cell according to claim 1 or the cell population according to claim 6 .

9. The cell-free conditioned medium according to claim 8, wherein The cell-free conditioned medium is depleted of extracellular vesicles (EVs).

10. The cell-free conditioned medium according to claim 9, wherein The cell-free conditioned medium is substantially free of extracellular vesicles (EVs). 11 . A secretome or a portion thereof, obtainable by culturing the cell according to claim 1 or the cell population according to claim 6 .

12. The secretome or a portion thereof according to claim 11, wherein The secretome or a portion thereof is depleted of extracellular vesicles (EVs).

13. The secretome or a portion thereof according to claim 12, wherein The secretome or portion thereof is substantially free of extracellular vesicles (EVs).

14. An extracellular vesicle (EV) population, obtainable by culturing the cell according to any one of claims 1 to 5 or the cell population according to claim 6.

15. The EV group according to claim 14, wherein: The EV population is a 100K EV fraction.

16. The cell-free conditioned medium of claim 8, or the secretome or fraction thereof of claim 11, comprising at least 10 different proteins selected from Table 2.

17. The cell-free conditioned medium of claim 8, or the secretome or a portion thereof of claim 11, or the EV population of claim 14 or 15, comprising at least 10 different proteins selected from Table 3.

18. The cell-free conditioned medium of claim 8, or the secretome or portion thereof of claim 11, or the EV population of claim 14 or 15, comprising at least 10 different miRNAs selected from Table 4.

19. A composition comprising at least 10 different proteins selected from Table 2.

20. A composition comprising at least 10 different proteins selected from Table 3.

21. A composition comprising at least 10 different miRNAs selected from Table 4.

22. The composition according to any one of claims 19 to 21, wherein The composition is a cell-free composition.

23. A pharmaceutical composition comprising the MSC-like cells of any one of claims 1 to 5, the cell population of claim 6, the DNA preparation of claim 7, the cell-free conditioned medium of any one of claims 8 to 10 or claims 16 to 18, the secretome or a portion thereof of any one of claims 11 to 13 or claims 16 to 18, the extracellular vesicle (EV) population of any one of claims 14, 15, 17 or 18, or the composition of any one of claims 19 to 22, wherein, The pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant, excipient, diluent and / or carrier.

24. The pharmaceutical composition according to claim 23, for use as a medicine.

25. The pharmaceutical composition according to claim 23, for use in promoting tissue repair.

26. The pharmaceutical composition for use according to claim 25, wherein The pharmaceutical composition is used to treat or prevent diseases or conditions associated with cartilage damage.

27. The pharmaceutical composition for use according to claim 26, wherein The disease or condition associated with cartilage damage is arthritis, optionally wherein the arthritis is selected from the group consisting of juvenile idiopathic arthritis, rheumatoid arthritis, osteoarthritis, spondyloarthritis and psoriatic arthritis.

28. The pharmaceutical composition for use according to claim 25, wherein The pharmaceutical composition is used for application in wound healing and / or tissue regeneration.

29. The pharmaceutical composition according to claim 23, for use in treating or preventing inflammation.

30. The pharmaceutical composition for use according to claim 29, wherein The pharmaceutical composition is used to treat or prevent an autoimmune disease or condition.

31. Use of the extracellular vesicle (EV) population of claim 14 or 15 for delivering a cargo to a cell.

32. A method for screening a test compound for its ability to induce MSC-like cell differentiation, the method comprising: a) contacting the test compound with the MSC-like cells of any one of claims 1 to 5 or the cell population of claim 6; and b) determining the effect of the test compound on at least one differentiation marker.

33. The method according to claim 32, wherein The at least one differentiation marker is selected from the group consisting of: osteogenic differentiation markers and chondrogenic differentiation markers, optionally wherein: a) the osteogenic differentiation marker is selected from the group consisting of: type I collagen, alkaline phosphatase, BMP2, osteopontin, osteonectin, osteocalcin, bone sialoprotein, and Runx2; and / or b) The chondrogenic differentiation marker is selected from the group consisting of type II collagen, type X collagen, aggrecan, lubricin, cartilage oligomeric matrix protein, and Sox9.

34. Use of the MSC-like cell according to any one of claims 1 to 5 or the cell population according to claim 6 for screening the ability of a test compound to induce MSC-like cell differentiation.

Images