Hainan tiger milk ganoderma strain and application thereof

By screening and identifying the Hainan Tiger Milk Ganoderma lucidum strain Lignosus hainanensis FCATAS 11829, the problems of resource scarcity and insufficient antioxidant capacity were solved, and high polysaccharide content and strong antioxidant and antibacterial capabilities were achieved, expanding its application in food, health products and medicines.

CN120442420BActive Publication Date: 2025-09-26SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510962858.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-14
Publication Date
2025-09-26
Estimated Expiration
2045-07-14

AI Technical Summary

Technical Problem

The existing resources of Hainan Tiger Milk Ganoderma are scarce, its antioxidant capacity is limited, and its unique biological characteristics and pharmacological activities have not been systematically studied.

Method used

A Hainan tiger milk Ganoderma lucidum strain, Lignosus hainanensis FCATAS 11829, was screened and identified through separation, purification and screening techniques. It has high polysaccharide content and strong antioxidant and antibacterial abilities, and can be used in the preparation of antioxidants and antibacterial agents.

Benefits of technology

It has improved the development and utilization value of Hainan Tiger Milk Ganoderma resources, provided a scientific basis for high-quality health products, and enhanced its development potential in the fields of food, health products and medicines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442420B_ABST
    Figure CN120442420B_ABST
Patent Text Reader

Abstract

The present invention discloses a Hainan tiger milk ganoderma strain and its applications. This strain was isolated from the Wuzhishan tropical rainforest in Hainan Province and is currently deposited with the China Center for Type Culture Collection under the accession number CCTCC NO: M 2025951, with a deposit date of April 30, 2025. This strain has high polysaccharide content and strong antioxidant and antibacterial properties. It can be used in pharmaceuticals, health products, foods, and other fields, and has promising application prospects and economic value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of fungi, and in particular to a Hainan tiger milk ganoderma lucidum strain and application thereof. Background Art

[0002] Hainan Tiger Milk Ganoderma Lucidum ( Lignosus hainanensi s BK Cui) is mainly distributed in the tropical rainforest areas of Hainan Province, China. It belongs to the Polyporaceae family in fungal taxonomy and is a precious medicinal fungus. In recent years, with the increasing demand for natural medicines and functional foods, Hainan Tiger Milk Ganoderma has gradually attracted attention due to its unique biological characteristics and medicinal value. Hainan Tiger Milk Ganoderma is rich in a variety of bioactive ingredients, such as polysaccharides, proteins, terpenes, flavonoids, etc. These ingredients give Hainan Tiger Milk Ganoderma a variety of pharmacological activities, such as antioxidant, immunomodulatory, anti-tumor, anti-inflammatory, etc. It is worth noting that differences in geographical distribution and climate may cause tiger milk Ganoderma from different origins to show intraspecific variation in morphological characteristics, chemical composition and biological activity. In particular, Hainan Tiger Milk Ganoderma grows under the unique tropical marine climate conditions of the island. This special habitat may make it different from Tiger Milk Ganoderma ( Lignosus rhinocerus ) specific metabolites and functional properties.

[0003] At present, the research and development of Hainan Tiger Milk Ganoderma is still in a relatively early stage, and its high-quality germplasm resources are relatively scarce. Lignosus rhinocerus While the medicinal value of the species has been explored to some extent, the unique biological characteristics and pharmacological activities of Hainan Tiger Milk Ganoderma, a closely related species, have yet to be systematically studied. Therefore, screening and identifying new strains of Hainan Tiger Milk Ganoderma with superior traits and analyzing their pharmacological mechanisms will not only help enhance the comprehensive development and utilization of the Tiger Milk Ganoderma resource but also provide scientific evidence and technical support for meeting market demand for high-quality health products. Summary of the Invention

[0004] In view of the shortcomings of the existing technology, the present invention aims to provide a Hainan tiger milk ganoderma strain with unique advantages. The strain has strong antioxidant and antibacterial abilities and high polysaccharide content, so as to solve the problems of the existing Hainan tiger milk ganoderma resources shortage and limited antioxidant ability.

[0005] The technical solutions of the present invention are as follows:

[0006] The present invention provides a strain of Hainan Tiger Milk Ganoderma lucidum, which was collected from the Wuzhishan tropical rain forest in Hainan Province and obtained through microbiological techniques such as separation, purification, and screening. After identification, the strain belongs to Hainan Tiger Milk Ganoderma lucidum ( Lignosus hainanensis ), classified as Lignosus hainanensis FCATAS11829. This strain is currently deposited with the China Center for Type Culture Collection under the accession number CCTCC NO:M 2025951, with a deposit date of April 30, 2025. Analysis of the chemical composition and pharmacological activity of this strain revealed that its sclerotial polysaccharide content can reach 82.16 mg / g. Furthermore, this strain exhibits strong antioxidant and antibacterial properties.

[0007] Furthermore, the present invention relates to the use of the Hainan tiger milk ganoderma strain in the preparation of antioxidants. The antioxidant comprises reducing iron ions.

[0008] Furthermore, the antioxidant includes mycelium and / or mycelium extract of the Hainan tiger milk ganoderma strain.

[0009] Furthermore, the application includes: activating the Hainan Tiger Milk Ganoderma lucidum strain, inoculating it into a liquid culture medium, and shaking the culture to obtain mycelium, wherein the mycelium contains antioxidant components. Furthermore, the liquid culture medium contains the following components: 20.0 g / L glucose, 2.0 g / L peptone, 3.0 g / L potassium dihydrogen phosphate, and 1.5 g / L magnesium sulfate.

[0010] Furthermore, the shaking culture conditions are: temperature 25° C., rotation speed 160 r / min, and culture for about 6 days.

[0011] Furthermore, the present invention also relates to the use of the Hainan tiger milk ganoderma strain in the preparation of tiger milk ganoderma polysaccharide or antibacterial agent.

[0012] Furthermore, the antibacterial agent contains the Hainan tiger milk ganoderma sclerotia or sclerotia extract.

[0013] Furthermore, the extract is a water extract.

[0014] Furthermore, the antibacterial agent is an anti-Escherichia coli agent.

[0015] Compared with the prior art, the present invention has the following advantages:

[0016] The Hainan tiger milk ganoderma lucidum strain provided by the present invention has the characteristics of high polysaccharide content, high antioxidant capacity and high antibacterial capacity, so that the strain has greater development potential in the fields of food, health products, medicines, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 : The performance of Hainan Tiger Milk Ganoderma screened by the present invention on PDA culture medium.

[0018] Figure 2 : The sclerotia of Hainan tiger milk ganoderma screened by the present invention. DETAILED DESCRIPTION

[0019] In order to better understand the technical content of the present invention, the present invention is further described below in conjunction with specific embodiments.

[0020] Example 1 Hainan Tiger Milk Ganoderma Lucidum ( Lignosus hainanensis )

[0021] Wild Ganoderma lucidum was collected from the Wuzhishan tropical rain forest in Hainan Province, and tissue isolation and culture were performed to obtain a single strain. Genomic DNA was extracted using a kit and the ITS gene (SEQ ID NO.1) fragment was amplified by PCR using the extracted DNA as a template. Lignosus hainanensis The model strain has a high degree of homology, and combined with morphological identification, it was determined that the fungus belongs to Hainan Tiger Milk Ganoderma ( Lignosus hainanensis ), classified as Lignosus hainanensi s FCATAS 11829. This strain is currently deposited in the China Center for Type Culture Collection, Wuhan University, Wuhan, China, with accession number CCTCC NO: M 2025951 and deposit date April 30, 2025.

[0022] The ITS sequence of Hainan Tiger Milk Ganoderma Lucidum CCTCC NO: M 2025951 is as follows (SEQ ID NO. 1):

[0023] TGCTAACTCGTAGTGACTGCGGAGGACATTATCGAGTTTTGATTTGGGTTGTAGCTGGCCCTCCCTCCGGGGTAAGGCATGTGCACGCCCTGCTCATCCACTCCTACACCTGTGCACTCACTTGTGGGTTTTCGGCCGGCGTTCGCATCCGTGCGGCGTTGACTGTGGACCTGCGTATTCACTACAAACCACACTGTCAGTATCAGAATGTCATATGTTTGCGATGTTAAACGCAATCAATACATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAAACCTGCAGGCTTTTTGGCTTGTAGGCTTTGGACTTGGAGGCCCTTTGCCGGTTCTAGTCAGTCGGCTCCTCTTAAACGCATTAGCCTGTATCCTTTGCGGATCGGCCCCTCGGTGTGATAAAACCTGTCTACGCCGGTGACCGTGAAGCGTTTTTGGCTGGCTTCCAACCGTCTCGCTGGAGACAAGCTCCTTCACTTTTTGACATCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGATAAAAAAAGGGGGG

[0024] Hainan Tiger Milk Ganoderma lucidum CCTCC NO: M 2025951 has the following characteristics: Its morphology and appearance are similar to the known Hainan Tiger Milk Ganoderma lucidum. The fruiting body has a long stipe, approximately 8-10 cm long, with sclerotia at the base. It grows in the soil. The sclerotia are approximately oval, 5×12 cm in size, with a cracked brown surface and white flesh. The stipe is thicker near the base and thinner near the cap, gradually fading from light brown to creamy white from the base to the cap. The cap is generally round and smooth, approximately 3-5 cm in diameter and 5 mm thick, with concentric rings that gradually fade from creamy white to yellowish brown from the outside to the inside. The flesh is creamy white and approximately 1 mm thick. The tube is creamy white and approximately 3 mm long. The pores are light yellow, mostly round, and there are approximately 3-4 pores per millimeter. The cap and stipe become corky after drying, and the sclerotia shrink upon drying. The hyphae are irregularly dendritic; the basidiospores are colorless and transparent, 5.0~5.8×2.2~2.6μm, oblong to cylindrical, with smooth edges and no starch reaction.

[0025] Hainan Tiger Milk Ganoderma Lignosus hainanensis Tiger Milk Ganoderma Lignosus rhinocerus There is a certain similarity in the fruiting body morphology. Lignosus rhinocerus It is also distributed in tropical areas of China. It has sclerotia and central stipe. Its cap is cinnamon brown and its pores are cream-colored and hairless. Its cap has concentric ring patterns. L. hainanensis The difference is that its fungus pores are smaller, about 6-8 per millimeter, and the basidiospores are smaller and more obvious wide oval, (4.0~5.0)×(2.8~3.0) μm. Hainan Tiger Milk Ganoderma CCTCC NO:M 2025951 and Tiger Milk Ganoderma Lignosus rhinocerus The ITS similarity is 90.86%~92.01%.

[0026] Example 2 Determination of polysaccharide content in Hainan tiger milk ganoderma

[0027] Strain culture:

[0028] Hainan Tiger Milk Ganoderma lucidum CCTCC No. M 2025951 was inoculated onto PDA solid medium and cultured in a constant temperature incubator at 25°C to obtain an activated strain of Tiger Milk Ganoderma lucidum. This activated strain was then inoculated onto sawdust medium (containing, by mass, 80% sawdust, 15% bran, 3% glucose, 1% soybean meal, and 1% gypsum, with water added at a solid-to-liquid ratio of 40:60 by volume). The culture was maintained in a dark incubator at 25°C and 65% humidity. After 60 days, the mycelium filled the bags. The soil was leveled, and the bags, once filled with mycelium, were removed from the plastic bags and placed side by side. The bags were covered with 3-4 cm of soil and sprayed with water to maintain moisture. After 150 days, the sclerotia matured and were harvested. Air-dried and then ground the sclerotia of Ganoderma lucidum were added to a 20 g / 100 mL solids / liquid ratio. Extraction was performed at 35 ± 2°C with stirring (150–200 rpm) for 24 h. The extract was then filtered and dried to a constant weight using a rotary vacuum evaporator to obtain the aqueous extract to be tested.

[0029] Polysaccharide content was determined using the phenol-sulfuric acid method, following the standard method described in "Determination of Crude Polysaccharide Content in Edible Fungi" (NY / T1676-2008). The experiment was repeated three times, and the mean ± standard deviation was reported.

[0030] The test results showed that the polysaccharide content in the sclerotium water extract of Hainan Tiger Milk Ganoderma Lucidum CCTCC NO:M 2025951 reached 82.16±2.47 mg / g.

[0031] In order to analyze the nutritional components and pharmacological effects of Hainan Tiger Milk Ganoderma Lucidum CCTCC NO:M 2025951, another Hainan Tiger Milk Ganoderma Lucidum strain collected from other areas of Hainan was simultaneously tested. The results showed that the sclerotial polysaccharide content (64.8±2.06mg / g) of the other strain was lower than that of Hainan Tiger Milk Ganoderma Lucidum CCTCC NO:M 2025951.

[0032] Example 3 Antibacterial Activity Detection of Hainan Tiger Milk Ganoderma Lucidum CCTCC NO: M 2025951

[0033] Obtain sclerotia according to the method described in Example 2. Air-dry and then crush the sclerotia of Ganoderma lucidum. Add water at a solid-liquid ratio of 20 g / 100 mL. Extract at 35 ± 2°C with stirring (150–200 rpm) for 24 h, then filter. Collect the aqueous extract and dry it under reduced pressure on a rotary vacuum evaporator to a constant weight to obtain the aqueous extract to be tested.

[0034] Dilute the water extract to be tested with distilled water to a concentration of 20 mg / mL. Take 100 μL of the 10 5A suspension of Escherichia coli (cfu / mL) was evenly spread on an agar plate. A 10 μL sample of the aqueous extract to be tested was used to wet a sterile Whatman filter paper (6 mm diameter) and allowed to dry. Amoxicillin (10 μg / slip) was used as a positive control. Using sterile tweezers, the filter paper was firmly placed on the surface of the inoculated agar plate. The plate was incubated at 37°C for 24 hours. Antimicrobial activity was assessed by measuring the diameter of the inhibition zone. All experiments were repeated three times, and the mean ± standard deviation was reported.

[0035] Experimental results: The diameter of the inhibition zone of the positive control was 21.94±0.47 mm, and the diameter of the inhibition zone of the Hainan tiger milk Ganoderma water extract against Escherichia coli was 15.78±0.59 mm. The Hainan tiger milk Ganoderma water extract showed good antibacterial activity against Escherichia coli.

[0036] Example 4 Antioxidant Activity Detection of Hainan Tiger Milk Ganoderma

[0037] Hainan Tiger Milk Ganoderma lucidum CCTCC No. M 2025951 was inoculated onto PDA solid medium and cultured in a constant-temperature incubator at 25°C to obtain activated strains of Tiger Milk Ganoderma lucidum. Five uniformly sized cakes were inoculated into liquid culture (20.0 g glucose, 2.0 g peptone, 3.0 g potassium dihydrogen phosphate, 1.5 g magnesium sulfate, and diluted to 1000 mL with water). The culture was shaken at 25°C and 160 rpm for 6 days, and mycelium was obtained by filtration. The filtered mycelium was dried in a 60°C oven to constant weight and then removed. The dried mycelium was ground and sieved to obtain mycelial powder for future use. Antioxidant activity was then tested. Iron ion reducing capacity was analyzed using a total antioxidant capacity (T-AOC, FRAP) assay kit from Puint Bioengineering Co., Ltd.

[0038] Determination of Ferric Reducing Antioxidant Capacity (FRAP Method)

[0039] 1) Solution preparation:

[0040] Mixed solution (prepared and used immediately): Mix reagent 1, reagent 2, and reagent 3 in a ratio of 10:1:1 and preheat to 37°C before use.

[0041] 2) Sample processing:

[0042] Weigh about 0.1g of sample, add 1mL of extraction solution (water) and homogenize in an ice bath, then centrifuge at 10000r / min and 4℃ for 10min, collect the supernatant and place on ice for testing.

[0043] 3) Determination steps:

[0044] ① Preheat the spectrophotometer for 30 minutes and adjust the wavelength to 593nm.

[0045] ② Add 50 μL of the extract and 950 μL of the mixed solution to the blank tube; add 50 μL of the sample and 950 μL of the mixed solution to the assay tube. Mix thoroughly and react for 20 minutes.

[0046] ③ Adjust to zero with double distilled water, use a 1mL glass cuvette, and measure the absorbance at 593nm. △A=A 测定 -A 空白 .

[0047] ④ Standard curve drawing: Use FeSO4 standard solution to replace the sample to draw a standard curve. Calculate the total antioxidant capacity of the sample based on the standard curve.

[0048] The test results showed that the iron-reducing antioxidant capacity of the mycelium reached 79.3±1.37 μmol Trolox / g, indicating that the antioxidant substances in the mycelium of Hainan Tiger Milk Ganoderma lucidum CCTCC No. M 2025951 possess significant antioxidant capacity. This compares to the iron-reducing antioxidant capacity of other Hainan Tiger Milk Ganoderma lucidum strains, which were 54.8±2.41 μmol Trolox / g. Therefore, Hainan Tiger Milk Ganoderma lucidum CCTCC No. M 2025951 possesses a stronger antioxidant capacity.

[0049] The above descriptions are only some embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall fall within the scope of protection of the present invention.

Claims

1. Hainan Tiger Milk Ganoderma Lucidum ( Lignosus hainanensi s) strain, characterized in that The strain was deposited in the China Center for Type Culture Collection with the accession number CCTCC NO:M 2025951 and the deposit date was April 30, 2025.

2. The use of the Hainan tiger milk ganoderma lucidum according to claim 1 in the preparation of tiger milk ganoderma lucidum polysaccharides and / or antibacterial agents, characterized in that: The antibacterial agent is an anti-Escherichia coli agent.

3. The use according to claim 2, characterized in that The Hainan tiger milk ganoderma is activated, inoculated into a liquid culture medium, and cultured with shaking to obtain mycelium.

4. The use according to claim 3, characterized in that The liquid culture medium contains the following components: 20.0 g / L glucose, 2.0 g / L peptone, 3.0 g / L potassium dihydrogen phosphate, and 1.5 g / L magnesium sulfate.

5. The use according to claim 4, characterized in that The shaking culture conditions are: temperature 25° C., rotation speed 160 r / min, and culture for 6 days.

6. The use according to claim 2, characterized in that The antibacterial agent contains the sclerotia or sclerotia extract of the Hainan tiger milk ganoderma.

7. The use according to claim 6, characterized in that The extract is a water extract.

Citation Information

Patent Citations

  • New ganoderma niger strain and cultivation method thereof

    CN117050886A

  • Polyporus rhinoceros cooke extract having anticancer and immunity enhancing activity and preparation method thereof

    CN1951403A