Oligonucleotide blocking agent for protein detection system and method for reducing background of ultra-sensitive protein detection system based on ortho-position reaction
By designing oligonucleotide blockers to occupy the extension site of the free antibody-probe conjugate, the background noise problem in the PEA system is solved, and the background signal is effectively reduced and the detection sensitivity and specificity are improved.
Patent Information
- Application Number
- CN202510957038.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-11
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2045-07-11
AI Technical Summary
There are background noise problems caused by nonspecific extension of free antibody-probe conjugates in existing ortho-extension reactions (PEA) systems. Existing strategies such as solid-phase PLA cleaning and protein blocking agents have low efficiency or non-site specificity problems, making it difficult to effectively reduce background signals.
An oligonucleotide blocker is designed, including a core blocking sequence and a support sequence. The core blocking sequence is complementary to the probe extension site. The support sequence prevents the formation of secondary structures and is used to compete to occupy the targetless free antibody-probe conjugate extension site in the liquid phase system to reduce background signals.
In the case of no dependence on enzymes or cleaning steps, the background signal of ortho-extension method is significantly reduced, the detection sensitivity and specificity is improved, and it is suitable for high-throughput ultrasensitive protein detection.
Smart Images

Figure CN120442620A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to an oligonucleotide blocker for a protein detection system and a method for reducing the background of an ultrasensitive protein detection system based on an ortho reaction. Background Art
[0002] Protein detection technology is of great significance in biomedical research and clinical diagnosis, especially in the early screening, disease progression monitoring, and efficacy evaluation of major diseases. Detection sensitivity directly determines the depth and accuracy of its application. Traditional detection technologies such as ELISA (enzyme-linked immunosorbent assay) and chemiluminescence, while capable of quantitative analysis, typically have detection limits in the picoliter range, which cannot accurately detect low-abundance protein markers at levels of fg / mL or even ag / mL in plasma. With the continuous advancement of precision medicine and early intervention, the development of protein detection methods with higher sensitivity, smaller sample requirements, and faster response times has become a common demand in both clinical and scientific research.
[0003] Ultrasensitive detection technologies have emerged in recent years, such as Quanterix's single-molecule immunoassay (Simoa), which has a detection limit of femtoliters or even atom-levels, achieving sensitivity 100-1000 times higher than traditional techniques. These technologies are capable of detecting and analyzing protein markers at extremely low abundance levels in plasma. However, methods based on the Simoa technology platform involve multiple cleaning steps, require sophisticated chips, and require expensive instrumentation, resulting in high testing costs and making them difficult to apply to large-scale clinical diagnostics.
[0004] In addition to the Simoa technology platform, proximity-based protein detection technologies, such as the Proximity Ligation Assay (PLA) and the Proximity Extension Assay (PEA), have developed rapidly in recent years. These technologies also enable ultrasensitive plasma protein detection, offering advantages such as no-cleaning and qPCR compatibility, making them suitable for rapid detection and integration into automated platforms. Both PLA and PEA are homogeneous systems, relying on dual antibodies to recognize targets and trigger nucleic acid signal amplification. However, their enzymatic reaction mechanisms differ fundamentally. PLA relies on DNA ligase to achieve nucleic acid ligation, and its reaction efficiency is often inhibited by interfering substances in complex samples such as plasma. PEA, on the other hand, replaces ligase with DNA polymerase, improving reaction efficiency and making it widely applicable in liquid environments such as plasma. However, both PLA and PEA suffer from background noise caused by nonspecific binding of free probes.
[0005] In order to reduce the background signal of the adjacent reaction system, there are currently two strategies. One is to reduce the background by using solid-phase PLA cleaning, and the other is to reduce the background by blocking non-specific proteins in the sample. For example, patent CN117431300A proposes a method for improving detection sensitivity by blocking the hybridization site between the probe and the capture probe and supplementing it with a cleaning operation. However, this method introduces multiple cleanings, which destroys the essential advantages of PLA for free cleaning and rapid detection. Patent CN103154266B discloses a protein-nucleic acid coupling blocking agent that prevents false positive signal amplification by binding to non-target proteins in the sample. Although these strategies have alleviated the background noise problem to a certain extent, the former relies on a solid-phase system and physical cleaning, and the latter lacks site specificity. Both are not suitable for background control caused by non-specific extension between free antibody-probe conjugates. Summary of the Invention
[0006] To address the background noise problem caused by nonspecific extension between free antibody-probe conjugates in the proximity extension reaction (PEA) system, the present invention provides a blocker designed based on short-chain oligonucleotides. This blocker can specifically occupy a pair of probe extension sites and achieve effective background control in a liquid phase system that does not rely on washing.
[0007] To achieve the above-mentioned purpose of the invention, the technical solution of the present invention is as follows: The oligonucleotide blocker for protein detection system includes at least one pair of oligonucleotide sequences, each oligonucleotide sequence includes a core blocking sequence and supporting sequences located at the 5' end and 3' end of the core blocking sequence, and only the core blocking sequence is partially or completely complementary to the extension site in the probe.
[0008] By analyzing the nucleic acid sequence of the extension site in the antibody-probe conjugate used in the proximity extension method, the present invention designs a universally applicable single-stranded oligonucleotide blocker structure. The single-stranded oligonucleotide blocker comprises a core blocking sequence that is partially or fully complementary to the probe and a support sequence that is completely non-complementary to the probe. The core blocking sequence can occupy the extension site of free, target-free antibody-probe conjugates, preventing them from binding and extending with each other, thereby reducing the background of the PEA system (the affinity between the antibody-probe conjugate pair that captures the target is stronger than the affinity between the oligonucleotide blocker and the antibody-probe conjugate, resulting in competitive displacement of the oligonucleotide blocker, exposing the extension site). The support sequence effectively prevents the formation of secondary structure in the core region and alleviates the reduction in pairing efficiency caused by steric conformational stress, thereby enhancing the structural stability and functional sustainability of the blocker.
[0009] In the oligonucleotide blockers of the present invention, the core blocking sequence is designed based on the nucleotide sequence of the probe used. The nucleotide sequence of the probe is universal in the PEA system and does not vary depending on the target analyte. Therefore, it can be considered that the present invention does not restrict the specific nucleotide sequence of the core blocking sequence; it can be designed based on the selected probe sequence according to the conditions specified in the present invention.
[0010] Preferably, in the above oligonucleotide blocker, the number of nucleotides in the core blocking sequence is less than or equal to 10.
[0011] In two oligonucleotide sequences belonging to the same pair, the lengths of the two core blocking sequences can be the same or different, and preferably the length is controlled to be less than 10 nucleotides; experiments have found that when the length of the core blocking sequence is too long, not only does the blocking effect tend to decrease, but the synthesis cost also increases.
[0012] Preferably, in the above oligonucleotide blocker, there are at least 4 consecutive complementary bases between the core blocking sequence and the extension site of the probe; that is, there are 4-10 consecutive complementary bases between the core blocking sequence and the extension site of the probe.
[0013] However, in two oligonucleotide sequences belonging to the same pair, the two core blocking sequences can independently be partially or fully complementary to the extension site of the probe, and this is not a specific requirement of the present invention. In a more preferred embodiment, making the core blocking sequence of at least one oligonucleotide sequence fully complementary to the extension site in the probe will achieve a better blocking effect.
[0014] Preferably, in the above-mentioned oligonucleotide blockers, in the two oligonucleotide sequences belonging to the same pair, there are at least 4 consecutive complementary bases between the two core blocking sequences, and the number of consecutive complementary bases between the two core blocking sequences is less than the number of consecutive complementary bases between the core blocking sequence and the extension site of the probe; more preferably, there are 4-6 consecutive complementary bases between the two core blocking sequences.
[0015] The number of complementary bases between core blocking sequences is usually less than the number of complementary bases between the core blocking sequence and the probe. On the one hand, this can reduce the possibility of complementarity between oligonucleotide blockers, and on the other hand, ensure that the core blocking sequence preferentially binds to the extension site of the probe.
[0016] Preferably, in the above oligonucleotide blocker, the support sequence has at least 3-6 consecutive bases T.
[0017] The present invention also provides a method for reducing the background of an ultrasensitive protein detection system based on an ortho reaction, the method comprising: (1) Incubating the above-mentioned oligonucleotide blocker with the antibody-probe conjugate and the sample to be analyzed; (2) Add extension solution, mix well and then proceed with extension reaction; (3) Continue to add the qPCR system, mix well, perform qPCR reaction, and analyze the qPCR test results.
[0018] It can be seen that the oligonucleotide blocker of the present invention is very simple to use and can effectively reduce the background signal of the proximity extension analysis system without relying on specific enzymes or additional washing steps, thereby improving the sensitivity and specificity of detection. It provides a new solution for high-throughput, ultrasensitive protein detection and is suitable for analyzing a wide range of samples.
[0019] Preferably, in step (1) of the above method, the concentration ratio of the oligonucleotide blocker to the antibody-probe conjugate is (100-2000): 1; the working concentration of the antibody-probe conjugate is 100-500 pM; In step (1), incubate at 37°C for 10-20 min.
[0020] In step (1) of the above method, the antibody-probe conjugate can be prepared by any existing or unknown method, and the present invention has no requirements for this. As an example of a specific embodiment, it can be prepared by the following method: (a) Activating the antibody using TCO-PEG4-NHS reagent to obtain an activated antibody; (b) Activating the amino-modified probe using Tz-PEG4-NHS reagent to obtain an activated probe; (c) coupling the activated antibody and the activated probe to obtain the antibody-probe conjugate. Preferably, in step (2) of the above application, the extension solution comprises: 4 μL of 10× buffer, 4 μL of a 100 μM equimolar mixture of four deoxynucleotide triphosphates, 2 μL of 8000 U / mL Bst elongase, and 26 μL of deionized water; The extension reaction process was as follows: extension at 37°C for 20 min, inactivation at 80°C for 20 min; In step (3), the qPCR system consists of: 0.4 μL of each qPCR detection primer, 0.2 μL of 6-carboxyfluorescein, 10 μL of a commercial qPCR mixed system containing a fluorescent dye and a polymerase, and 5 μL of deionized water.
[0021] Compared with the prior art, the beneficial effects of the present invention are embodied in: (1) The present invention designs a novel oligonucleotide blocker in the form of a universal single-stranded oligonucleotide by analyzing the nucleic acid sequence of the extension site in the antibody-probe conjugate used in the adjacent extension method. The single-stranded oligonucleotide blocker has a core blocking sequence that is partially or completely complementary to the probe and a support sequence that is completely non-complementary to the probe. The core blocking sequence can occupy the extension site of the free antibody-probe conjugate without a target, so that the free antibody-probe conjugate without a target cannot bind to and extend each other, thereby reducing the non-specific background of the PEA system (the affinity between a pair of antibody-probe conjugates that capture the target is stronger than the affinity between the oligonucleotide blocker and the antibody-probe conjugate, so the oligonucleotide blocker will be competitively displaced, exposing the extension site); and the support sequence can not only prevent the core blocking sequence from forming a secondary structure itself, but also prevent the nucleic acid pairing efficiency from decreasing due to spatial distortion or rigid tension, thereby stabilizing the blocking effect of the oligonucleotide blocker.
[0022] (2) The oligonucleotide blocker of the present invention is very easy to use and can effectively reduce the background signal of the proximity extension method analysis system without relying on specific enzymes or additional washing steps, thereby improving the sensitivity and specificity of the detection. It provides a new solution for high-throughput, ultrasensitive protein detection and is suitable for analyzing a wide range of samples.
[0023] (3) When the oligonucleotide blocker of the present invention is used to detect proteins by the proximity extension method, the signal of the target protein can be enhanced by more than 2.5 times. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 Schematic diagram of the working principle of the oligonucleotide blocker of the present invention; Among them, Cycles represents the number of cycles, Fluorescence represents the fluorescence signal, Negative represents negative, Threshold represents the critical value, and Positive represents positive; Figure 2 The blocking effect of different concentrations of the oligonucleotide blocker of the present invention when analyzing IL-6 by the proximity extension method; Wherein, Concentration represents the concentration of IL-6, the same below; Figure 3 The blocking effect of the oligonucleotide blockers of the present invention having different nucleotide sequences when analyzing IL-6 by the proximity extension method; Figure 4 The figure shows the blocking effect of the oligonucleotide blocker of the present invention when analyzing IL-6 by the proximity extension method at different antibody-probe conjugate concentrations. Figure 5 The blocking effect of the oligonucleotide blocker of the present invention when analyzing PSA by the proximity extension method; Figure 6 This is the blocking effect of the oligonucleotide blocker of the present invention when analyzing IL-17 using the proximity extension method. DETAILED DESCRIPTION
[0025] The technical solution of the present invention is further described in detail below with reference to the accompanying drawings and embodiments.
[0026] Example 1-7 Design of oligonucleotide blockers In an embodiment of the present invention, an oligonucleotide blocker is proposed, comprising at least a pair of oligonucleotide sequences, each of which consists of a core blocking sequence and support sequences located at the 5' end and 3' end of the core blocking sequence, respectively, wherein only the core blocking sequence is partially or fully complementary to the extension site of the probe, while the support sequence is completely non-complementary to the extension site of the probe.
[0027] The number of nucleotides in the core blocking sequence is less than or equal to 10, and there are at least 4 consecutive complementary bases between each core blocking sequence and the extension site in the probe.
[0028] In the two oligonucleotide sequences belonging to the same pair, there are 4-6 consecutive complementary bases between the two core blocking sequences.
[0029] The supporting sequence consists of 3-6 consecutive bases T.
[0030] In order to introduce the specific performance of the oligonucleotide blocker, the embodiments of the present invention, under the premise of following the above principles, designed several pairs of oligonucleotide blockers based on the following probes: Probe-1: 5'-GTGAGGCCAGCGTCTTTTATATTAGGCCCTGGTATAGCAGACTGAAA-3' (SEQ IDNo. 1); Probe-2: 5′-CGCAATGTCGCACATGATTCTCTGACGAACCGCTTTGCCTGATTTCAGTCT-3′ (SEQ ID No. 2).
[0031] The nucleotide sequences of each pair of oligonucleotide blockers are shown in Table 1.
[0032] Table 1 Nucleotide sequences of each pair of oligonucleotide blockers F(5’→ 3’) R(5’→ 3’) Oligonucleotide Blocker 1 <![CDATA[TTT SAC CAGT AC TTT(SEQ ID No.3)]]> <![CDATA[TTT AGACTGAAA TTT(SEQ ID No.4)]]> Oligonucleotide Blocker 2 <![CDATA[TTT AAA CAGTCT TTT(SEQ ID No.5)]]> <![CDATA[TTTTT AGACTGAAA T TTTT(SEQ ID No.6)]]> Oligonucleotide Blocker 3 <![CDATA[TTT AA TCAGTCT TTT(SEQ ID No.7)]]> <![CDATA[TTTTT AGACTGAAAT TTTTT(SEQ ID No.8)]]> Oligonucleotide Blocker 4 <![CDATA[TTT TTTCAGTCT TTT(SEQ ID No.9)]]> <![CDATA[TTTTTT AGACTGAAAT TTTTT(SEQ ID No.10)]]> Oligonucleotide Blocker 5 <![CDATA[TTT TTTCAGTCT G TTT(SEQ ID No.11)]]> <![CDATA[TTT AGACTGAAA TTT(SEQ ID No.12)]]> Oligonucleotide Blocker 6 <![CDATA[TTT TTTCAGTCT GCT TTT(SEQ ID No.13)]]> <![CDATA[TTT AGACTGAAA TTT(SEQ ID No.14)]]> Oligonucleotide Blocker 7 <![CDATA[TTT TTTCAGTCT GCTAT TTT(SEQ ID No.15)]]> <![CDATA[TTT AGACTGAAA TTT(EQ ID No.16)]]> Note: The underlined bold mark is the core blocking sequence, and the italic part is the base complementary to the probe extension site.
[0033] The working principle of the oligonucleotide blocker in this embodiment is as follows Figure 1As shown in the figure, the core blocking sequence of the oligonucleotide blocker first binds to the probe extension site on the antibody-probe conjugate. When the sample to be analyzed is added, the antibody portion of the antibody-probe conjugate binds to the target. At this time, the affinity between the pair of antibody-probe conjugates that have captured the target is stronger than the affinity between the oligonucleotide blocker and the antibody-probe conjugate. Therefore, the oligonucleotide blocker will be competitively displaced, exposing the extension site. After the two bind and extend, a signal is generated. However, the extension site of the free antibody-probe conjugate that has not captured the target is still occupied by the oligonucleotide blocker, which prevents the free antibody-probe conjugates without the target from binding and extending with each other, thereby reducing the background noise of the PEA system.
[0034] Example 8-11 Oligonucleotide Blocker 1 is used to analyze the blocking effect of IL-6 This embodiment provides a method for reducing the background of ultrasensitive protein detection based on proximity reaction, which comprises the following steps: (1) Incubating the oligonucleotide blocker 1 with the antibody-probe conjugate and the sample to be analyzed; The antibody-probe conjugate can be prepared by the following method: (a) Activating the antibody using TCO-PEG4-NHS reagent to obtain an activated antibody; Specifically, a desalting column that meets the target antibody quality requirements was first centrifuged to remove the storage buffer, and then 0.1M NaHCO3 + PBS was centrifuged and replaced three times. 10 µg of antibody (OriGene D624, D623) was added to the replaced filter column and centrifuged. The coupling agent TCO-PEG4-NHS was added to the filtrate at an amount of 1 / 10 of the antibody substance, and the reaction was carried out at room temperature in the dark for 25 minutes to obtain reaction solution A. Then, the storage buffer was removed by centrifugation using a desalting column that met the antibody quality requirements, and then the PBS buffer was replaced by centrifugation three times. The reaction solution A was desalted using the desalting column to remove excess TCO-PEG4-NHS to obtain the activated antibody. (b) Activating the amino-modified probe using Tz-PEG4-NHS reagent to obtain an activated probe; Specifically, a desalting column that meets the probe quality requirements was first centrifuged to remove the storage buffer, and then the borate buffer (0.1 mol / L pH = 8.5) was replaced by centrifugation three times. 10 μL of NH2-modified DNA was placed on the filter column, centrifuged, and 1 / 20 of the amount of Tz-PEG4-NHS was added. The reaction was carried out at room temperature in the dark for 25 minutes to obtain reaction solution B. Then, the desalting column that meets the probe quality requirements is centrifuged to remove the storage buffer, and then the PBS buffer is replaced by centrifugation three times; the reaction solution B is desalted using the desalting column to remove excess Tz-PEG4-NHS to obtain the activated probe; (c) coupling the activated antibody and the activated probe to obtain the antibody-probe conjugate; Specifically, the desalted activated antibody and activated probe were mixed evenly in a ratio of 1:1, and reacted at room temperature in the dark for 45 minutes to obtain an antibody-probe conjugate; In this experimental step, the antibody-probe conjugate was diluted to a concentration of 500 pM with PEA Buffer for use; then, the oligonucleotide blocker and the antibody-probe conjugate were mixed at a ratio of 100:1, 300:1, 500:1, 800:1, 1000:1, 1500:1, and 2000:1, respectively, and the sample to be analyzed (IL-6 concentrations were: 1000, 200, 40, 8, 1.6, 0.32, 0.064, and 0 pg / mL) was added and incubated at 37°C for 15 min; (2) Add extension solution, mix well and then proceed with extension reaction; The composition of the extension solution in this example is: 4 μL 10× buffer, 4 μL A / T / C / GTP, 2 μL 8000U / mL Bst elongase, and 26 μL deionized water; After the extension solution and incubation solution are mixed, the extension reaction is carried out in a PCR instrument. The extension reaction process is as follows: extension at 37°C for 20 min, inactivation at 80°C for 20 min; (3) Continue to add qPCR system, mix well, perform qPCR reaction, and analyze the qPCR test results; In this example, the qPCR system was composed of: 0.4 μL each of qPCR detection primers, 0.2 μL FAM, 10 μL MixBuffer, and 5 μL deionized water; Among them, qPCR detection primers include: Upstream primer: GTGAGGCCAGCGTCTTTTATATTA (SEQ ID No. 17); Downstream primer: CAATGTCGCACATGATTCT (SEQ ID No. 18); The qPCR reaction program is shown in Table 2: Table 2 qPCR reaction procedure After the qPCR reaction, the CT values under different conditions were compared to evaluate the inhibitory effect of the oligonucleotide blocker on the nonspecific background signal of PEA. The results are shown in Tables and Figure 2 .
[0035] Table 3 Blocking effect of different concentrations of oligonucleotide blocker 1 in IL-6 analysis by proximity extension assay Note: The multiple refers to the concentration of the oligonucleotide blocker relative to the antibody-probe conjugate. ΔCT represents the difference in quantitative detection cycles between a concentration of 1000 pg / mL and a blank background of 0 pg / mL, representing the signal intensity of the detection.
[0036] From Table 3 and Figure 2 The results show that the ΔCT value is 8.51 when no oligonucleotide blocker is added, while when 100-fold, 300-fold, 600-fold, 800-fold, 1000-fold, 1500-fold and 2000-fold oligonucleotide blockers are added, the ΔCT are 9.64, 9.97, 10.15, 9.86, 10.29, 9.78 and 9.58, respectively; that is, due to the blocking effect of the oligonucleotide blocker, the background CT of ultrasensitive protein detection is reduced, so that the signal of the target analyte IL-6 is enhanced by 2.19-fold, 2.75-fold, 3.11-fold, 2.55-fold, 3.43-fold, 2.41-fold and 2.10-fold, respectively.
[0037] And, from Table 2 and Figure 2 The results also show that an appropriate oligonucleotide blocker multiple is beneficial to further improve the blocking efficiency. At 300-1000 times, the signal enhancement of the target analyte is more significant.
[0038] Examples 12-17 Blocking Effects of Different Oligonucleotide Blockers in Analyzing IL-6 This embodiment provides a protein detection method based on the proximity extension method, which is basically the same as Example 5, except that the oligonucleotide blockers used are: oligonucleotide blocker 2, oligonucleotide blocker 3, oligonucleotide blocker 4, oligonucleotide blocker 5, oligonucleotide blocker 6, and oligonucleotide blocker 7.
[0039] At the same time, the oligonucleotide blocker 1 and the no oligonucleotide blocker conditions were set up again for comparison.
[0040] The concentration ratio of each oligonucleotide blocker to antibody-probe conjugate was 1000:1.
[0041] The blocking effects of each oligonucleotide blocker are shown in Table 4 and Figure 3 .
[0042] Table 4 Blocking effect of different oligonucleotide blockers in IL-6 analysis by proximity extension assay From Table 4 and Figure 3 It can be seen that the ΔCT value is 8.77 when no oligonucleotide blocker is added, while the ΔCT values are 10.08, 10.19, 10.22, and 10.25 when oligonucleotide blocker 1, oligonucleotide blocker 2, oligonucleotide blocker 3, and oligonucleotide blocker 4 are added, respectively. Due to the blocking effect of the oligonucleotide blockers, the background CT of ultrasensitive protein detection is reduced, and the signal of the target analyte IL-6 is enhanced by 4.60 times, 4.96 times, 5.06 times, and 5.17 times, respectively.
[0043] However, when oligonucleotide blocker 5, oligonucleotide blocker 6, and oligonucleotide blocker 7 were added, the ΔCT values were 9.83, 9.20, and 9.04, respectively, and the signals of the target analyte IL-6 were enhanced by 2.08-fold, 1.34-fold, and 1.21-fold, respectively.
[0044] Effect of different ratios of oligonucleotide blocker and antibody-probe conjugate on blocking effect in Examples 18-20 This example provides a protein detection method based on the proximity extension method, which is basically the same as Example 5, except that the concentrations of the antibody-probe conjugate are 100 pM, 200 pM, and 400 pM, respectively; and the ratio of oligonucleotide blocker 1 to antibody-probe conjugate is 1000:1.
[0045] At the same time, the concentration of the antibody-probe conjugate was set to 500 pM for comparison.
[0046] The blocking results are shown in Table 5 and Figure 4 shown.
[0047] Table 5 Effect of probe concentration on blocking effect From Table 5 and Figure 4 It can be seen that at different antibody-probe conjugate concentrations, the signal intensity of IL-6 differed by 1.09-1.93 times, and the best blocking effect was achieved when the concentration of the antibody-probe conjugate was 100 pM.
[0048] Example 21 Blocking effect of oligonucleotide blocker 1 in analyzing PSA This embodiment provides a protein detection method based on the proximity extension method, which is basically the same as Example 5, except that: the target analyte is PSA, the concentration of the antibody-probe conjugate is 200 pM, and the concentration ratio of oligonucleotide blocker 1 to antibody-probe conjugate is 1000:1.
[0049] The analysis results are shown in Table 6 and Figure 5 .
[0050] Table 6 Blocking effect of oligonucleotide blocker 1 in PSA analysis by proximity extension method From Table 6 and Figure 5 As can be seen from the figure, the PSA signal was enhanced by 2.08 times after the addition of oligonucleotide blocker 1 compared with that without oligonucleotide blocker.
[0051] Example 22 Oligonucleotide Blocker 1 is used to analyze the blocking effect of IL-17 This embodiment provides a protein detection method based on the proximity extension method, which is basically the same as Example 5, except that: the target analyte is IL-17, the concentration of the antibody-probe conjugate is 100 pM, and the concentration ratio of oligonucleotide blocker 1 to antibody-probe conjugate is 1000:1.
[0052] The analysis results are shown in Table 7 and Figure 6 .
[0053] Table 7 Blocking effect of oligonucleotide blocker 1 in IL-17 analysis by proximity extension assay From Table 7 and Figure 6 As can be seen in the figure, the IL-17 signal was enhanced by 2.68 times after the addition of oligonucleotide blocker 1 compared with that without oligonucleotide blocker.
Claims
1. An oligonucleotide blocker for a protein detection system, comprising at least one pair of oligonucleotide sequences, characterized in that: Each oligonucleotide sequence includes a core blocking sequence and supporting sequences located at the 5' end and the 3' end of the core blocking sequence, respectively, and only the core blocking sequence is partially or completely complementary to the extension site of the probe.
2. The oligonucleotide blocker according to claim 1, wherein The number of nucleotides in the core blocking sequence is less than or equal to 10.
3. The oligonucleotide blocker according to claim 1, wherein There are at least 4 consecutive complementary bases between the core blocking sequence and the extension site of the probe.
4. The oligonucleotide blocker according to claim 1, wherein In the two oligonucleotide sequences belonging to the same pair, the core blocking sequence of at least one oligonucleotide sequence is completely complementary to the extension site of the nucleic acid portion of the antibody-probe conjugate.
5. The oligonucleotide blocker according to claim 1, wherein In the two oligonucleotide sequences belonging to the same pair, there are at least 4 consecutive complementary bases between the two core blocking sequences, and the number of consecutive complementary bases between the two core blocking sequences is less than the number of consecutive complementary bases between the core blocking sequence and the extension site of the nucleic acid portion of the antibody-probe conjugate.
6. The oligonucleotide blocker according to claim 5, wherein In two oligonucleotide sequences belonging to the same pair, there are 4-6 consecutive complementary bases between the two core blocking sequences.
7. The oligonucleotide blocker according to claim 1, wherein The supporting sequence has at least 3-6 consecutive bases T.
8. A method for reducing the background of an ultrasensitive protein detection system based on an ortho reaction, characterized in that: include: (1) incubating the oligonucleotide blocker according to any one of claims 1 to 7 with the antibody-probe conjugate and the sample to be analyzed; (2) Add extension solution, mix well and then proceed with extension reaction; (3) Continue to add the qPCR system, mix well, perform qPCR reaction, and analyze the qPCR test results.
9. The method according to claim 8, wherein In step (1), the concentration ratio of the oligonucleotide blocker to the antibody-probe conjugate is (100-2000): 1; the working concentration of the antibody-probe conjugate is 100-500 pM; In step (1), incubate at 37°C for 10-20 min.
10. The method according to claim 8, wherein In step (2), the composition of the extension solution was: 4 μL 10 × buffer, 4 μL 100 μM equimolar mixture of four deoxynucleotide triphosphates, 2 μL 8000 U / mL Bst elongase, and 26 μL deionized water; The extension reaction process was as follows: extension at 37°C for 20 min, inactivation at 80°C for 20 min; In step (3), the qPCR system consists of: 0.4 μL of each qPCR detection primer, 0.2 μL of 6-carboxyfluorescein, 10 μL of a commercial qPCR mixed system containing a fluorescent dye and a polymerase, and 5 μL of deionized water.
Citation Information
Patent Citations
Blocking reagents and their usage
CN103154266B
High throughput genome sequencing on DNA arrays
CN101432439A
Blocking reagent and methods for the use thereof
CN103154266A
Unfolding proximity probes and methods for the use thereof
CN103703145A
Protein detection kit and detection method
CN113528611A