Promoter responding to 1, 6-hexanediol and application thereof
By developing the promoter PmioC and its mutant PmioC-74 that responds to 1,6-hexanediol, a biosensor was constructed, and the problem of low biosynthesis efficiency of 1,6-hexanediol was solved, achieving the effect of efficient screening of key enzyme mutants.
Patent Information
- Application Number
- CN202510594567.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-08-08
AI Technical Summary
In the prior art, 1,6-hexanediol biosynthesis efficiency is low, and the lack of efficient biosensors leads to high cost and long periods of screening key enzyme mutants.
A promoter PmioC and its mutant PmioC-74, which responds to 1,6-hexanediol, were developed and coupled to a fluorescent reporter gene, to construct a biosensor for specifically responding to 1,6-hexanediol and initiating fluorescent protein expression.
The specific response within the concentration range of 0-12g/L 1,6-hexanediol was achieved, which significantly improved the sensitivity and screening efficiency of the biosensor and reduced the screening cost and cycle.
Smart Images
Figure CN120442628A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of genetic engineering and fermentation engineering, and particularly relates to a promoter responsive to 1,6-hexanediol and application thereof. Background Art
[0002] 1,6-Hexanediol, an important aliphatic diol, is widely used in the synthesis of polymer materials such as polyurethanes, polyesters, and plasticizers. Currently, the biosynthesis of 1,6-Hexanediol has attracted considerable attention due to its green and sustainable nature. However, due to the lack of natural metabolic pathways, artificially designed non-natural synthetic pathways often face bottlenecks such as low efficiency of rate-limiting enzymes, limiting the efficiency of 1,6-Hexanediol biosynthesis.
[0003] In order to improve the catalytic performance of these key enzymes, protein engineering technology can be used to modify them in a targeted manner. Methods for rapidly screening beneficial mutations in large mutation libraries are crucial. Conventional screening efficiency is limited by low throughput and slow detection methods, resulting in high costs for screening a large number of mutants. Genetically encoded biosensors can couple the desired phenotype with a detectable signal, which not only greatly reduces screening costs but also significantly shortens the screening cycle, providing strong support for the rapid acquisition of high-performance enzyme mutants. The development of 1,6-hexanediol biosensors provides a powerful tool for the efficient screening of key enzyme mutants and provides a new method for optimizing the 1,6-hexanediol biosynthesis pathway. Summary of the Invention
[0004] Purpose of the Invention: This invention addresses the shortcomings of existing technologies by providing a 1,6-hexanediol-responsive promoter and its applications. The present invention aims to develop a promoter specifically responsive to 1,6-hexanediol. In the presence of 1,6-hexanediol, this promoter can effectively initiate the translation and expression of a downstream fluorescent reporter gene. By mutating the spacer sequence of the promoter gene, the response range and sensitivity of the 1,6-hexanediol biosensor are enhanced.
[0005] In order to solve the above technical problems, the present invention discloses a promoter responsive to 1,6-hexanediol and its application. The specific technical solution is as follows:
[0006] A promoter responsive to 1,6-hexanediol, wherein the nucleotide sequence of the promoter is shown in SEQ ID NO.1 or SEQ ID NO.2. mioC or P mioC -74, the P mioC The nucleotide sequence of P is shown in SEQ ID NO.1. mioC -74 nucleotide sequence is shown in SEQ ID NO.2, said P mioC -74 is in PmioC The mutation was performed based on .
[0007] In a second aspect, the present invention provides use of the promoter described in the first aspect in constructing a 1,6-hexanediol-specific biosensor.
[0008] In a third aspect, the present invention provides a biosensor comprising the promoter according to the first aspect.
[0009] Wherein, the biosensor is a recombinant vector carrying the promoter and target gene described in the first aspect.
[0010] The target gene is the green fluorescent protein encoding gene eGFP, and the nucleotide sequence of the green fluorescent protein encoding gene is shown in SEQ ID NO.4.
[0011] The recombinant vector is pcadR-GFP, and the nucleotide sequence of the pcadR-GFP is shown in SEQ ID NO. 3. The pcadR-GFP plasmid is connected to the multiple cloning site (MCS), rrnbT1, rrnbT2, and the green fluorescent protein encoding gene eGFP on pET28a (ΔlacIO). pET28a (ΔlacIO) is a pET28a plasmid with the lacO and lacI regions deleted, and the nucleotide sequence of the green fluorescent protein encoding gene eGFP is shown in SEQ ID NO. 4.
[0012] In a fourth aspect, the present invention provides a recombinant strain, wherein the recombinant strain contains the promoter described in the first aspect or the biosensor described in the third aspect.
[0013] Wherein, the recombinant strain uses Escherichia coli as the expression host. Preferably, the recombinant strain uses Escherichia coli BW25113 as the expression host. Further preferably, the recombinant strain is a strain into which the biosensor pcadR-P is introduced. mioC -gfp or pcadR-P mioC coli BW25113 containing pcadR-74 and p-gfp, respectively, and were named E. coli BW25113 / pcadR-P mioC -gfp or E. coli BW25113 / pcadR-P mioC -74–GFP.
[0014] Preferably, the present invention verifies the effect of the promoter described in the first aspect in response to 1,6-hexanediol by:
[0015] Different concentrations of 1,6-hexanediol were added to LB medium to culture the recombinant strain E. coli BW25113 / pcadR-P mioC -gfp or E. coli BW25113 / pcadR-P mioC -74-GFP, and the fluorescence intensity of the strains under different conditions was measured.
[0016] The results showed that 1,6-hexanediol was able to activate the expression of the promoter described in the first aspect of the present invention at 0 g / L to 12 g / L 1,6-hexanediol, thereby initiating the effective translation of the green fluorescent protein encoding gene.
[0017] In the 1,6-hexanediol concentration range of 0 g / L to 12 g / L, the fluorescence intensity of the green fluorescent protein expression driven by the promoter described in the first aspect of the present invention increases with the increase of the 1,6-hexanediol concentration.
[0018] In a fifth aspect, the present invention provides use of the promoter described in the first aspect or the biosensor described in the third aspect in screening key enzymes in the 1,6-hexanediol biosynthesis pathway.
[0019] The present invention also provides the use of the biosensor promoter in responding to different hexanediol concentrations.
[0020] Beneficial effects:
[0021] The present invention first discovered the promoter P of the mioC gene. mioC or P mioC -74 has the function of responding to the concentration of 1,6-hexanediol. It is coupled with the fluorescent reporter gene GFP. Expression analysis under different 1,6-hexanediol concentration conditions shows that this promoter can specifically respond to 1,6-hexanediol and has no concentration response to other polyols.
[0022] (1) At a 1,6-hexanediol concentration of 0 g / L to 12 g / L, the promoter of the present invention can specifically respond to 1,6-hexanediol and initiate the expression of the fluorescent protein gene, and the fluorescence intensity increases with the increase of the 1,6-hexanediol concentration.
[0023] (2) The present invention is to promote P mioC Mutation was performed, and the mutant P mioC -74 further improves the sensitivity of the biosensor. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more apparent.
[0025] Figure 1This is the plasmid map of the reporter plasmid pcadR-GFP.
[0026] Figure 2 P mioC Fluorescence intensity analysis of the promoter at different 1,6-hexanediol concentrations.
[0027] Figure 3 P mioC Response of promoter mutants obtained from the initial screening of the mutant library to 1,6-hexanediol.
[0028] Figure 4 The promoter mutant P mioC Comparison of fluorescence intensity of -74 at different 1,6-hexanediol concentrations.
[0029] Figure 5 The promoter mutant P mioC -74 responses to different polyols at different concentrations. DETAILED DESCRIPTION
[0030] In order to make the purpose, technical solutions and beneficial effects of the present invention more clear, the present invention is further described in detail below with reference to the accompanying drawings and specific embodiments. Examples of the embodiments are shown in the accompanying drawings. It should be understood that the specific embodiments described in the following embodiments of the present invention are only exemplary descriptions of the specific embodiments of the present invention, intended to be used for explaining the present invention, and do not constitute a limitation of the present invention.
[0031] Example 1 Promoter P mioC Construction of biosensors
[0032] The specific steps are as follows:
[0033] (1)P mioC PCR amplification of gene promoter fragments
[0034] The E. coli BL21 (DE3) genome published on NCBI was used as a template and primers P mioC -F and P mioC -R was used for PCR amplification to obtain the mioC promoter P of about 100 bp in length. mioC The fragment (its nucleotide sequence is shown in SEQ ID NO.1); the primer P mioC -F and P mioC The nucleotide sequence of -R is as follows:
[0035] P mioC -F: TGAACATGCCggaAGATTCTTcggcttttttaatcccatacttttccac
[0036] PmioC -R: CAAAATTATTTCTAGAGGATCCtgccataaaccgccacctt
[0037] (2)P mioC Obtaining gene promoter expression vector
[0038] The reporter plasmid pcadR-GFP (its nucleotide sequence is shown in SEQ ID NO.3) was double-digested with restriction endonucleases XbaI and BglII to obtain a linearized vector. The vector fragment was then combined with the P obtained in step (1) using a homologous recombination enzyme kit. mioC The fragments were connected to obtain a recombinant plasmid, which was transformed into E. coli BW25113 competent cells, and positive clones were selected to extract the plasmid. After colony PCR verification, the fusion expression vector pcadR-P was obtained. mioC -gfp. At the same time, the recombinant strain E. coli BW25113 / pcadR-P was obtained mioC -gfp.
[0039] The plasmid map of the reporter plasmid pcadR-GFP (its nucleotide sequence is shown in SEQ ID NO. 3) used in this example is as follows Figure 1 As shown, the reporter plasmid is connected to the multiple cloning site (MCS), rrnbT1, rrnbT2, and the green fluorescent protein encoding gene eGFP on pET28a (ΔlacIO). pET28a (ΔlacIO) is a pET28a plasmid with the lacO and lacI regions deleted. The nucleotide sequence of the green fluorescent protein encoding gene eGFP is shown in SEQ ID NO. 4.
[0040] Example 2 Promoter P in recombinant expression strain mioC Response to 1,6-hexanediol
[0041] The recombinant strain E. coli BW25113 / pcadR-P prepared in Example 1 was mioC -gfp was inoculated into LB medium and cultured at 37°C, 200 rpm for 12 hours to prepare a seed solution. LB medium in a 96-well shallow-well plate containing 0, 2, 4, 6, 8, 10, or 12 g / L of 1,6-hexanediol was inoculated at a 10% v / v inoculum and cultured at 37°C, 800 rpm for 12 hours.
[0042] OD was measured using a multifunctional microplate reader 600The fluorescence intensity of green fluorescent protein was measured using a Thermo fluorescence analyzer with an excitation wavelength of 485 nm and an emission wavelength of 526 nm. The fluorescence value was calculated to be proportional to the absorbance value. The relative fluorescence intensity results were compared as shown in the figure below. Figure 2 As shown. Figure 2 It can be seen that the biosensor pcadR-P mioC -gfp promoter P mioC The promoter P showed a significant concentration response to 1,6-hexanediol. When 2-12 g / L of 1,6-hexanediol was added, mioC It can efficiently initiate the expression of green fluorescent protein, and the fluorescence intensity increases with the increase of 1,6-hexanediol concentration.
[0043] Example 3 Mutant P mioC -74 optimized response to hexanediol
[0044] (1) Plasmid pcadR-P mioC -gfp was used as a template and PCR amplified with primers JB-F and JB-R. The PCR product was digested at 37°C for 1 hour under the action of Dpn I. The digested product was chemically transformed into E. coli BW25113 competent cells and recircularized to form a recombinant plasmid, obtaining a 1,6-hexanediol up-regulated promoter mutation library. First, the promoter mutation library was screened in 0g / L, 8g / L, and 12g / L hexanediol culture media to obtain multiple beneficial mutants, P mioC- 74 responded best to 1,6-hexanediol, i.e., P mioC- The fluorescence intensity of green fluorescent protein expression driven by 74 mutants can increase with the increase of 1,6-hexanediol concentration, while there is no obvious response relationship between the fluorescence intensity of green fluorescent protein expression driven by other promoter mutants and the concentration of 1,6-hexanediol. Figure 3 As shown, the mutated promoter P mioC- The nucleotide sequence of 74 is shown in SEQ ID NO. 2. The nucleotide sequences of the primers JB-F and JB-R involved are as follows:
[0045] JB-F:CCATACTTTTCCACAGGTAGATCCCANNNNNNNNNNNGCGTACAAT
[0046] JB-R:TGTGGAAAAGTATGGGATTAAAAAAGCCG
[0047] (2) The mutated promoter P mioC -74 composed of recombinant plasmid pcadR-P mioC -74-gfp
[0048] The recombinant strain E. coli BW25113 / pcadR-P was obtained by introducing the pcadR-P into E. coli BW25113. mioC -74-gfp was inoculated into LB medium and cultured at 37°C, 200 rpm for 12 h to prepare the seed solution. LB medium in a 96-well shallow-well plate containing 0 g / L, 2 g / L, 4 g / L, 6 g / L, 8 g / L, 10 g / L, and 12 g / L of 1,6-hexanediol was inoculated at a 10% v / v inoculum and cultured at 37°C, 800 rpm for 12 h.
[0049] OD was measured using a multifunctional microplate reader 600 The fluorescence intensity of green fluorescent protein was measured using a Thermo fluorescence analyzer with an excitation wavelength of 485 nm and an emission wavelength of 526 nm. The fluorescence value was calculated to be proportional to the absorbance value. The relative fluorescence intensity results were compared as shown in Figure 2. Figure 4 As shown. Mutant P mioC -74 promoter is more mioC The sensitivity and response range of the promoter to 1,6-hexanediol at 0-12 g / L were improved.
[0050] Example 4 Mutant P mioC -74's response to other polyols
[0051] The recombinant strain E. coli BW25113 / pcadR-P constructed in Example 3 was mioC -74-gfp was inoculated into LB medium and cultured at 37°C, 200 rpm for 12 hours to prepare a seed solution. LB medium in a 96-well shallow-well plate contained 0 g / L, 2 g / L, 4 g / L, 6 g / L, 8 g / L, 10 g / L, or 12 g / L of 1,6-hexanediol (or 1,2,4-butanetriol, or 1,4-butanediol, or 1,5-pentanediol). The seed solution was inoculated into each shallow-well plate at a 10% v / v inoculum and cultured at 37°C, 800 rpm for 12 hours.
[0052] OD was measured using a multifunctional microplate reader 600 The fluorescence intensity of green fluorescent protein was measured using a Thermo fluorescence analyzer with an excitation wavelength of 485 nm and an emission wavelength of 526 nm. The fluorescence value was calculated to be proportional to the absorbance value. The relative fluorescence intensity results were compared as shown in the figure below. Figure 5 As shown. Mutant P mioC -74 promoter only responded to 1,6-hexanediol concentration, that is, the mutant P mioCThe fluorescence intensity of the fluorescent protein expressed by the -74 promoter increased only with the increase of the concentration of 1,6-hexanediol, while the fluorescence intensity of the fluorescent protein expressed did not change significantly when the concentrations of other alcohols changed.
[0053] The present invention provides a 1,6-hexanediol-responsive promoter and its application concept and method. There are numerous methods and approaches for implementing this technical solution. The above description is merely a preferred embodiment of the present invention. It should be noted that those skilled in the art may make various improvements and modifications without departing from the principles of the present invention, and such improvements and modifications are also within the scope of protection of the present invention. Any components not specified in this embodiment may be implemented using existing technologies.
Claims
1. A promoter responsive to 1,6-hexanediol, characterized in that The nucleotide sequence of the promoter is shown as SEQ ID NO.1 or SEQ ID NO.
2.
2. Use of the promoter according to claim 1 in constructing a 1,6-hexanediol-specific biosensor.
3. A biosensor, characterized in that: The biosensor comprises the promoter according to claim 1.
4. The biosensor according to claim 3, wherein: The biosensor is a recombinant vector carrying the promoter and target gene according to claim 1.
5. The biosensor according to claim 4, wherein: The target gene is a green fluorescent protein encoding gene.
6. The biosensor according to claim 4, wherein: The recombinant vector is pcadR-GFP, and the nucleotide sequence of pcadR-GFP is shown in SEQ ID NO.
3.
7. A recombinant strain, characterized in that The recombinant strain contains the promoter according to claim 1 or the biosensor according to any one of claims 3 to 6.
8. The recombinant strain according to claim 7, characterized in that The recombinant strain uses Escherichia coli as an expression host.
9. The recombinant strain according to claim 8, characterized in that The recombinant strain uses Escherichia coli BW25113 as an expression host.
10. Use of the promoter according to claim 1 or the biosensor according to any one of claims 3 to 6 in screening key enzymes in the 1,6-hexanediol biosynthesis pathway.