Cronobacter sakazakii aptamer and preparation method of fluorescence quenching type biosensor
Through the fluorescence quenching biosensor of Sakazaki Cronobacterium aptamer, the problem of long-term and low sensitivity of Sakazaki Cronobacterium detection in food is solved, and fast and accurate food safety detection is achieved, which is suitable for a variety of food sample scenarios.
Patent Information
- Application Number
- CN202510648730.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2045-05-20
AI Technical Summary
The prior art is difficult to quickly and accurately detect Cronoba sakazaki in food. The traditional method takes a long time, has low sensitivity, and has high requirements for equipment and technicians. It is not suitable for large-scale routine testing.
The use of Kronobacter Sakazaki and its fluorescence quenching biosensor is used to specifically bind the surface of the target bacteria through nucleic acid aptamers, and the rapid detection is achieved by combining fluorescence technology. The preparation method is simple, and only a mixture of fluorescence probes and quenching probes are required.
It realizes rapid detection with high specificity and low detection limit, and can complete sample processing and fluorescence measurement within 40 minutes. It is suitable for real-time monitoring in food production, reducing detection costs and personnel training needs, and has strong adaptability.
Smart Images

Figure CN120442634A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biosensors, and in particular relates to a method for preparing a Cronobacter sakazakii aptamer and a fluorescence quenching biosensor thereof. Background Art
[0002] Food safety is a growing concern in the modern food industry, particularly during the production and processing of prepared or cooked foods. Cronobacter sakazakii, a significant foodborne pathogen, has attracted widespread attention due to its presence in infant formula. This bacterium can cause serious health problems, such as bacterial meningitis, sepsis, and necrotizing enterocolitis, particularly in infants whose immune systems are not yet fully developed. This bacterium primarily transmits infection through the ingestion of contaminated food, particularly infant formula, making ensuring food safety a critical issue in the food industry. Cronobacter sakazakii is highly adaptable to its environment and can survive long periods of dryness and low moisture conditions. This makes it a potential risk factor in prepared foods, particularly in milk powder, cereals, spices, and other dry foods. Traditional food processing and disinfection methods, such as high-temperature sterilization and chemical disinfectants, while effective in killing most bacteria, are often ineffective against the biofilms and desiccation resistance of Cronobacter sakazakii. In addition, the bacteria can form biofilms in production equipment and the environment, increasing the difficulty of removal.
[0003] Currently, the detection of Cronobacter sakazakii in food relies primarily on microbial culture and molecular biology techniques. Microbial culture requires multiple steps, including pre-enrichment, selective culture, and biochemical identification, and typically takes several days to produce results. While reliable, this method is time-consuming and labor-intensive, making it difficult to meet the demand for rapid testing. Molecular biology techniques, such as PCR and real-time PCR, can provide test results within hours, but they require high equipment and technical personnel, are expensive, and are unsuitable for large-scale routine testing. Aptamers are single-stranded DNA or RNA molecules obtained through in vitro screening that can specifically bind to target molecules. Compared to traditional antibodies, aptamers offer advantages such as simple synthesis, high stability, and ease of modification. In recent years, the application of aptamers in food safety testing has made significant progress. Aptamers can specifically bind to the surface of target bacteria, enabling highly sensitive and specific detection.
[0004] Aptamers hold great promise for application in food safety testing. Further optimization of aptamer screening and modification techniques can enhance their stability and specificity in diverse food matrices. Furthermore, combined with fluorescence technology and portable detection devices, aptamer fluorescent probes have the potential to enable real-time, online detection during food production and processing, ensuring food safety. Summary of the Invention
[0005] In view of the problems of existing detection technology for Listeria monocytogenes in food, such as high detection difficulty, long detection time and low sensitivity, the present invention provides a Cronobacter sakazakii aptamer and a method for preparing a fluorescence quenching biosensor based on the Cronobacter sakazakii aptamer.
[0006] The DNA sequence of a Cronobacter sakazakii aptamer is shown in SEQ ID No: 1; the Cronobacter sakazakii aptamer specifically recognizes Cronobacter sakazakii.
[0007] The steps for preparing the fluorescence quenching biosensor of the Cronobacter sakazakii aptamer are as follows:
[0008] (1) Preparation of activation mixture
[0009] 10 mM 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 5 mM N-hydroxysuccinimide were mixed in a volume ratio of 2:1 to obtain an activation mixture;
[0010] (2) Preparation of the first aptamer solution
[0011] 10 uM of the aptamer represented by the DNA sequence SEQ ID No: 1 was added to 180 uL of the activation mixture to prepare a first aptamer solution with a molar concentration of 10 uM;
[0012] (3) Preparation of the second aptamer solution
[0013] 10 uM of the aptamer represented by the DNA sequence SEQ ID No: 2 was added to 180 uL of the activation mixture to prepare a second aptamer solution with a molar concentration of 10 uM;
[0014] The aptamer shown in the DNA sequence SEQ ID No: 2 is gggtcggggg tggtgggtgg gggttctcgtctggcttcgg;
[0015] (4) Preparation of fluorescent probes
[0016] 2g of citric acid and 2g of L-cysteine were added to 30mL of ultrapure water, dissolved by ultrasonication, heated to 180°C, maintained at 180°C for 1.5 hours, and cooled to room temperature. The reaction solution was dialyzed for 5 days to obtain a brown reaction solution. 500uL of the brown reaction solution was vortex-mixed with 200uL of the activation mixture and incubated on a shaker for 40 minutes. 100uL of the first aptamer solution was then added and incubated on a shaker for 3 hours to prepare the fluorescent probe.
[0017] (5) Preparation of quenching probe
[0018] 1 mL of 1% tetrachloroauric acid solution was added to 120 mL of distilled water, and the mixture was boiled. 3 mL of 1% trisodium citrate solution was added, and the mixture was boiled for 18 minutes and cooled to room temperature to obtain a gold nanoparticle solution.
[0019] 100 μL of the second aptamer solution was incubated in a 95°C water bath for 5 minutes and cooled to room temperature. 10 μL of a 3-(2-formylethyl)phosphine hydrochloride solution with a final concentration of 2.867 g / L was added and the mixture was allowed to react for 40 minutes. 1.2 mL of the gold nanoparticle solution was then added and the mixture was incubated at 37°C for 16 hours. The supernatant was removed by centrifugation. 500 μL of a pH 7.4 phosphate buffer was added to the precipitate and resuspended to prepare a quenched probe.
[0020] (6) Preparation of biosensors
[0021] The fluorescent probe and the quenching probe were mixed at a volume ratio of 1:1.8 to prepare a fluorescence quenching biosensor.
[0022] Further preparation technology scheme is as follows:
[0023] In step (4), when the fluorescence emission wavelength of the fluorescent probe shifts from 424 nm to 420 nm, it indicates that the first aptamer is successfully modified onto the fluorescent material.
[0024] In step (5), when the ultraviolet absorption wavelength of the gold nanoparticles shifts from 520 nm to 523 nm, it indicates that the second aptamer has been successfully modified onto the gold nanoparticles.
[0025] The beneficial technical effects of the present invention are embodied in the following aspects:
[0026] 1. The present invention provides a Cronobacter sakazakii aptamer. Through efficient aptamer screening and the application of a fluorescence quenching biosensor, the detection performance of Cronobacter sakazakii is significantly improved. The Cronobacter sakazakii aptamer obtained through screening (DNA sequence shown in SEQ ID No: 1) can specifically recognize target bacteria. Experimental verification shows that the Cronobacter sakazakii aptamer has a high flow cytometric binding rate of 80.7% with Cronobacter sakazakii and an affinity constant of 18.59 nM. Cross-reactivity with other common foodborne pathogens (such as Staphylococcus aureus, Salmonella, Escherichia coli, Listeria monocytogenes, and Pseudomonas aeruginosa) is low (6.8%, 9.7%, 23.7%, 20.5%, and 17.4%, respectively). This high specificity ensures accurate detection results and avoids interference from non-target bacteria, making it particularly suitable for the precise identification of Cronobacter sakazakii in food safety testing. The detection method based on a fluorescence quenching biosensor achieves a detection limit as low as 4.27 CFU / mL, far exceeding the sensitivity of traditional detection methods. Experimental data demonstrates a linear relationship between the fluorescence intensity ratio (F / F0) and the logarithm of the Cronobacter sakazakii concentration (linear regression equation: y = -0.09515x + 1.03153, correlation coefficient: r² = 0.993), enabling reliable detection at extremely low concentrations. This property meets the stringent requirements for trace pathogen detection in food safety testing and is particularly suitable for high-risk foods such as infant formula. Compared to traditional microbial culture methods (which take several days) and molecular biology techniques (such as PCR, which take several hours), the fluorescence quenching biosensor for Cronobacter sakazakii can complete detection in a fraction of the time. From sample preparation to fluorescence intensity measurement, the entire process can be completed within 40 minutes, significantly improving detection efficiency. This rapidity makes it suitable for real-time monitoring during food production, effectively reducing contamination risks.
[0027] Analysis of the design mechanism of this invention reveals that when the sensor is not bound to the target bacterium, the fluorescent probe and the quenching probe maintain contact through the spatial proximity of the aptamer, and the gold nanoparticles efficiently quench the fluorescence (F0 approaches 0). However, upon the presence of Cronobacter sakazakii, its surface proteins specifically bind to the aptamer on the fluorescent probe, causing the fluorescent probe to detach from the quenching probe surface and a rapid recovery of the fluorescence signal (F value increases). This process is essentially a steric change driven by molecular recognition, requiring no enzymatic reaction or chemical modification. The reaction kinetics are determined solely by the aptamer-target binding rate (on the order of minutes), rather than the amplification or incubation time required in traditional methods.
[0028] 2. The preparation method of the fluorescence quenching biosensor of the present invention is simple. It only requires the preparation of fluorescent material by reacting citric acid and L-cysteine, and then combining it with a nucleic acid aptamer. It does not rely on complex equipment or high technical barriers.
[0029] The fluorescence quenching biosensor of this invention overcomes the time bottleneck of traditional detection technologies through the collaborative design of "rapid target recognition by high-affinity aptamers, instant signal conversion by nanomaterials, and a simplified amplification-free process." The molecular recognition kinetics of the aptamer (binding equilibrium in minutes), the instantaneous quenching effect of the gold nanoparticles, and the pretreatment-free detection process ensure that the entire process, from sample preparation to fluorescence measurement, is completed within 40 minutes. This rapid detection feature is particularly suitable for real-time monitoring of food production and emergency response to sudden contamination incidents, providing a highly efficient solution for the rapid detection of trace pathogens.
[0030] 3. The fluorescence quenching biosensor of the present invention is used to detect Cronobacter sakazakii. The detection process only requires mixing the fluorescence quenching biosensor with the sample to be tested and measuring the fluorescence intensity after incubation. There are few operation steps and it is easy to promote and apply in the laboratory and on-site. The simple operation reduces the detection cost and personnel training requirements, and has good practicality. The nucleic acid aptamer has high chemical and thermal stability and can maintain its recognition function under different environmental conditions (such as temperature changes, pH fluctuations). The fluorescent probe can maintain its performance for a long time when stored in the dark at 4°C, ensuring the reliability and repeatability of the detection method. This stability makes it suitable for a variety of food sample detection scenarios, especially during transportation and storage. The method performs well in real food samples (such as pre-prepared conditioned beef balls) and can accurately detect Cronobacter sakazakii even in complex matrices with high protein, high salt, and high fat. The measured concentration (0.99×10 6 CFU / mL and the actual concentration (1.00×10 6 The results are highly consistent across the entire sample (CFU / mL). No new standard curves need to be established for each sample; the linear regression equation based on PBS buffer can be used universally, demonstrating excellent adaptability. This versatility enables widespread application in a variety of food testing scenarios, enhancing the technology's dissemination value. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 is the secondary structure diagram of the Cronobacter sakazakii aptamer;
[0032] Figure 2 The three-dimensional structure of the membrane protein matched for molecular docking of Cronobacter sakazakii aptamer;
[0033] Figure 3 This is the application principle diagram of fluorescence detection;
[0034] Figure 4 TEM image of gold nanoparticles detected by fluorescence quenching;
[0035] Figure 5FT-IR chromatogram of fluorescent carbon dots detected by fluorescence quenching;
[0036] Figure 6 The relative fluorescence intensity diagram of the aptamer before and after covalent coupling with gold nanoparticles for fluorescence quenching detection;
[0037] Figure 7 The UV absorption graph of the nucleic acid aptamer before and after covalent coupling with gold nanoparticles for fluorescence quenching detection;
[0038] Figure 8 This is the standard curve of different concentrations of Cronobacter sakazakii detected by fluorescence quenching;
[0039] Figure 9 Specific detection diagram of various bacteria using fluorescence quenching detection. DETAILED DESCRIPTION
[0040] The present invention is described in detail below with reference to specific embodiments.
[0041] Unless otherwise defined, technical and scientific terms used in the following examples have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0042] The present invention is described in detail below with reference to specific embodiments.
[0043] Unless otherwise defined, technical and scientific terms used in the following examples have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0044] Unless otherwise specified, the raw materials used in the following examples are all conventional biochemical reagents; the experimental methods described are all conventional methods unless otherwise specified; the quantitative tests in the following examples are all repeated three times, and the results are averaged unless otherwise specified; the percentages in the following examples are all weight percentages, unless otherwise specified.
[0045] In the following examples, the synthesized aptamers were purchased from Sangon Biotech (Shanghai) Co., Ltd.; unless otherwise specified, other raw materials used were purchased from Sinopharm Chemical Reagent Co., Ltd.
[0046] It should be noted that the phosphate buffer used in this application is a sterile PBS buffer with a pH of 7.4 and a 0.1 M concentration.
[0047] It should be noted that all bacterial strains used in this application were purchased from the American Type Culture Collection (ATCC).
[0048] The strains of Cronobacter sakazakii are numbered ATCC 14028, Staphylococcus aureus are numbered ATCC 29213, Listeria monocytogenes are numbered ATCC 43251, Escherichia coli are numbered ATCC 25922, Cronobacter sakazakii are numbered ATCC 29544, and Pseudomonas aeruginosa are numbered ATCC 15442. Furthermore, the aforementioned strains were purchased through overseas agents such as Hefei Xiyue Biotechnology Co., Ltd.
[0049] It should be noted that the instruments, equipment, raw materials, reagents or method steps used in this application are ensured to be handled under sterile conditions.
[0050] It should be noted that the instruments, equipment, raw materials, reagents or method steps not mentioned in this application are conventional or well-known technical methods for those skilled in the art and will not be described in detail in this application.
[0051] Example 1
[0052] This Example 1 provides a Cronobacter sakazakii aptamer, whose DNA sequence is shown in SEQ ID No: 1. The Cronobacter sakazakii aptamer is a nucleic acid aptamer, see Figure 1 Secondary structure of Cronobacter sakazakii aptamer, such as RNAStructure analysis Figure 1 shown.
[0053] The binding test referred to the "aptamer binding test" and "affinity constant determination" involved in "Screening and identification of aptamers for Vibrio parahaemolyticus based on whole-bacteria SELEX technology_Lou Xiuqin", and the same test was performed using this bacterium. The flow cytometry binding rate was 80.7%, and the result of the affinity constant determination was 18.59nM. At the same time, the flow cytometry binding rates of Staphylococcus aureus, Listeria monocytogenes, Escherichia coli, Salmonella and Pseudomonas aeruginosa were 6.8%, 9.7%, 23.7%, 20.5% and 17.4%, respectively. The nucleic acid aptamers we screened are close to the highest known publicly available level (for example, the source article DOI of SEQ ID No: 2 is: 10.3168 / jds.2021-20898. The same test showed that its flow cytometry binding rate was 81.6%, and the affinity constant was determined to be 34 nM). The nucleic acid aptamers we obtained are feasible and meet the requirements of use. In addition, when Cronobacter sakazakii is at a low concentration, the low affinity constant leads to a more stable binding state.
[0054] In addition, the screening method for the DNA sequence of Cronobacter sakazakii aptamer is as follows:
[0055] (1) Construction of the membrane protein structure of Cronobacter sakazakii
[0056] Obtain the amino acid sequence and structural information of the membrane protein OmpA of Cronobacter sakazakii, Figure 2 As shown;
[0057] Specifically, search protein databases (such as the PDB) for the crystal structure or homology modeled structure of the Cronobacter sakazakii OmpA protein. If no experimentally resolved structure is available, construct a three-dimensional structural model using homology modeling software (such as MODELLER or SWISS-MODEL). Optimize the resulting OmpA protein structure, including hydrogenation and energy minimization, to obtain a reasonably stable initial structure.
[0058] (2) Perform molecular docking test on the membrane protein of Cronobacter sakazakii obtained in step (1)
[0059] The random design capacity is 10 14 A short-chain oligoDNA fragment library is prepared, wherein the length of the short-chain oligoDNA fragment ranges from 40bp to 70bp; the structural information of the membrane protein OmpA protein of Cronobacter sakazakii in step (1) is imported into the AutoDock-Vina molecular simulation software, and then the short-chain oligoDNA fragment library is molecularly docked with the surface domain of the membrane protein OmpA protein to obtain the free energy of binding between each short-chain oligoDNA fragment and the membrane protein OmpA protein.
[0060] The screening of nucleic acid aptamers usually adopts SELEX technology, which uses multiple rounds of enrichment and screening to generate a large number of nucleic acid aptamers from a pool containing up to 10 14 Aptamers with high affinity and specificity for the target molecule are screened from a library of single-stranded oligonucleotides containing multiple distinct nucleic acid sequences. However, a major drawback of SELEX technology is its long screening cycle, which typically requires weeks or even months to obtain specific candidate aptamers. Furthermore, the aptamer sequences obtained by screening are often long and contain redundant base sequences, resulting in high synthesis costs and the susceptibility to side reactions during detection.
[0061] DNA sequences can be randomly generated using programming languages (such as Python) or specialized DNA sequence generation tools (such as DNAWorks). The selected short oligoDNA fragments can be converted into three-dimensional structures. DNA three-dimensional structure modeling tools (such as 3dna and NAB) can be used to convert the DNA sequences into three-dimensional structure coordinate files in PDB format for subsequent molecular docking. Furthermore, three-dimensional structure coordinate files are also beneficial for the application of distance optimization models such as ant colony algorithms. The conversion to a three-dimensional structure is particularly important.
[0062] In addition, the AutoDock-Vina molecular simulation software was used for molecular docking. The structure files of the OmpA protein and DNA fragment were imported into AutoDock Tools, and polar hydrogen atoms, charges, etc. were added to the receptor and ligand molecules. The operation is as follows:
[0063] Load the receptor molecule in AutoDock Tools: Open the AutoDock Tools software, select "File"->"Read Molecule" in the menu bar, select the PDB file of the OmpA protein and open it. Select "Hydrogens"->"Add" in the "Edit" menu to add polar hydrogen atoms to the protein molecule. Select "Charges"->"Add Kollman Charges" in the "Edit" menu to add Kollman charges to the protein molecule. Select "Atoms"->"Assign AD4 Type" in the "Edit" menu to assign the AutoDock 4 atom type to the protein atoms. Select "Macromolecule"->"Choose" in the "Grid" menu to select the processed protein molecule. Select "Save"->"Write PDBQT" in the "File" menu to save the processed protein molecule as a PDBQT format file. Load the ligand molecule in AutoDock Tools: Select "File"->"Read Molecule" in the menu bar of AutoDock Tools, select the PDB file of the DNA fragment and open it. Under the "Ligand" menu, select "Input"->"Choose" to select the loaded DNA molecule. Under the "Ligand" menu, select "Torsion Tree"->"Detect Root" to automatically detect the root atoms of the DNA molecule. Under the "Ligand" menu, select "Torsion Tree"->"Choose Torsions" to define the rotatable bonds of the DNA molecule. Under the "Ligand" menu, select "Output"->"Save as PDBQT" to save the processed DNA molecule as a PDBQT format file. Define the docking area: In AutoDock Tools, select "Grid Box" under the "Grid" menu to open the grid box settings window. Adjust the size and position of the grid box so that it covers the expected DNA binding site on the receptor protein. You can refer to known nucleic acid binding sites, or use blind docking to cover the entire protein surface. Under the "File" menu, select "Save"->"SaveGPF" to save the grid parameters as a GPF file for subsequent docking calculations. Through the above steps, the OmpA protein and DNA fragment were imported into AutoDock Tools, and the necessary information such as polar hydrogen atoms and charges were added to them. At the same time, the area for docking calculation was also defined.
[0064] In addition, a suitable docking region is defined on the OmpA protein surface (typically a known or predicted nucleic acid binding site) and a grid parameter file for this region is generated. The Vina algorithm is then used to perform a molecular docking search. With each DNA fragment acting as a ligand and the OmpA protein as a receptor, a stable binding conformation is searched within the defined docking region. The docking process can be controlled by adjusting parameters such as search accuracy and exhaustiveness. After docking is complete, Vina outputs a list of top-scoring docking conformations and their binding free energies. For each DNA fragment, the conformation with the lowest binding free energy is selected as the representative conformation for its binding to the OmpA protein.
[0065] (3) Optimize the molecular docking results obtained in step (2) using the ant colony algorithm model
[0066] The improved ant colony algorithm model is used to optimize the free energy of the above binding, where the algorithm formula of the model is as follows:
[0067] (I),
[0068] (II),
[0069] Where, Represents ants Slave nodes To Node The transition probability value of express Time Node To Node The pheromone concentration, express Time Node To Node The constant heuristic function, α represents the pheromone enhancement coefficient, β represents the heuristic information coefficient, represents the specified position of the binding free energy of a short oligopeptide fragment, express Time Node To Node The pheromone concentration, express Time Node To Node The constant heuristic function of express Node Next allows the selection of node sets, Represents ants Passage Node To Node The sum of the pheromones released, Indicates the pheromone volatility coefficient (0< <1), Represents ants Passage Node To Node Increased amounts of pheromones released;
[0070] According to the results of the optimization process, statistics The corresponding short-chain oligoDNA fragments were used to obtain the matching nucleic acid aptamers of Cronobacter sakazakii. Finally, the nucleic acid secondary structure prediction software (such as mfold, RNAstructure, etc.) was used to predict the structure of the generated DNA sequences and screen out DNA sequences that can form suitable secondary structures (such as hairpins, stem-loops, etc.).
[0071] Example 2
[0072] The steps for preparing a biosensor using the Cronobacter sakazakii aptamer of Example 1 are as follows:
[0073] (1) Preparation of activation mixture
[0074] 10 mM 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 5 mM N-hydroxysuccinimide were mixed at a volume ratio of 1:1 to obtain an activation mixture.
[0075] (2) Preparation of the first aptamer solution
[0076] 10 uM of the aptamer represented by DNA sequence SEQ ID No: 1 was added to 180 uL of the activation mixture to prepare a first aptamer solution with a molar concentration of 10 uM. The 5' end of the first aptamer was modified with an amino group; see Figure 6 When the fluorescence emission wavelength of the fluorescent material shifts from 424 nm to 420 nm, it indicates that the first aptamer in the fluorescence quenching biosensor is successfully modified onto the fluorescent material.
[0077] (3) Preparation of the second aptamer solution
[0078] 10 uM of the aptamer represented by the DNA sequence SEQ ID No: 2 was added to 180 uL of the activation mixture to prepare a second aptamer solution with a molar concentration of 10 uM. The aptamer represented by the DNA sequence SEQ ID No: 2 is gggtcgggggtggtgggtgg gggttctcgt ctggcttcgg. The 5' end of the second aptamer was modified with a thiol group. Where "1" represents the UV absorption spectrum curve before covalent coupling, and "2" represents the UV absorption spectrum curve after covalent coupling. See Figure 7 When the ultraviolet absorption wavelength of gold nanoparticles shifts from 520nm to 523nm, it indicates that the nucleic acid aptamer in the fluorescent probe is successfully modified onto the gold nanoparticles.
[0079] (4) Preparation of fluorescent probes
[0080] Add 2g of citric acid and 2g of L-cysteine to 30mL of ultrapure water, sonicate, heat to 180°C, maintain the reaction at 180°C for 1.5 hours, and cool to room temperature. Dialyze for 5 days to obtain a brown reaction solution. Vortex mix 500uL of the brown reaction solution with 200uL of the activation mixture and incubate on a shaker for 40 minutes. Then add 100uL of the first aptamer solution and incubate on a shaker for 3 hours to prepare the fluorescent probe. Figure 4 and Figure 5 .
[0081] (5) Preparation of quenching probe
[0082] 1 mL of 1% tetrachloroauric acid solution was added to 120 mL of distilled water, and the mixture was boiled. 3 mL of 1% trisodium citrate solution was added, and the mixture was boiled for 18 minutes. The mixture was cooled to room temperature to obtain a gold nanoparticle solution.
[0083] Place 100uL of the second aptamer solution in a 95°C water bath for 5 minutes and cool to room temperature; add 10uL of 3-(2-formylethyl)phosphine hydrochloride solution with a final concentration of 2.867g / L and let it react for 40 minutes; then add 1.2mL of gold nanoparticle solution, incubate at 37°C for 16 hours, and remove the supernatant by centrifugation; add 500uL of pH 7.4 phosphate buffer to the precipitate and resuspend it to prepare the quenched probe.
[0084] (6) Preparation of biosensors
[0085] The fluorescent probe and the quenching probe were mixed at a volume ratio of 1:1.8 to prepare a fluorescence quenching biosensor.
[0086] Example 3
[0087] The principle of using the fluorescence quenching biosensor prepared in Example 2 to detect Cronobacter sakazakii is as follows: Figure 3 As shown, the operation steps are as follows:
[0088] (1) Establishment of linear regression equation: Prepare a test solution of the test sample that does not contain bacteria, set it as a blank control test solution, and artificially contaminate the blank control test solution with Cronobacter sakazakii, and set a linear gradient dilution of the bacteria-containing test solution.
[0089] The fluorescence quenching biosensor was mixed with the blank control test solution and the bacteria-containing test solution at a volume ratio of 1:1, and incubated for 40 minutes to obtain an incubation solution.
[0090] Under an excitation wavelength of 365 nm, the fluorescence intensity of the incubation solution at an emission wavelength of 420 nm was measured, where the fluorescence intensity of the blank control test solution was recorded as F0, and the fluorescence intensity of the bacteria-containing test solution was recorded as F; a standard curve was plotted with the fluorescence intensity ratio F / F0 as the ordinate and the logarithm of the bacterial concentration of the bacteria-containing test solution as the abscissa to obtain a linear regression equation, and the correlation coefficient and detection limit were obtained.
[0091] (2) Detection of Cronobacter sakazakii in the test sample: prepare a test solution of the test sample, mix the fluorescence quenching biosensor with the test solution at a volume ratio of 1:1, incubate for 40 minutes, and obtain an incubation solution; measure the fluorescence intensity of the incubation solution at an emission wavelength of 420 nm under an excitation wavelength of 365 nm.
[0092] The obtained fluorescence intensity ratio F1 / F0 is substituted into the linear regression equation obtained in step (2) to obtain the concentration of Cronobacter sakazakii in the sample to be tested.
[0093] During the experiment, PBS buffer was selected as the blank control test solution. At the same time, the bacterial solution of Cronobacter sakazakii was centrifuged and washed three times with PBS buffer, and then resuspended and gradiently diluted with PBS buffer to prepare concentrations of 10 1 CFU / mL, 10 2 CFU / mL, 10 3 CFU / mL, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL, 10 7 CFU / mL of bacteria-containing test solution. First, 100uL of the prepared fluorescence quenching biosensor was taken and incubated with 100uL of blank control test solution and 100uL of gradiently diluted bacteria-containing test solution at 37°C for 40 minutes to obtain incubation solution. Then, the fluorescence intensity of the incubation solution was measured at an excitation wavelength of 365nm and an emission wavelength of 420nm. The fluorescence intensity of the blank control test solution was recorded as F0, and the fluorescence intensity of the bacteria-containing test solution was recorded as F. A standard curve was plotted with the fluorescence intensity ratio F / F0 as the ordinate and the logarithm of the bacterial concentration of the bacteria-containing test solution as the abscissa. The linear regression equation was obtained, and the correlation coefficient and detection limit were obtained.
[0094] The fluorescence quenching biosensor prepared by the present invention has a fluorescent probe with an obvious fluorescence emission peak at 420nm. At the same time, the ratio between the fluorescence intensity value F at 420nm and the fluorescence intensity value F0 at 420nm is linearly related to the logarithm of the bacterial concentration of Cronobacter sakazakii.
[0095] At the same time, see the fluorescence spectrum curves from top to bottom, respectively: Curve 0 represents the fluorescence spectrum curve with a bacterial concentration of 0 CFU / mL (blank control test solution), Curve 1 represents the fluorescence spectrum curve with a bacterial concentration of 10 1 The fluorescence spectrum curve of CFU / mL, curve 2 indicates that the bacterial concentration is 10 2 The fluorescence spectrum curve of CFU / mL, curve 3 indicates that the bacterial concentration is 10 3 The fluorescence spectrum curve of CFU / mL, curve 4 indicates that the bacterial concentration is 10 4 The fluorescence spectrum curve of CFU / mL, curve 5 indicates that the bacterial concentration is 10 5 The fluorescence spectrum curve of CFU / mL, curve 6 indicates that the bacterial concentration is 10 6 The fluorescence spectrum curve of CFU / mL, curve 7 indicates that the bacterial concentration is 10 7 CFU / mL fluorescence spectrum curve; at the same time, see Figure 8 The quotient ratio between the fluorescence intensity value F at 420 nm and the fluorescence intensity value F0 at 420 nm on the fluorescence spectrum curve is taken as the ordinate, and the logarithm of the bacterial concentration corresponding to each fluorescence spectrum curve is taken as the abscissa. The linear regression equation is y=-0.09515x+1.03153, and the correlation coefficient (r 2 ) was 0.993, and the detection limit was 4.27 CFU / mL.
[0096] In addition, specific detection tests of fluorescence quenching biosensors were performed:
[0097] Cronobacter sakazakii was replaced with Staphylococcus aureus, Salmonella, Escherichia coli, Listeria monocytogenes, and Pseudomonas aeruginosa; and the concentration was 1.0x10 6 CFU / mL of the test solution containing bacteria.
[0098] See also Figure 9 It can be seen that the fluorescence intensity ratios F / F0 of the bacteria-containing test solutions after adding Staphylococcus aureus, Salmonella, Escherichia coli, Listeria monocytogenes, and Pseudomonas aeruginosa are 0.99±0.02, 0.93±0.04, 0.91±0.03, 0.96±0.02, and 0.94±0.02, respectively. At the same time, under the same conditions, the fluorescence intensity ratio F / F0 of the bacteria-containing test solution after adding Listeria monocytogenes is 0.41. In addition, under the same conditions, the fluorescence intensity ratio F0 / F0 of the blank control test solution is 1. This shows that the fluorescence quenching biosensor prepared by the present invention has good specificity for Listeria monocytogenes.
[0099] Example 4
[0100] On the basis of Example 3, the detection of real food samples was added, and pre-prepared prepared foods and the Cronobacter sakazakii nucleic acid aptamers designed by the present invention were selected for testing:
[0101] It should be noted that in order to verify whether the above-mentioned standard curve can be effectively applied to the determination in an interference environment (prepared prepared foods), the difference between the number of bacteria detected by the probe in artificial quantitative contamination and preparatory prepared foods was respectively carried out to find out that even in real samples, the fluorescent probe established by the present invention can effectively perform detection under the influence of nutrients such as high protein, high salt, and high fat.
[0102] It should be noted that the pre-made conditioned beef meatballs involved in this embodiment were purchased from a food company. The product standard number is DB44 / 005-2016, and its ingredients (per 100g) are as follows: 26g protein, 9.8g fat, 2.4g starch, and 428KJ energy.
[0103] During the experiment, 1 mL of pre-prepared beef balls were artificially inoculated with Cronobacter sakazakii. The final concentration of Cronobacter sakazakii after inoculation was 1.00x10 6 CFU / mL, centrifuge at 5000×g for 5 min, discard the supernatant, resuspend the precipitate with 1 mL of PBS buffer as the bacteria-containing test solution, then take 500uL of the test solution and mix it with 500uL of the prepared fluorescence quenching biosensor, incubate for 40 min to obtain an incubation solution, then measure the fluorescence intensity of the incubation solution at an emission wavelength of 420nm under an excitation wavelength of 365nm, where the fluorescence intensity of the blank control test solution is recorded as F0, and the fluorescence intensity of the bacteria-containing test solution is recorded as F. Finally, according to the obtained fluorescence intensity ratio F / F0, it is substituted into the linear regression equation obtained above to obtain the concentration of Cronobacter sakazakii in the test sample.
[0104] The experimental results show that, according to calculations, the concentration of Cronobacter sakazakii measured by the fluorescent probe in the environment of artificial inoculation of Cronobacter sakazakii in prepared foods is 0.99x10 6 CFU / mL, almost the same as its actual concentration (1.00x10 6 CFU / mL) is close. It can be seen that even if the corresponding standard curve and linear regression equation are not established in the pre-prepared prepared food environment, the standard curve and linear regression equation established in the pure PBS solution environment can still have good versatility. This shows that the fluorescent probe prepared by the present invention has good versatility and can be quickly applied to different sample detection.
[0105] It will be easily understood by those skilled in the art that the above embodiments are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A Cronobacter sakazakii aptamer, characterized in that: The DNA sequence of the Cronobacter sakazakii aptamer is shown in SEQ ID No: 1; the Cronobacter sakazakii aptamer specifically recognizes Cronobacter sakazakii.
2. A method for preparing a fluorescence quenching biosensor based on the Cronobacter sakazakii aptamer according to claim 1, characterized in that: The steps are as follows: (1) Preparation of activation mixture 10 mM 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 5 mM N-hydroxysuccinimide were mixed in a volume ratio of 1:1 to obtain an activation mixture; (2) Preparation of the first aptamer solution 10 uM of the aptamer represented by the DNA sequence SEQ ID No: 1 was added to 180 uL of the activation mixture to prepare a first aptamer solution with a molar concentration of 10 uM; (3) Preparation of the second aptamer solution 10 uM of the aptamer represented by the DNA sequence SEQ ID No: 2 was added to 180 uL of the activation mixture to prepare a second aptamer solution with a molar concentration of 10 uM; The aptamer shown in the DNA sequence SEQ ID No: 2 is gggtcggggg tggtgggtgg gggttctcgtctggcttcgg; (4) Preparation of fluorescent probes 2g of citric acid and 2g of L-cysteine were added to 30mL of ultrapure water, dissolved by ultrasonication, heated to 180°C, maintained at 180°C for 1.5 hours, and cooled to room temperature. The reaction solution was dialyzed for 5 days to obtain a brown reaction solution. 500uL of the brown reaction solution was vortex-mixed with 200uL of the activation mixture and incubated on a shaker for 40 minutes. 100uL of the first aptamer solution was then added and incubated on a shaker for 3 hours to prepare the fluorescent probe. (5) Preparation of quenching probe 1 mL of 1% tetrachloroauric acid solution was added to 120 mL of distilled water, and the mixture was boiled. 3 mL of 1% trisodium citrate solution was added, and the mixture was boiled for 18 minutes and cooled to room temperature to obtain a gold nanoparticle solution. 100 μL of the second aptamer solution was incubated in a 95°C water bath for 5 minutes and cooled to room temperature. 10 μL of a 2.867 g / L 3-(2-formylethyl)phosphine hydrochloride solution was added and the mixture was allowed to react for 40 minutes. 1.2 mL of the gold nanoparticle solution was then added and the mixture was incubated at 37°C for 16 hours. The supernatant was removed by centrifugation. 500 μL of a pH 7.4 phosphate buffer was added to the precipitate and resuspended to prepare a quenched probe. (6) Preparation of biosensors The fluorescent probe and the quenching probe were mixed at a volume ratio of 1:1.8 to prepare a fluorescence quenching biosensor.
3. A method for preparing a fluorescent probe based on the Cronobacter sakazakii aptamer according to claim 1, characterized in that: In step (4), when the fluorescence emission wavelength of the fluorescent probe shifts from 424 nm to 420 nm, it indicates that the first aptamer is successfully modified onto the fluorescent material.
4. A method for preparing a fluorescent probe based on the Cronobacter sakazakii aptamer according to claim 1, characterized in that: In step (5), when the ultraviolet absorption wavelength of the gold nanoparticles shifts from 520 nm to 523 nm, it indicates that the second aptamer has been successfully modified onto the gold nanoparticles.
Citation Information
Patent Citations
Method, primer, probe and kit for detecting cronobacter sakazakii
CN104894212A
Method for rapidly detecting cronobactersakazakii based on magnetically-captured nanogold colorimetric method
CN109593837A
Specific new molecular targets for 4 species in Cronobacter, and rapid detection methods of 4 species in Cronobacter
CN110951898A
Nucleic acid aptamer capable of specifically recognizing cronobacter and application of nucleic acid aptamer
CN117230069A
3D-DNA walker aptamer sensor based on magnetic separation and cronobacter detection method
CN117434263A