Preparation method of humulus lupulus and kadsura longepedunculata composite enzymatic hydrolysate with remarkable anti-wrinkle, firming and skin-care effects

Abstract

The invention discloses a preparation method of humulus lupulus and kadsura longepedunculata composite enzymatic hydrolysate with remarkable anti-wrinkle, firming and skin-care effects, and relates to the technical field of daily chemical skin-care materials. The invention discloses a preparation method of a humulus lupulus and kadsura longepedunculata composite enzymatic hydrolysate with remarkable anti-wrinkle, firming and skin-care effects, which comprises the following steps: blending humulus lupulus powder, kadsura longepedunculata powder and a solvent to obtain a mixed solution; adding a compound enzyme composition into the mixed solution, adjusting the pH value to 4-7, carrying out enzymolysis treatment, centrifugally collecting supernate, carrying out enzyme deactivation treatment on the supernate, and carrying out rotary evaporation and concentration to obtain humulus lupulus and kadsura longepedunculata compound enzymatic hydrolysate; the enzymatic hydrolysate obtained by performing enzymolysis on the humulus lupulus powder and the kadsura longepedunculata powder is used as an effective component to be added into the skin care product, so that the skin care product has remarkable anti-wrinkle, firming and skin care effects.

Description

Technical Field

[0001] The invention relates to the technical field of daily chemical skin care materials, and in particular to a method for preparing a hop and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle and firming skin care effects. Background Art

[0002] With an aging population and increasing consumer demand for youthful skin, the anti-wrinkle skincare market is growing rapidly. Wrinkle formation is primarily linked to collagen loss, elastic fiber degradation, free radical damage, and a weakened skin barrier function. Existing anti-wrinkle ingredients, such as retinol, peptides, and vitamin C, suffer from irritation, poor stability, and high cost. For example, retinol can cause skin sensitivity, dryness, and flaking; vitamin C is easily oxidized and inactivated. Furthermore, most ingredients only target specific wrinkle-causing factors and fail to comprehensively address skin aging issues. Consequently, the development of safer and more effective natural anti-wrinkle ingredients is becoming increasingly popular.

[0003] Hops, also known as hops, fragrant hops, hops, and wild hops, are perennial climbing herbs in the genus Humulus in the Moraceae family. Its stems, branches, and petioles are densely covered with hairs and barbed spines; its leaves are ovate or broadly ovate. Hops is not only a raw material for brewing beer but also a plant with a long history of medicinal and edible uses. Hops are highly nutritious, rich in flavonoids, polyphenols, α-acids, and β-acids, and possess anti-inflammatory, antiviral, and endocrine-regulating properties. Schisandra chinensis (Schisandra chinensis) is the mature fruit of the Chinese Schisandra chinensis plant, which is distinct from Schisandra chinensis (Schisandra chinensis). Plants of the genus Schisandra contain lignans such as schisandrin A, schisandrin B, C, and E, as well as volatile oils, organic acids, fats, and triterpenes. Triterpenes are one of the main bioactive components of plants of the genus Schisandra.

[0004] Currently, hot water reflux, ultrasonic, and microwave methods are commonly used to extract the active ingredients from hops and Schisandra chinensis. However, the hot reflux method has high extraction temperatures and low extraction rates, while ultrasonic and microwave methods can cause bond breakage in the active ingredients. This application uses a combined enzyme method using pectinase and cellulase to extract the active ingredients from hops and Schisandra chinensis. This enzyme extraction method can decompose plant tissue under relatively mild conditions, accelerating the release of active ingredients and has broad application prospects. Summary of the Invention

[0005] The purpose of the present invention is to provide a method for preparing a hops and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle and firming skin care effects, and to solve the following technical problems:

[0006] Existing anti-wrinkle ingredients such as retinol, peptides and vitamin C have problems such as irritation, poor stability or high cost.

[0007] The purpose of the present invention can be achieved through the following technical solutions:

[0008] A method for preparing a hops and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle and firming skin care effects comprises the following steps:

[0009] S1: blending hop powder, Schisandra chinensis powder, and a solvent to obtain a mixed solution;

[0010] S2: adding a composite enzyme composition to the mixed solution, adjusting the pH to 4-6, performing enzymatic hydrolysis, collecting the supernatant by centrifugation, inactivating the enzyme in the supernatant, and concentrating the supernatant by rotary evaporation to obtain a composite enzymatic hydrolyzate of hops and Schisandra chinensis;

[0011] The preparation method of the complex enzyme composition comprises the following steps:

[0012] A1: Pectinase, sodium alginate solution, and glycerol were added to a reaction kettle and dispersed evenly to obtain a pectinase dispersion. The pectinase dispersion was added dropwise to a CaCl2 solution, the temperature was controlled at 10-25°C, and the solution was allowed to stand for 0.5-1 hour. The solution was then washed with water and dried to obtain pectinase microspheres.

[0013] A2: Add chitosan, acetic acid, and water to a reaction flask and disperse evenly. Adjust the pH to 5-6.5, add pectinase microspheres, control the temperature to 10-20°C, let stand for 10-20 minutes, and wash with PBS to obtain modified pectinase microspheres.

[0014] A3: Add cellulase and distilled water to a reactor and disperse them evenly. Adjust the pH to 5-6, add modified pectinase microspheres, control the temperature to 0-10°C, let stand for 10-20 minutes, add glutaraldehyde, and keep the mixture warm for 1-2 hours. Add glycine and disperse them evenly. Keep the mixture warm for 0.5-1 hour. Wash with PBS, filter, and dry to obtain a complex enzyme composition.

[0015] As a further embodiment of the present invention, the addition ratio of pectinase, sodium alginate solution and glycerol in A1 is 0.5-1 g:100 mL:3-6 g.

[0016] As a further solution of the present invention: the addition ratio of chitosan, acetic acid, distilled water, and pectinase microspheres in A2 is 1-2 g: 0.8-1.2 g: 100 mL: 5-10 g.

[0017] As a further embodiment of the present invention, the addition ratio of distilled water, modified pectinase microspheres, glutaraldehyde and glycine in A3 is 100 mL: 1-2 g: 0.4-0.8 g: 0.5-1 g.

[0018] As a further embodiment of the present invention: a method for preparing a CaCl2 solution comprises the following steps: mixing 1-5 g of CaCl2 and 100 mL of distilled water, and then dropwise adding PBS to adjust the pH to 5-6 to obtain a CaCl2 solution;

[0019] The preparation method of the sodium alginate solution comprises the following steps: mixing 1-3 g of sodium alginate powder and 100 mL of distilled water, controlling the temperature at 50-60° C., and magnetically stirring until the sodium alginate is completely dissolved to obtain the sodium alginate solution.

[0020] As a further solution of the present invention: hops powder is obtained by drying hops at low temperature and then crushing and sieving; and Schisandra chinensis powder is obtained by drying Schisandra chinensis at low temperature and then crushing and sieving.

[0021] As a further solution of the present invention: the mass ratio of hops powder to Schisandra chinensis powder in the mixed liquid is 1:0.5-1.5; the solid-liquid ratio in the mixture is 2:50-150; and the solvent is distilled water.

[0022] As a further solution of the present invention: the mass ratio of cellulase to pectinase in the complex enzyme composition is 2-1:1.

[0023] As a further solution of the present invention: the complex enzyme composition accounts for 5-15% of the total mass of the complex enzyme composition and the mixed solution.

[0024] As a further solution of the present invention: the specific steps of enzymatic hydrolysis are: controlling the temperature at 45-55°C, keeping warm and stirring for 30-60 minutes;

[0025] The specific steps of enzyme inactivation treatment are: controlling the temperature at 100°C, keeping warm and stirring for 10-15 minutes;

[0026] The specific steps of rotary evaporation concentration are: concentrating to one half to one quarter of the original volume.

[0027] Beneficial effects of the present invention:

[0028] (1) The present application adopts a composite enzymatic hydrolysis technology to decompose the structure of the plant cell walls of hop powder and Schisandra chinensis powder through cellulase and pectinase, thereby more effectively releasing the active substances in the cells. Compared with single enzymatic hydrolysis or traditional solvent extraction, composite enzymatic hydrolysis can not only improve the extraction efficiency, but also retain the activity of more heat-sensitive components, reduce the use of organic solvents, and avoid the risk of chemical solvent residues. Moreover, the present application can decompose macromolecular substances such as polysaccharides and proteins into small molecular active substances through enzymatic hydrolysis, which are easier to be absorbed by the skin, thereby improving the transdermal absorption rate and moisturizing and repairing effect.

[0029] (2) The present application utilizes a composite enzyme to hydrolyze hop powder and Schisandra chinensis powder to obtain a composite enzymatic hydrolysate; wherein, flavonoids in hops, such as quercetin, rutin, polyphenols, and α-acids (humulones), can neutralize free radicals (ROS), reduce the damage of oxidative stress to skin cells (such as fibroblasts and keratinocytes), protect collagen and elastic fibers from oxidative degradation, and delay skin sagging and wrinkle formation. It enhances the activity of the skin's own antioxidant enzymes (such as superoxide dismutase SOD and glutathione peroxidase) and improves the skin's defense ability. Hops can not only delay skin aging, but also indirectly stimulate collagen synthesis through antioxidant and anti-inflammatory effects, effectively improve skin texture, and make the skin more delicate and smooth. Hops can synergistically improve skin aging problems through a multi-target mechanism of action, achieving anti-wrinkle and firming skin care effects. Schisandra chinensis is rich in active ingredients such as lignans, polysaccharides, volatile oils and vitamins. Among them, lignans and polyphenol compounds can not only scavenge free radicals and reduce the damage of oxidative stress to the skin; but also stimulate fibroblasts, increase the production of collagen and elastin, and improve skin elasticity.

[0030] This application utilizes Schisandra chinensis (Schisandra chinensis) to focus on antioxidants and collagen synthesis, while Hops (Hops) focuses on anti-inflammatory and antibacterial properties. The combination of these two ingredients can comprehensively address the causes of wrinkles. Both ingredients in the complex enzymatic hydrolysate used in this application are natural plant extracts, which are low in irritation and suitable for long-term use. Furthermore, the active ingredients of Schisandra chinensis (Schisandra chinensis) and Hops (Hops) are highly stable in skincare formulations and are not easily inactivated.

[0031] (3) The present application uses a combination of cellulase and pectinase to decompose the structure of the plant cell walls of hop powder and Schisandra chinensis powder. The present application first uses an enzyme fixation method to encapsulate pectinase in sodium alginate to form pectinase microspheres; and adds glycerol during the preparation of the pectinase microspheres to reduce the thermal denaturation of the enzyme during the recovery process. The present application uses pectinase microspheres as raw materials, forms a chitosan coating on the surface of the pectinase microspheres by an electrostatic adsorption method, and obtains modified pectinase microspheres; and loads cellulase on the surface of the modified pectinase microspheres, and adds glutaraldehyde during the loading process to achieve cross-linking and fixation, effectively improving the binding strength between the cellulase and the modified pectinase microspheres; finally, glycine is added to block the residual aldehyde groups to obtain a complex enzyme composition.

[0032] The present application loads cellulase and pectinase on a carrier, realizes not only realizing the recycling of pectinase and cellulase, but also the layered fixation of pectinase and cellulase, maintains the activity of the two enzymes, and ensures their stability and synergy on the carrier, avoids competitive inhibition between enzymes. In the composite enzymatic hydrolysis process, the composite enzyme preparation of cellulase and pectinase is recycled, realizing the key link of cost control and green production. Through reasonable recycling technology, the raw material consumption of the enzymatic hydrolysis process can be significantly reduced, while reducing waste discharge. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The present invention will be further described below with reference to the accompanying drawings.

[0034] Figure 1 This is a statistical chart showing the effects of different concentrations of the composite enzymatic hydrolysate prepared in Example 5 of the present application on the proliferation of HDF cells;

[0035] Figure 2 This is a statistical graph showing the promotion of collagen gene expression in cells by the composite enzymatic hydrolysate prepared in Example 5 of the present application;

[0036] Figure 3 This is an observation diagram of the reaction of the composite enzymatic hydrolysate prepared in Example 5 of the present application to the chicken embryo chorioallantoic membrane (HET-CAM) within 5 minutes. DETAILED DESCRIPTION

[0037] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0038] The preparation method of the complex enzyme composition of Example 1 comprises the following steps:

[0039] A1: Blend 2 g of CaCl2 with 100 mL of distilled water, and add PBS dropwise to adjust the pH to 6 to obtain a CaCl2 solution. Blend 2 g of sodium alginate powder with 100 mL of distilled water, control the temperature at 55°C, and magnetically stir until completely dissolved to obtain a sodium alginate solution.

[0040] A2: Add 1 g pectinase (activity ≥ 5000 U / g), 100 mL sodium alginate solution, and 3 g glycerol to a reactor and disperse evenly to obtain a pectinase dispersion. The pectinase dispersion is then dripped dropwise into a CaCl2 solution through a 22-26 Gauge needle. The solution is then placed at 10°C for 0.5 h, washed with water, and dried to obtain pectinase microspheres with a particle size of 1 mm.

[0041] A3: Add 1 g chitosan, 0.8 g acetic acid, and 100 mL distilled water to a reaction flask and disperse evenly. Adjust the pH to 5, add 5 g pectinase microspheres, control the temperature to 10°C, let stand for 10 min, and wash with PBS to obtain modified pectinase microspheres.

[0042] A4: Cellulase (activity ≥5000 U / g) and 100 mL of distilled water were added to a reactor and dispersed evenly. The pH was adjusted to 5. 1 g of modified pectinase microspheres was added. The temperature was controlled at 0°C and the mixture was allowed to stand for 10 min. 0.4 g of glutaraldehyde was added and the mixture was kept warm for 1 h. 0.5 g of glycine was added and dispersed evenly. The mixture was kept warm for 0.5 h. The mixture was washed with PBS, filtered, and dried to obtain a complex enzyme composition. The mass ratio of cellulase to pectinase in the complex enzyme composition was 1:1.

[0043] The preparation method of the complex enzyme composition of Example 2 comprises the following steps:

[0044] A1: Blend 2 g of CaCl2 with 100 mL of distilled water, and add PBS dropwise to adjust the pH to 6 to obtain a CaCl2 solution. Blend 2 g of sodium alginate powder with 100 mL of distilled water, control the temperature at 55°C, and magnetically stir until completely dissolved to obtain a sodium alginate solution.

[0045] A2: Add 1 g pectinase (activity ≥ 5000 U / g), 100 mL sodium alginate solution, and 5 g glycerol to a reactor and disperse evenly to obtain a pectinase dispersion. The pectinase dispersion is then dripped dropwise into a CaCl2 solution through a 22-26 Gauge needle. The solution is kept at 15°C for 0.5 h, washed with water, and dried to obtain pectinase microspheres with a particle size of 1 mm.

[0046] A3: Add 1.5 g chitosan, 1 g acetic acid, and 100 mL distilled water to a reaction flask and disperse evenly. Adjust the pH to 5.5, add 7 g pectinase microspheres, control the temperature to 15°C, let stand for 15 min, and wash with PBS to obtain modified pectinase microspheres.

[0047] A4: Cellulase (activity ≥ 5000 U / g) and 100 mL of distilled water were added to a reactor and dispersed evenly. The pH was adjusted to 5.5, 1 g of modified pectinase microspheres was added, the temperature was controlled at 5°C, and the mixture was allowed to stand for 10 min. 0.6 g of glutaraldehyde was added and the mixture was kept warm for 1.5 h. 0.7 g of glycine was added and dispersed evenly. The mixture was kept warm for 0.5 h. The mixture was washed with PBS, filtered, and dried to obtain a complex enzyme composition, wherein the mass ratio of cellulase to pectinase in the complex enzyme composition was 1:1.

[0048] The preparation method of the complex enzyme composition of Example 3 comprises the following steps:

[0049] A1: Blend 2 g of CaCl2 with 100 mL of distilled water, and add PBS dropwise to adjust the pH to 6 to obtain a CaCl2 solution. Blend 2 g of sodium alginate powder with 100 mL of distilled water, control the temperature at 55°C, and magnetically stir until completely dissolved to obtain a sodium alginate solution.

[0050] A2: Add 0.5-1g pectinase (activity ≥5000U / g), 100mL sodium alginate solution, and 3-6g glycerol to a reactor and disperse evenly to obtain a pectinase dispersion. The pectinase dispersion is then dripped dropwise into a CaCl2 solution through a 22-26G needle. The solution is kept at 25°C and allowed to stand for 0.5h. The solution is then washed with water and dried to obtain pectinase microspheres with a particle size of 1mm.

[0051] A3: Add 1 g chitosan, 1.2 g acetic acid, and 100 mL distilled water to a reaction flask and disperse evenly. Adjust the pH to 6, add 10 g pectinase microspheres, control the temperature to 20°C, let stand for 10 min, and wash with PBS to obtain modified pectinase microspheres.

[0052] A4: Cellulase (activity ≥5000 U / g) and 100 mL of distilled water were added to a reactor and dispersed evenly. The pH was adjusted to 6. 1 g of modified pectinase microspheres was added. The temperature was controlled at 10°C and the mixture was allowed to stand for 10 min. 0.8 g of glutaraldehyde was added and the mixture was allowed to react at this temperature for 2 h. 1 g of glycine was added and dispersed evenly. The mixture was allowed to react at this temperature for 1 h. The mixture was washed with PBS, filtered, and dried to obtain a complex enzyme composition. The mass ratio of cellulase to pectinase in the complex enzyme composition was 1:1.

[0053] Example 4 A method for preparing a hops and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle and firming skin care effects comprises the following steps:

[0054] S1: hops were dried at low temperature and then crushed through a 200-mesh sieve to obtain hop powder; Schisandra chinensis was dried at low temperature and then crushed through a 200-mesh sieve to obtain Schisandra chinensis powder; 1 g of hop powder, 1 g of Schisandra chinensis powder, and 100 mL of distilled water were blended to obtain a mixture;

[0055] S2: 12.5 g of the complex enzyme composition prepared in Example 1 was added to 100 mL of the mixed solution, the pH was adjusted to 6.5, the temperature was controlled at 55° C., and the mixture was stirred for 30 min. The supernatant was collected by centrifugation, the temperature of the supernatant was controlled at 100° C., the mixture was stirred for 10 min, and the supernatant was concentrated by rotary evaporation to one third of the original volume to obtain a composite enzymatic hydrolyzate of hops and Schisandra chinensis.

[0056] Example 5 A method for preparing a hops and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle and firming skin care effects comprises the following steps:

[0057] S1: hops were dried at low temperature and then crushed through a 200-mesh sieve to obtain hop powder; Schisandra chinensis was dried at low temperature and then crushed through a 200-mesh sieve to obtain Schisandra chinensis powder; 1 g of hop powder, 1 g of Schisandra chinensis powder, and 100 mL of distilled water were blended to obtain a mixture;

[0058] S2: 12.5 g of the complex enzyme composition prepared in Example 2 was added to 100 mL of the mixed solution, the pH was adjusted to 6.5, the temperature was controlled at 55° C., and the mixture was stirred for 30 min. The supernatant was collected by centrifugation, the temperature of the supernatant was controlled at 100° C., the mixture was stirred for 10 min, and the supernatant was concentrated by rotary evaporation to one third of the original volume to obtain a composite enzymatic hydrolyzate of hops and Schisandra chinensis.

[0059] Example 6 A method for preparing a hops and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle and firming skin care effects comprises the following steps:

[0060] S1: hops were dried at low temperature and then crushed through a 200-mesh sieve to obtain hop powder; Schisandra chinensis was dried at low temperature and then crushed through a 200-mesh sieve to obtain Schisandra chinensis powder; 1 g of hop powder, 1 g of Schisandra chinensis powder, and 100 mL of distilled water were blended to obtain a mixture;

[0061] S2: 12.5 g of the complex enzyme composition prepared in Example 3 was added to 100 mL of the mixed solution, the pH was adjusted to 6.5, the temperature was controlled at 55° C., and the mixture was stirred for 30 min. The supernatant was collected by centrifugation, the temperature of the supernatant was controlled at 100° C., the mixture was stirred for 10 min, and the supernatant was concentrated by rotary evaporation to one third of the original volume to obtain a composite enzymatic hydrolyzate of hops and Schisandra chinensis.

[0062] The preparation method of the complex enzyme composition of Comparative Example 1 comprises the following steps:

[0063] 1 g of pectinase (activity ≥ 5000 U / g) and cellulase (activity ≥ 5000 U / g) were blended to obtain a complex enzyme composition.

[0064] The preparation method of the complex enzyme composition of Comparative Example 2 comprises the following steps:

[0065] A1: Blend 2 g of CaCl2 with 100 mL of distilled water, and add PBS dropwise to adjust the pH to 6 to obtain a CaCl2 solution. Blend 2 g of sodium alginate powder with 100 mL of distilled water, control the temperature at 55°C, and magnetically stir until completely dissolved to obtain a sodium alginate solution.

[0066] A2: Add 1 g pectinase (activity ≥ 5000 U / g), 1 g cellulase (activity ≥ 5000 U / g), 100 mL sodium alginate solution, and 5 g glycerol to a reactor and disperse them evenly to obtain a pectinase dispersion. The pectinase dispersion was then dripped dropwise into a CaCl2 solution through a 22-26 Gauge needle. The solution was kept at 15°C and allowed to stand for 0.5 h. The mixture was then washed with water and dried to obtain complex enzyme microspheres with a particle size of 1 mm.

[0067] A3: Add 1.5 g chitosan, 1 g acetic acid, and 100 mL distilled water to a reaction flask and disperse evenly. Adjust the pH to 5.5, add 7 g complex enzyme microspheres, control the temperature to 15°C, let stand for 15 min, and wash with PBS to obtain modified complex enzyme microspheres.

[0068] A4: Add 1 g of modified pectinase microspheres and 100 mL of distilled water to a reactor and disperse them evenly. Adjust the pH to 5.5, control the temperature to 5°C, and let it stand for 10 min. Add 0.6 g of glutaraldehyde and incubate for 1.5 h. Add 0.7 g of glycine and disperse them evenly. Incubate for 0.5 h. Wash with PBS, filter, and dry to obtain a complex enzyme composition.

[0069] The preparation method of the complex enzyme composition of Comparative Example 3 comprises the following steps:

[0070] A1: Blend 2 g of CaCl2 with 100 mL of distilled water, and add PBS dropwise to adjust the pH to 6 to obtain a CaCl2 solution. Blend 2 g of sodium alginate powder with 100 mL of distilled water, control the temperature at 55°C, and magnetically stir until completely dissolved to obtain a sodium alginate solution.

[0071] A2: Add 1 g pectinase (activity ≥ 5000 U / g), 100 mL sodium alginate solution, and 5 g glycerol to a reactor and disperse evenly to obtain a pectinase dispersion. The pectinase dispersion is then dripped dropwise into a CaCl2 solution through a 22-26 Gauge needle. The solution is kept at 15°C for 0.5 h, washed with water, and dried to obtain pectinase microspheres with a particle size of 1 mm.

[0072] A3: Add 1.5 g chitosan, 1 g acetic acid, and 100 mL distilled water to a reaction flask and disperse evenly. Adjust the pH to 5.5, add 7 g pectinase microspheres, control the temperature to 15°C, let stand for 15 min, and wash with PBS to obtain modified pectinase microspheres.

[0073] A4: Cellulase (activity ≥5000 U / g) and 100 mL of distilled water were added to a reactor and dispersed evenly. The pH was adjusted to 5.5, 1 g of modified pectinase microspheres was added, the temperature was controlled at 5°C, and the mixture was allowed to stand for 100 min. 0.7 g of glycine was added and dispersed evenly. The mixture was kept warm for 0.5 h, washed with PBS, filtered, and dried to obtain a complex enzyme composition. The mass ratio of cellulase to pectinase in the complex enzyme composition was 1:1.

[0074] Comparative Example 4 is compared with Example 5, except that the complex enzyme composition prepared in Example 2 added in Example 5 is replaced by the complex enzyme composition prepared in Comparative Example 1 in equal amount, and the remaining components are completely consistent with the preparation method.

[0075] Comparative Example 5 is compared with Example 5, except that the same amount of the complex enzyme composition prepared in Example 2 added in Example 5 is replaced by the complex enzyme composition prepared in Comparative Example 2, and the remaining components are completely consistent with the preparation method.

[0076] Comparative Example 6 is compared with Example 5, except that the complex enzyme composition prepared in Example 2 added in Example 5 is replaced by the complex enzyme composition prepared in Comparative Example 3 in equal amount, and the remaining components are completely consistent with the preparation method.

[0077] Comparative Example 7 Compared with Example 5, 1g of hop powder and 1g of Schisandra chinensis powder added in Example 5 were replaced with 2g of hop powder, and the other components were exactly the same as the preparation method.

[0078] Comparative Example 8 Compared with Example 5, the 1g hop powder and 1g Schisandra chinensis powder added in Example 5 were replaced with 2g Schisandra chinensis powder, and the other components were exactly the same as the preparation method.

[0079] Performance testing

[0080] (1) Cell culture and grouping

[0081] HDF fibroblasts were cultured in RPMI1640 medium (containing 1% penicillin-streptomycin and 1% fetal bovine serum) at 37°C and 5% CO2. When the cells grew to 80%, they were digested with 0.25% trypsin and counted using a handheld automatic cell counter. Finally, a cell suspension of a certain concentration was prepared for subculture.

[0082] In the photoaging damage experiment, HDF fibroblasts were divided into three groups: blank control group, photoaging damage model group (50 mj / cm 2 UVA irradiation), sample experimental group, all with 5X10 4 Cells in the blank control group were not treated with any treatment, and cells in the aging damage model group were treated with 50 mJ / cm 2 UVA irradiation, the cells of the sample experimental group were first treated with a certain concentration of complex enzyme hydrolysate for 24 hours, then discarded and washed three times with sterile PBS, and finally irradiated with 50mj / cm 2 UVA irradiation.

[0083] (2) Determination of the effect of enzymatic hydrolysis on cell proliferation activity

[0084] The CCK8 method for testing cell proliferation activity has the advantages of good reproducibility and low cytotoxicity. HDF cells in the logarithmic growth phase of passage 4-5 were taken at a cell density of 4x10 4Cells were plated at 100 μg / mL in a 96-well plate and cultured at 37°C and 5% CO2 for approximately 12 hours. A 10% volume of enzyme solution was then added to the plate. After the sample and cells had interacted for 24 hours, 10% CCK8 reagent was added and the cells were incubated in a cell culture incubator for 2 hours. Finally, the absorbance at 450 nm was measured on a microplate reader. Each concentration was repeated 5 times. The cell proliferation rate was calculated according to the following formula:

[0085] Cell viability % = [(OD of experimental group - OD of apoptosis well) / (OD of control group - OD of apoptosis well)] X 100%

[0086] After the HDF cells were treated with enzyme solutions of different concentrations for 24 hours, the cell proliferation activity was tested using the CCK8 kit. Figure 1 As shown in the figure, it can be seen that different concentrations of enzymatic hydrolysate have no effect on the proliferation of HDF cells; based on the cell proliferation experimental data, it is preliminarily judged that the enzymatic hydrolysate has certain safety as a natural skin care active ingredient.

[0087] (3) Fluorescence quantitative PCR detection of the mRNA expression levels of collagen type 1 and collagen type 3

[0088] The mRNA expression levels of collagen type 1 and collagen type 3 were measured by the method described in (2). The total RNA of each well was extracted using RNAiso, and then PrimeScript TM The RT reagent kit converts total RNA into cDNA. After adding SYBR reagent, gene primers, and gene template, a real-time fluorescence quantitative PCR reaction is performed. The reaction procedure is a two-step method, specifically as follows: pre-denaturation at 95°C for 30 seconds; PCR reaction at 95°C for 5 seconds, 60°C for 30 seconds for 40 cycles. The primer sequences are shown below:

[0089] Actin-F:GTTGGACCTGACAGACTACCTCA;

[0090] Actin-R:GTTGCCAATAGTGATGACCT;

[0091] Col lagen type1-F:TGGTCCACTTGCTTGAAGAC;

[0092] Col lagen type1-R:ACAGATTTGGGAAGGAGTGG;

[0093] Col lagen type3-F:ATGGTTGCACGAAACACACT;

[0094] Col lagen type3-R:CTTGATCAGGACCACCAATG;

[0095] See also Figure 2 , where Collagen type 1 and Collagen type 3 represent collagen I and III genes respectively. Figure 2 The data shows that

[0096] The composite enzymatic hydrolyzates obtained by composite enzymatic hydrolysis with only hops in Comparative Example 7 and only Schisandra chinensis in Comparative Example 8 promoted the expression level of Collagen type 1 gene in cells by 23.33% and 34.33%, respectively, while the composite enzymatic hydrolyzate prepared by adding both hops and Schisandra chinensis as raw materials in Example 5 promoted the expression level of Collagen type 1 gene by 65.33%.

[0097] The composite enzymatic hydrolyzate obtained by composite enzymatic hydrolysis of the raw materials containing only hops in Comparative Example 7 and only Schisandra chinensis in Comparative Example 8 promoted the expression level of collagen type 3 gene in cells by 35% and 26.67%, respectively, while the composite enzymatic hydrolyzate prepared by adding both hops and Schisandra chinensis as raw materials in Example 5 promoted the expression level of collagen type 3 gene by 55%. In summary, the composite enzymatic hydrolyzate prepared by composite hops and Schisandra chinensis has a very significant promoting effect and synergistic effect on the expression of collagen genes in cells. It can be seen that the composite enzymatic hydrolyzate prepared by composite hops and Schisandra chinensis can better play an anti-wrinkle and firming skin care effect than the composite enzymatic hydrolyzate of the single raw materials.

[0098] (4) Irritation test of the composite enzymatic hydrolysate prepared in Example 5

[0099] The chicken embryo chorioallantoic membrane (HET-CAM) in vitro test method was used to replace the traditional animal experimental method. The test was conducted in accordance with the "Chicken Embryo Chorioallantoic Membrane Test for Eye Irritation / Corrosion of Cosmetics" (SN / T2329-2009). The test adopted the reaction time method, and negative (0.9% NaCl) and positive control groups (0.1 mol / L NaOH) were set up at the same time.

[0100] See also Figure 3 , Figure 3Figure A in the middle is the negative control group, Figure 3 Figure B is the positive control group, Figure 3 Figure C in the middle shows the enzymatic hydrolysate experimental group. The toxicity was graded and scored by observing the reaction of the chicken embryo chorioallantoic membrane (HET-CAM) within 5 minutes. Figure 3 As shown, the negative control group (0.9% NaCl) showed no vascular bleeding, coagulation, or hemolysis, and the blood vessels remained normal, while the positive control group (0.1 mol / L NaOH) and HET-CAM produced severe bleeding reactions, indicating that the two control groups were successfully established and have comparative significance. The degree of each type of bleeding, coagulation, and vascular melting from the start of the test was observed and recorded to determine whether the test sample was an eye irritant. Figure 3 The results of the enzymatic hydrolysate experimental group were consistent with those of the negative control group, with no evidence of vascular bleeding, coagulation, or hemolysis. Therefore, the composite enzymatic hydrolysate can be classified as non-irritating and can be added to cosmetic formulations for skin care.

[0101] (5) Enzyme activity detection

[0102] ① Pectinase activity detection method: The complex enzyme composition prepared in Examples 1-3 and Comparative Examples 1-3 was reacted with PGA solution (pH 4.5, 50°C) for 10 minutes. After terminating the reaction, the supernatant was centrifuged and the solution was added with DNS reagent for boiling and color development. The absorbance at 540 nm was measured, and the activity retention rate was calculated according to the following formula:

[0103] Activity retention rate = (enzyme activity of complex enzyme composition / initial enzyme activity) × 100%

[0104] Wherein, initial enzyme activity is the initial activity of pectinase, and the test results are shown in Table 1;

[0105] ② Cellulase activity detection method: The complex enzyme compositions prepared in Examples 1-3 and Comparative Examples 1-3 were reacted with sodium carboxymethyl cellulose (CMC-Na) solution (pH 5.0, 50°C) for 10 minutes. After terminating the reaction, the supernatant was centrifuged and the supernatant was added with DNS reagent and boiled for color development. The glucose production was measured, and the immobilization efficiency was calculated according to the following formula:

[0106] Immobilization efficiency = (enzyme activity of complex enzyme composition / initial enzyme activity) × 100%

[0107] Wherein, initial enzyme activity is the initial activity of cellulase, and the test results are shown in Table 1;

[0108] ③ Catalytic efficiency: Using hop powder and Schisandra chinensis powder as composite substrates, the composite substrates were degraded using the composite enzyme compositions prepared in Examples 1-3 and Comparative Examples 1-3, and the amount of reducing sugar released after degradation was detected. The test results are shown in Table 1;

[0109] ④ Operational stability: Using hop powder and Schisandra chinensis powder as the composite substrate, the composite substrate was degraded using the composite enzyme composition prepared in Examples 1-3 and Comparative Examples 1-3. After the reaction, the composite enzyme composition was recovered by centrifugation, washed three times with PBS buffer, and reused five times. The enzyme activity retention rate of the composite enzyme composition after five washes was measured. The test results are shown in Table 1;

[0110] Table 1: Enzyme activity test data statistics of Examples 1-3 and Comparative Examples 1-3

[0111]

[0112] As shown in Table 1, although the activity of the pectinase and cellulase in the complex enzyme composition prepared by the present application decreased slightly after being loaded on the carrier, the activity of the pectinase remained above 85%, and the activity of the cellulase remained above 75%. Furthermore, the present application solidifies the pectinase and cellulase in layers, effectively improving the degradation efficiency of the complex enzyme. Furthermore, the complex enzyme composition maintains a high level of enzyme activity over multiple recycling and reuse, facilitating its recycling and reuse.

[0113] The above is a detailed description of an embodiment of the present invention. However, the content described is only a preferred embodiment of the present invention and should not be considered to limit the scope of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the patent coverage of the present invention.

Claims

1. A method for preparing a hops and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle and firming skin care effects, characterized in that: The steps include: S1: blending hop powder, Schisandra chinensis powder, and a solvent to obtain a mixed solution; S2: adding a composite enzyme composition to the mixed solution, adjusting the pH to 4-6.5, performing enzymatic hydrolysis, collecting the supernatant by centrifugation, inactivating the enzyme in the supernatant, and concentrating the supernatant by rotary evaporation to obtain a composite enzymatic hydrolyzate of hops and Schisandra chinensis; The preparation method of the complex enzyme composition comprises the following steps: A1: Pectinase, sodium alginate solution, and glycerol were added to a reaction kettle and dispersed evenly to obtain a pectinase dispersion. The pectinase dispersion was added dropwise to a CaCl2 solution, the temperature was controlled at 10-25°C, and the solution was allowed to stand for 0.5-1 hour. The solution was then washed with water and dried to obtain pectinase microspheres. A2: Add chitosan, acetic acid, and water to a reaction flask and disperse evenly. Adjust the pH to 5-6, add pectinase microspheres, control the temperature to 10-20°C, let stand for 10-20 minutes, and wash with PBS to obtain modified pectinase microspheres. A3: Add cellulase and distilled water to a reactor and disperse them evenly. Adjust the pH to 5-6, add modified pectinase microspheres, control the temperature to 0-10°C, let stand for 10-20 minutes, add glutaraldehyde, and keep the mixture warm for 1-2 hours. Add glycine and disperse them evenly. Keep the mixture warm for 0.5-1 hour. Wash with PBS, filter, and dry to obtain a complex enzyme composition.

2. The method for preparing a hop and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle and firming skin care effects according to claim 1, characterized in that: The addition ratio of pectinase, sodium alginate solution, and glycerol in A1 is 0.5-1 g:100 mL:3-6 g.

3. The method for preparing a hops and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle and firming skin care effects according to claim 1, characterized in that: The addition ratio of chitosan, acetic acid, distilled water, and pectinase microspheres in A2 is 1-2 g: 0.8-1.2 g: 100 mL: 5-10 g.

4. The method for preparing a hops and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle, firming and skin care effects according to claim 1, characterized in that: The addition ratio of distilled water, modified pectinase microspheres, glutaraldehyde, and glycine in A3 is 100 mL: 1-2 g: 0.4-0.8 g: 0.5-1 g.

5. The method for preparing a hops and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle and firming skin care effects according to claim 1, characterized in that: The preparation method of the CaCl2 solution comprises the following steps: mixing 1-5 g of CaCl2 and 100 mL of distilled water, and then adding PBS dropwise to adjust the pH to 5-6 to obtain a CaCl2 solution; The preparation method of the sodium alginate solution comprises the following steps: mixing 1-3 g of sodium alginate powder and 100 mL of distilled water, controlling the temperature at 50-60° C., and magnetically stirring until the sodium alginate is completely dissolved to obtain the sodium alginate solution.

6. The method for preparing a hops and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle, firming and skin care effects according to claim 1, characterized in that: The hop powder is obtained by drying hops at low temperature and then crushing and sieving; the Schisandra chinensis powder is obtained by drying Schisandra chinensis at low temperature and then crushing and sieving.

7. The method for preparing a hops and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle, firming and skin care effects according to claim 1, characterized in that: The mass ratio of hop powder to Schisandra chinensis powder in the mixed liquid is 1:0.5-1.5; the solid-liquid ratio in the mixture is 2:50-150; and the solvent is distilled water.

8. The method for preparing a hops and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle, firming and skin care effects according to claim 1, characterized in that: The mass ratio of cellulase to pectinase in the complex enzyme composition is 2-1:

1.

9. The method for preparing a hops and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle, firming and skin care effects according to claim 1, characterized in that: The complex enzyme composition accounts for 5-15% of the total mass of the complex enzyme composition and the mixed solution.

10. The method for preparing a hops and Schisandra chinensis composite enzymatic hydrolyzate having significant anti-wrinkle, firming and skin care effects according to claim 1, characterized in that: The specific steps of enzymatic hydrolysis are: controlling the temperature at 45-55°C, keeping warm and stirring for 30-60 minutes; The specific steps of enzyme inactivation treatment are: controlling the temperature at 100°C, keeping warm and stirring for 10-15 minutes; The specific steps of rotary evaporation concentration are: concentrating to one half to one quarter of the original volume.

Images