Goat hornless target gene RXFP2 specific expression regulatory element and application

Abstract

The invention discloses a specific expression regulatory element of a goat hornless target gene RXFP2 and application of the specific expression regulatory element. The sequence of the regulatory element is SEQ ID No.1. Through fetal ox horn bud tissue single cell gene expression and chromatin accessibility analysis, it is found that a section of specifically open regulatory element (chr12: 29279059-29279559) in horn bud tissue exists on the upstream of RXFP2, the element has a binding motif of a core transcription factor RUNX2 for promoting differentiation of osteoblast progenitor cells and is highly conserved in horned animals, and the position of the element is chr12: 57440948-57441449 compared with a goat genome. Through a dual luciferase experiment, it is verified that the regulatory element mediates interaction of a transcription factor RUNX2 and RXFP2, and specific high expression of the RXFP2 in horn bud tissue is achieved. CRISPR-Cas9 is used for knocking out the regulatory element region (chr12: 57440800-57441678) of the goat embryo, and the goat embryo of which the specific expression regulatory element of the hornless target gene RXFP2 is knocked out through gene editing is successfully prepared. The invention further discloses the origin, evolution and skin ossification mechanism of horn organs, and provides a new target for breeding of hornless livestock.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a specific expression regulatory element of the goat hornless target gene RXFP2 and its application. Background Technology

[0002] Horns are a unique feature of bovine animals (such as cattle, sheep, and deer), formed by the fusion of multiple tissues including skin, bone, and nerves. The evolution of horns may be related to defense, courtship competition, or territorial disputes, giving animals a survival advantage in specific environments. However, in modern animal husbandry, the horn structure of goats poses a challenge for large-scale breeding. Injuries from horn fighting pose a risk of group conflict; furthermore, horns can get stuck in equipment or fences, increasing the difficulty of daily management and transportation, and leading to a higher accident rate. Therefore, many farms surgically remove the horns from goats. Hornless goats, due to their low injury rate, reduce medical expenses and lower feeding costs, resulting in higher economic returns. From an animal welfare perspective, the significance of hornless goat breeding lies primarily in avoiding the pain of horn removal surgery, aligning with the ethical requirements of modern animal welfare in animal husbandry. Breeding hornless goats can optimize genetic traits, improve population productivity and adaptability, and support the sustainable development of animal husbandry. With the development of genomics, the discovery of candidate genes for the hornless trait has attracted much attention, and its application in hornless livestock breeding urgently needs exploration and breakthroughs.

[0003] In the origin of new organs, existing genes may be "recruited" from their original functional regions to new developmental processes. For example, RXFP2 is recruited from testicular tissue to horns and antlers, and is highly expressed in sheep fetal horn bud tissue. In sheep, there exists a hornless variant. Genome-wide analysis of hornless variant sheep revealed that RXFP2 is a key gene regulating sheep horn development, and genetic variation in its 3'UTR region is closely related to the horn phenotype. SNP sites associated with the hornless trait were identified in the 3'UTR region of the RXFP2 gene. Furthermore, a specific 1833 bp insertion mutation was found in this region in hornless sheep, and this mutation showed a stable genotype-phenotype association across different sheep breeds. Sequencing and gene expression analysis of 89 individual Chinese sheep confirmed that the RXFP2 gene also controls horn shape and size. Therefore, the RXFP2 gene regulates the presence, size, and shape of sheep horns, indicating that RXFP2 plays a crucial role in the regulation of horn development.

[0004] The role of RXFP2 in bone metabolism is closely related to its ability to regulate osteoblast differentiation, enhancing the expression of the key transcription factor RUNX2 in osteoblasts. RUNX2, as a core regulator of osteogenic differentiation, can induce the expression of osteogenic markers such as alkaline phosphatase and osteocalcin, promote collagen deposition, provide a matrix for hydroxyapatite crystallization, and ultimately drive the formation of mineralized nodules. Overexpression of RXFP2 in mouse pre-osteoblast cell lines increased RUNX2 mRNA levels by 2.1-fold and significantly increased the number of mineralized nodules; while knockdown of RXFP2 reduced the mineralized area to 30% of the control group. These studies indicate that RXFP2-RUNX2 interact during osteoogenesis; however, the specific regulatory mechanism remains unclear. Research on the RXFP2-RUNX2 regulatory network can not only reveal the molecular driving mechanism of natural selection on bone morphological diversity but also demonstrates translational potential in multidisciplinary collaboration, opening new pathways for the treatment of bone diseases and the innovation of biomaterials. Summary of the Invention

[0005] Based on the above reasons, this invention proposes a specific expression regulatory element for the goat hornless target gene RXFP2 and its application. Specifically, to achieve the objectives of this invention, the following technical solution is proposed:

[0006] This invention relates, in one aspect, to a specific expression regulatory element of the goat hornless target gene RXFP2, the sequence of which is SEQ ID No. 1, specifically as follows:

[0007] ATGGATGCCTTGCTCACGAGTCTGTGGGTCATGTGTGGCTCTTCTGGGCTCAGCTGGGCTCAGGTTCAAGCCTGCTGCACGTGGCTCTCACTCTGGCTAAGGAGTGGGGAAGCCAAGCCACACCA CACAAGACATTTAAAGCCTCTCCTGGAATGCGGCACATGCTACTTCTGGTCACATTTTATTGGTCAAGAGGCAAAAATCAGTGCAGCAGAGAAATACACACTCACTATGAGAGGTTCTGCCAAGTC ACATGGCAAAATGTGGAACTGAGTGCATAATCCTTTTGCAGACAGTGGAATAATTGGTAATGCTAATCTGATGTACCATAATATCTCTCATATGCGTCTTTTGGTCTGGCCATGTATGCGTGGCC AGGAGTCTCTCAGTTTCACTCGGGTACAAGAATCAGGTTTACTTTCTTCTGCCATCAGCCTGACTGTGTACTTAGTTGCTCCGCACCATGACATGACTTCTTAATCTCTCAGTTTGTTCTATTCA.

[0008] In another aspect of the invention, there is an application of a goat hornless target gene RXFP2-specific expression regulatory element in enhancing RXFP2 gene expression.

[0009] In a preferred embodiment of the present invention, the enhancement of RXFP2 gene expression refers to enhancing the expression of the RXFP2 gene in keratinocytes.

[0010] Another aspect of the present invention relates to a method for knocking out the specific expression regulatory element of the goat hornless target gene RXFP2, which involves gene knockout via microinjection of sgRNA and Cas9 protein.

[0011] In a preferred embodiment of the present invention, the sgRNA sequence is: 5'-AGGACGAAAACTAAGGATAT-3' and 5'-GGACTTCTCAACAACAATGA-3'.

[0012] The beneficial effects of this invention are as follows: This invention discovers a type of horn progenitor cell in bovine horn bud tissue that highly co-expresses RXFP2 and RUNX2; single-cell chromatin accessibility analysis reveals a potential cis-regulatory element (CRE) upstream of RXFP2. Transcription factor prediction analysis shows that this regulatory element and its upstream and downstream 100bp range contain multiple RUNX2 binding motifs. Dual-luciferase reporter system verification confirms that this CRE can mediate the spatial interaction between the transcription factor RUNX2 and the RXFP2 gene, enhancing RXFP2 transcriptional activity. This CRE is specifically open in horn bud tissue but not in adjacent skin and testicular tissues, and cross-species alignment shows that its sequence is highly conserved in horned ruminants such as cattle and sheep. The sequence location in the goat genome is chr12:57440948-57441449. Based on this, the CRISPR-Cas9 system was used to directly inject Cas9 protein and sgRNA (upstream 5'-AGGACGAAAACTAAGGATAT-3' (reverse strand); downstream 5'-GGACTTCTCAACAACAATGA-3' (reverse strand), located in chr12) into goat fertilized eggs to target and knock out this regulatory element, successfully preparing goat embryos with knockout of RXFP2 horn-specific expression CRE (chr12:57440834-57441679). This invention not only elucidates the molecular mechanism of the origin and evolution of horn organs, but also transforms theoretical discoveries into a "non-surgical, high-welfare, low-cost" molecular breeding program for hornless animals through gene editing technology targeting regulatory elements, promoting the transformation of animal husbandry towards precision and sustainable development. Attached Figure Description

[0013] Figure 1 This is the identification result of RXFP2-specific expression regulatory elements (chr12:29279059-29279559) in fetal ox horn bud tissue;

[0014] Figure 2 Schematic diagram of a fluorescent reporter carrier;

[0015] Figure 3 These are the results of a dual-luciferase reporter assay that validates the transcriptional regulation level of the RXFP2 angle-specific expression regulatory element.

[0016] Figure 4 : Schematic diagram of the target site;

[0017] Figure 5 Schematic diagram of Cas9 eukaryotic expression vector; Schematic diagram of the principle of sgRNA cloning into expression vector;

[0018] Figure 6 This is the result of an experiment using dual fluorescence detection to assess the targeting efficiency of sgRNA targeting the goat RXFP2 corner-specific expression regulatory element.

[0019] Figure 7 Schematic diagram of SSA report carrier; Schematic diagram of Cas9 cleavage efficiency at target site;

[0020] Figure 8 The results are from the preparation and identification of goat embryos with CRE knockout (chr12:57440800-57441678). Detailed Implementation

[0021] To further understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0022] Unless otherwise specified, all reagents involved in the embodiments of this invention are commercially available products and can be purchased through commercial channels.

[0023] (I) Identification of RXFP2 angle-specific expression regulatory elements

[0024] 1. Pairing of snATAC-seq and snRNA-seq data of fetal bovine horn buds at three time points: 100, 150, and 200 days.

[0025] We integrated snRNA-seq and snATAC-seq data from buds (D100, D150, D200) using the R package scMEGA. By performing cell pairing to obtain one-to-one matches between the snRNA-seq and snATAC-seq data, we created a pseudo-multimodal dataset. Each cell was characterized by its gene expression and chromatin accessibility. Dimensionality reduction clustering was then performed on these cells to determine cell types.

[0026] 2. Sub-clustering analysis, cell trajectory construction, and construction of cell regulatory networks.

[0027] Sub-clustering analysis was performed on all nerve cells and fibroblasts, and their subpopulation time-tracking trajectories were plotted using the AddTrajectory function. scMEGA used chromVAR based on predicted binding sites and chromatin accessibility spectra to estimate the binding activity of each TF and cell along the time-tracking trajectory. “SelectTF” was used to identify functionally relevant TFs in biological processes, and “SelectGenes” was used to identify highly variable genes along the trajectory. scMEGA then predicted enhancer-promoter connections by calculating the correlation between enhancer chromatin accessibility and the expression of nearby genes. Genes significantly associated with at least one enhancer were retained as targets. Finally, a gene regulatory network was constructed by integrating enhancer-promoter connections, predicted transcription factor binding sites, and the correlation between transcription factor activity and target gene expression.

[0028] 3. Peak identification and TF motif analysis of differential peaks

[0029] Peak discovery was performed using MACS2 (version 2.2.7). All peaks were merged into a joint peak set. A counting matrix was constructed using the "addPeakMatrix" function. Peaks could be linked to genes using the addPeak2GeneLinks function, and finally, the JASPAR2020 database was used to enrich the TF motifs of the peaks. Furthermore, identifying commonly accessible peaks in a single cell can be used to infer chromatin spatial organization and interaction patterns. Peak co-accessibility analysis uses peak identification algorithms, such as MACS2, to locate and identify peaks in the chromatin accessibility data for each cell. The location information of these peaks is used to calculate the degree of overlap between peaks to determine peak pairs with co-accessibility in a single cell. A common method is to compare the overlap of peak regions by setting a threshold to determine whether peaks are co-accessible. Finally, analysis can infer chromatin spatial organization and interaction patterns, providing important information for further gene function annotation and regulatory network research. The identification results are as follows: Figure 1 As shown, where, Figure 1 The image above shows the scanning results of the RXFP2 gene's specifically open chromatin regions and binding motifs in keratinogenic progenitor cells. Red markers indicate peaks specifically open in keratinogenic progenitor cells. Four CREs that significantly enhance chromatin accessibility in keratin were identified. The most significant CRE (chr12:29279059-29279559) contains the RUNX2 binding motif. RUNX2 is a core osteogenic regulator in the osteogenic progenitor cell gene regulatory network, and this CRE is inactivated in testicular tissue. Figure 1The figure below shows a specific sequence alignment of the RUNX2 binding motif region. Sequence conservation analysis revealed that this CRE is specifically conserved in ruminants with head appendages. These results suggest that this CRE may mediate the specific expression of RXFP2 in horn progenitor cells.

[0030] (II) Validation of the RXFP2 angle-specific expression regulatory element

[0031] 1. Construction of a fluorescent reporter vector for regulatory elements

[0032] Using the Goat whole genome sequence published by the NCBI database website as the standard sequence, the sequences chr12:57440448-5744949, chr12:57440948-57441449(CRE), chr12:57441449-57441949 and the 1000bp gene fragment upstream of the RXFP2 transcription start site were synthesized and ligated into the vector pGL4.10 (Shanghai Sangon Biotech Co., Ltd.).

[0033] The recombinant regulatory element fluorescent reporter vectors were named RXFP2-enhancer and RXFP2-del-enhancer, respectively. A schematic diagram of the construction of the fluorescent reporter vectors is shown below. Figure 2 As shown.

[0034] 2. Dual fluorescence detection modulation element function

[0035] HEK-293T cells (Shanghai Sixin Biotechnology Co., Ltd.) and bovine mammary epithelial cell MAC-T cells (Shanghai Sixin Biotechnology Co., Ltd.) were cultured at a ratio of 5 × 10⁶ cells per well. 5 Cells were transferred to 24-well plates and cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (FBS, Gibco). When cell confluence reached 70%, cells were transferred via liposomes (Lipofectamine). TMTransfection was performed using a 3000 Transfection Reagent (Thermo Fisher Scientific). The plasmid amounts used were 0.4 μg of pGL4.10 plasmid per well, 0.1 μg of pRL-TK (Promega luciferase reporter vector) plasmid per well, and 0.4 μg of RUNX2-pcDNA3.1 plasmid per well. The groups were assigned as follows: The negative control group was transfected with the pGL4.10 empty vector and pRL-TK plasmid; the positive control group was transfected with the RXFP2-del-enhancer plasmid and pRL-TK; the experimental group was transfected with the RXFP2-enhancer plasmid and pRL-TK; the positive control group was transfected with the RXFP2-del-enhancer+RUNX2 plasmid, pRL-TK, and RUNX2-pcDNA3.1; the experimental group was transfected with the RXFP2-enhancer plasmid, pRL-TK, and RUNX2-pcDNA3.1. The samples were incubated at room temperature for 10 min, treated for 8 h, then the medium was changed. After 48 h, the samples were lysed and collected. Luciferase activity was identified using the TransDetect Double-Luciferase Reporter Assay Kit (Beijing TransGen Biotech Co., Ltd.). Results are as follows: Figure 3 As shown, the experimental results indicate that the transcriptional regulatory potential of this CRE was assessed using a dual-luciferase reporter gene detection system in two different cell models (HEK-293T and MAC-T cell lines). The results showed that the luciferase activity of the experimental group RXFP2-enhance was significantly enhanced compared to the positive control group RXFP2-del-enhancer; the luciferase activity of the experimental group RXFP2-enhance+RUNX2 was significantly enhanced compared to the positive control group RXFP2-del-enhancer+RUNX2; and the luciferase activity of the experimental group RXFP2-enhance+RUNX2 was significantly enhanced compared to the experimental group RXFP2-enhancer. These results indicate that this CRE has significant enhancer activity, mediates the interaction between RUNX2 and RXFP2, and enhances the expression level of RXFP2. (III) Detection of the efficiency of knockout of different target sites of goat RXFP2 horn-specific expression regulatory element

[0036] 1. Target site screening and off-target site prediction

[0037] The specific target sequence for the RXFP2 angular-specific expression regulatory element was determined to be chr12:57440948-57441449. Considering the presence of RUNX2 binding motifs upstream and downstream, target sites were screened within 250 bp upstream and downstream of this sequence. The website CRISPOR (http: / / crispor.tefor.net / ) was used for sgRNA design. This website's sgRNA design is applicable to the genomes of multiple species, and it provides MIT scores and CFD scores for predicting off-target effects. The former uses the same formula as websites that calculate Hsu-Zhang scores (Concordet et al. 2018; Haeussler et al. 2016), so it was ultimately selected for sgRNA screening. On the CRISPOR page, enter the target sequence, select "Capra hircus-goat-RefSeq ARS1" for the genome and "20bp-NGG-Sp Cas9,SpCas9-HF1,eSpCas91.1" for PAM to obtain all available target sites. Target sites are then selected by comprehensively comparing the targeting efficiency and off-target effects of various sgRNAs. Figure 4 Show.

[0038] 2. Construction of Cas9 targeting vector and SSA reporter vector

[0039] The eukaryotic expression vector pSpCas9(BB)-2A-GFP (Cas9 expression vector, Addgene website) is 9289 bp in length. Different sgRNAs can be inserted into the U6 promoter and scaffold structure using the BbsI restriction site. Specific vector diagrams and the principles of cloning different sgRNAs into the expression vector using BbsI are as follows: Figure 5 Show.

[0040] First, the upstream and downstream sequences of each sgRNA were synthesized separately. After annealing and ligation, the sgRNAs corresponding to different target sites were ligated into the linear vector using the BbsI restriction site and the DNA ligase SolutionI, respectively. The positive recombinants were named pCas9-360 / -353 / -386 / -389 / -1204 / -1083 / -1233 / -1092.

[0041] The vector pSSA-1-3 (single-stranded annealing reporter vector, Addgene website), 6162 bp in length, is a modified version of pGL3-Control (luciferase reporter vector) used to verify the single-stranded annealing (SSA) mechanism induced after DSB generation. The sequence between the first stop codon and EcoRI is replaced with sgRNA, allowing it to be recognized and cleaved by Cas9, resulting in a double-strand break. Cells then recover luciferase gene expression through the single-stranded annealing repair mechanism, enabling the vector to catalyze the substrate reaction and generate fluorescence. Higher Cas9 protein cleavage efficiency at different target sites and more frequent SSA repairs result in stronger cell fluorescence. The cleavage efficiency of the sgRNA relative to the corresponding Cas9 protein can be estimated by detecting the final fluorescence intensity. The vector map of the SSA reporter vector and the experimental principle of using the SSA reporter vector to detect the cleavage efficiency of Cas9 protein at different target sites are as follows. Figure 4 As shown.

[0042] Primers were designed, with the universal primer RvP3 for the pSSA-1-3 vector as the upstream primer and the sgRNA and PAM sequences as the downstream primers. The luciferase reporter vector pGL3-Control was used as a template, and the gene was cloned using a premixed enzyme (PrimeSTAR DNA Polymerase, Takara) and ligated into the backbone vector pSSA-1-3, named pSSA-360 / -353 / -386 / -389 / -1204 / -1083 / -1233 / -1092.

[0043] The specific sequences of the amplification primers are as follows:

[0044] LucRep-Forward(5'-CGAAGGTTGTGGATCTGGATACC-3')

[0045] LucRep-Reverse(5'-TAGCTGATGTAGTCTCAGTGAGC-3')

[0046] 3. Dual fluorescence detection of sgRNA targeting efficiency

[0047] Dairy goat mammary epithelial cells were transferred to 24-well plates at a rate of 5 × 10⁵ cells per well. Cell confluence was increased to 70% before being transferred to liposomes (Lipofectamine). TMTransfection was performed using a 3000 Transfection Reagent (Thermo Fisher Scientific), with 0.6 μg Cas9 plasmid, 0.2 μg pSSA plasmid, and 0.1 μg pRL-SV40 plasmid per well. Incubation was performed at room temperature for 10 min, followed by medium replacement after 8 h. Samples were lysed and collected after 48 h, and luciferase activity was identified using a TransDetect Double-Luciferase Reporter Assay Kit (Beijing TransGen Biotech Co., Ltd.). Experimental results are shown below. Figure 6 As shown, by co-transfecting cells with an SSA reporter vector containing the target site and a Cas9 expression vector, the Cas9 nuclease cleaves the target site on the reporter vector, generating DNA double-strand breaks (DSBs). The repetitive sequences upstream and downstream of the DSBs are repaired via the SSA pathway, resulting in large deletions and repairing the firefly luciferase gene. The vector pRL-SV40 containing the Renida luciferase reporter gene serves as an internal control to indicate transfection efficiency. The expression of the firefly luciferase gene and the Renida luciferase reporter gene can be assessed using a dual-fluorescence reporter system assay kit to evaluate the cleavage efficiency of the Cas9 nuclease at the target site. The results showed that in the mammary epithelial cells of dairy goats, the luciferase activity of the reporter vectors corresponding to Cas-sgRNA2-353 and Cas-sgRNA3-1233 was stronger than that of other vectors. Therefore, 5'-AGGACGAAAACTAAGGATAT-3'(reverse strand), located in chr12 and 5'-GGACTTCTCAACAACAATGA-3'(reverse strand), located in chr12 were identified as the upstream and downstream target sites of this CRE, respectively.

[0048] (iv) Preparation and identification of goat embryos with knockout of RXFP2 horn-specific expression regulatory element.

[0049] 1. Oocyte collection and maturation culture

[0050] Ovaries collected from the slaughterhouse were placed in physiological saline supplemented with penicillin-streptomycin (PS, Gibco) at a temperature of 20–23°C and transported to the laboratory within 4 hours. The ovaries were washed in preheated PBS (Gibco), and cumulus-oocyte complexes (COCs) were collected under a stereomicroscope and transferred to oocyte-collecting PBS. The COCs were repeatedly washed in PBS to remove impurities surrounding them. COCs with uniform cytoplasm and intact granulosa cells were selected and transferred to oocyte maturation medium (OM). The cells were cultured at 38.5°C in a cell culture incubator with 5% CO2 saturated humidity for 20–22 hours, with 50 COCs cultured per 500 μL of OM.

[0051] 2. In vitro fertilization

[0052] Frozen sperm was thawed in 37°C warm water. After cutting the incision, the semen flowed into PureSperm medium. Cocci cultured for 20 hours were then sequentially transferred into HEPES-TALP and BO-IVF fertilization media. Residual OM culture medium and detached granulocytes around the cocci were gently washed away. The cocci were then transferred into fertilization droplets, with each droplet containing 30 cocci. The sperm density was adjusted to 1×10⁻⁶. 6 Sperm / mL. Gently mix the sperm suspension, add 10 μL of the sperm suspension to a drop of fertilization fluid containing COCs, and incubate in a cell culture incubator for 12 h.

[0053] 3. Intrauterine Injection of Fertilized Eggs

[0054] Two hours before injection, prepare the operating droplets (SCNT nucleus-free solution), 80 μL each, and cap with mineral oil. The number of droplets is determined based on the experimental group being injected, with two droplets required per group. Equilibrate on a 38.5℃ hot plate. Pre-cool the mixture in a 4℃ centrifuge for 20 min beforehand, and centrifuge the sgRNA and Cas9 protein at 16000g for 30 min at 4℃. Mix the sgRNA and Cas9 protein and adjust their final concentrations to 100 ng / μL with buffer, then incubate at room temperature for 30 min. Prepare the fixation needle and injection needle using a needle grinding and calcining apparatus. The fixation needle has an orifice diameter of approximately 100 μm and is bent at 30°, while the injection needle has a diameter of 5–7 μm and is bent at 25°. After incubation for 10 hours, fertilized eggs were treated with hyaluronidase to remove encapsulated granulosa cells and adherent sperm. The eggs were then washed twice with HEPES-TALP. Eggs with clearly defined polar bodies and uniform cytoplasm were selected and placed in the manipulation solution. A small amount (4–5 μL) of RNP solution was drawn using a micro-sampler and added to the injection needle. The positions of the fixation needle and injection needle were adjusted to secure the fertilized eggs. The injection needle was then used to strike the incision site and smooth the cut surface. Injection was performed using a microinjector. Approximately 50 fertilized eggs were injected each time, with each egg receiving approximately 5 μL of RNP solution.

[0055] 4. In vitro culture

[0056] After injection, the fertilized eggs were washed three times in SOF washing buffer (BO-IVC can also be used), placed in BO-IVC droplets, and incubated for 10 minutes. Dead fertilized eggs were discarded. The remaining fertilized eggs were transferred to new BO-IVC droplets and cultured in an incubator. Development rate was recorded, and editing efficiency was assessed. Primers were designed 500 bp upstream and downstream of the knockout fragment. Gene amplification was performed using knockout goat embryos and non-knockout goat embryos (control group) as templates. Agarose gel electrophoresis was used to observe band size; the non-knockout fragment should be approximately 1700 bp, and the knockout fragment approximately 1000 bp. The 1000 bp band was recovered, and sequencing results were compared with the target sequence. Experimental results are as follows: Figure 8 As shown in Figure A, the blastocyst development ratio of goat fertilized eggs after direct injection of sgRNA shows that 6 out of 36 fertilized eggs developed normally into blastocysts. Figure B shows the gene fragments amplified after primers were designed at 500 bp upstream and downstream of the target fragment (chr12:57440800-57441678). The control group, using genomic DNA extracted from Qing goat blood tissue as a template, should have a gene fragment of 1878 bp. The experimental group, using blastocysts injected with sgRNA as templates, should have a gene fragment of 878 bp. The agarose gel electrophoresis results in the figures show that the control group only had a band of about 1800 bp, while the experimental group had both 1800 bp and 800 bp bands, proving that they were heterozygous knockout embryos.

[0057] The preferred embodiments of the present invention have been described above, but are not intended to limit the invention. Those skilled in the art can make modifications and variations to the embodiments disclosed herein without departing from the scope and spirit of the invention.

Claims

1. A specific expression regulatory element for the goat hornless target gene RXFP2, whose sequence is SEQ ID No.

1.

2. Use of the goat hornless target gene RXFP2 specific expression regulatory element according to claim 1 in improving RXFP2 gene expression.

3. The use according to claim 2, wherein said increasing the expression of the RXFP2 gene refers to increasing the expression of the RXFP2 gene in horn tissue.

4. A method for knocking out the specific expression regulatory element of the goat hornless target gene RXFP2 according to claim 1, wherein gene knockout is performed by microinjection of sgRNA and Cas9 protein.

5. The method according to claim 1, wherein the sequences of the sgRNA are: 5'-AGGACGAAAACTAAGGATAT-3' and 5'-GGACTTCTCAACAACAATGA-3'.

Images