SNP (Single Nucleotide Polymorphism) molecular marker for identifying high / low folic acid content of cucumber fruit and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker for identifying high / low folic acid content of cucumber fruit and application of the SNP molecular marker, the site of the SNP marker is the 1st 875bp and 192bp of the physical position of a cucumber chromosome 6, the basic group of the site is C or T, the cucumber material with the basic group of the site is the cucumber material with high folic acid content of the fruit, and the cucumber material with the basic group of the site is the cucumber material with high folic acid content of the fruit. The cucumber material with the basic group at the site being T is a fruit low-folic-acid-content cucumber material. The invention not only lays a foundation for fine positioning and molecular cloning of folic acid content traits of cucumber fruits, but also provides an efficient approach for molecular marker-assisted breeding of new varieties of cucumbers with high folic acid content.

Description

Technical Field

[0001] The present invention relates to the technical field of biotechnology-assisted breeding, and in particular to a SNP molecular marker for identifying high / low folic acid content in cucumber fruits and an application thereof. Background Art

[0002] Folic acid, referring to tetrahydrofolic acid (THF) and its derivatives, is a water-soluble B vitamin essential for living organisms. The folic acid molecule is composed of three components: pterin, para-aminobenzoic acid (PABA), and glutamic acid (Storozhenko et al., 2008). Folic acid deficiency can lead to conditions such as megaloblastic anemia and neural tube defects in the fetus. Therefore, folic acid is crucial for normal human life. The human body cannot synthesize folic acid on its own and must obtain it from food.

[0003] Folate biosynthesis occurs in mitochondria, chloroplasts, and the cytoplasm (Hanson et al. 2011; Ravanel et al. 2011). In the cytoplasm, GTP is converted to 6-hydroxymethyldihydropterin (HMDHP) catalyzed by GTP cyclohydrolase I (GTPCHI), phosphorylase, and dihydroneopterin aldolase (DHNA) (Basset et al. 2002). In chloroplasts, chorismate is converted to acetamidobenzoic acid (pABA) catalyzed by aminodeoxychorismate synthase (ADCS) and aminodeoxychorismate lyase (ADCL) (Matthews et al. 2007). GTPCHI and ADCS are generally considered the key enzymes catalyzing folate synthesis in plants.

[0004] Folate content in both grain crops and vegetables varies widely. Among 78 rice germplasm resources, the folate content of brown rice and polished rice ranged from 13.3 to 111.4 μg / 100 g and 10.3 to 77.7 μg / 100 g, respectively (Dong et al. 2011). Riaz et al. (2019) analyzed the folate content of 360 wheat grains, finding a range of 10.15 to 91.44 μg / 100 g. In another study, the folate content of 262 wheat germplasm resources ranged from 22.68 to 111.77 μg / 100 g (Zheng et al. 2022). Folate content in 67 and 54 potato tubers ranged from 52.1 to 137.3 μg / 100 g and 38.8 to 209.8 μg / 100 g, respectively (Goyer et al. 2007; Goyer et al. 2011). Folate content in green-ripe fruit from 125 tomato accessions ranged from 12.5 to 70.9 μg / 100 g, while folate content in red-ripe fruit ranged from 13.8 to 45.8 μg / 100 g (Upadhyaya et al., 2016). Folate content in 67 spinach accessions ranged from 54.1 to 173.2 μg / 100 g (Shohag et al., 2011). Folate concentrations in 50 cowpea seeds ranged from 177.2 to 780.7 μg / 100 g (Nascimento et al., 2011).

[0005] So far, no SNP markers linked to high folate content in cucumber fruit have been reported. Summary of the Invention

[0006] The purpose of the present invention is to address the above problems and provide a SNP molecular marker for identifying high / low folate content in cucumber fruits and its application.

[0007] In order to achieve its purpose, the present invention adopts the following technical solutions:

[0008] The first aspect of the present invention provides a SNP molecular marker for identifying high / low folate content in cucumber fruit. The site of the SNP marker is at the physical position 1,875,192bp of cucumber chromosome 6. The base at this site is C or T. The cucumber material with the base C at this site is a cucumber material with high folate content in the fruit, and the cucumber material with the base T at this site is a cucumber material with low folate content in the fruit.

[0009] The second aspect of the present invention provides the use of the above-mentioned SNP molecular marker for identifying high / low folate content in cucumber fruit in any of the following (1)-(3):

[0010] (1) Identify or assist in identifying cucumber fruit materials with high or low folate content;

[0011] (2) Screening or assisting in the screening of cucumber varieties with high folate content in fruits;

[0012] (3) Cultivate or assist in the cultivation of cucumber varieties with high folic acid content in fruits;

[0013] The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3 or SEQ ID NO.4, wherein the 29th base is C or T. The cucumber material whose base at this position is C is a cucumber material with a high folate content in the fruit, and the cucumber material whose base at this position is T is a cucumber material with a low folate content in the fruit.

[0014] The application comprises the following steps: extracting genomic DNA of a sample to be tested as a template, performing PCR amplification using the amplification primers of the SNP molecular marker, and performing sequencing or enzyme digestion electrophoresis detection on the PCR amplification product. The enzyme digestion electrophoresis detection refers to using a restriction endonuclease that can recognize the differential site of the SNP molecular marker to digest the PCR amplification product, and then performing electrophoresis on the amplification product; preferably, the electrophoresis adopts non-denaturing polyacrylamide gel electrophoresis.

[0015] In the above application technology solution, the amplification primers for the SNP molecular marker are as follows:

[0016] dcaps-06-F: 5'-GACTCTTGTCTTCGGTCATTCACAGACT-3',

[0017] dcaps-06-R: 5'-CAACGATTAATCTATACATGAGGGGAGG-3'.

[0018] In the above-mentioned application technology scheme, PCR amplification obtains a 208bp fragment. When sequencing detection is used, the cucumber material whose 29th base of the PCR amplification fragment is C is a cucumber material with high folate content in the fruit, and the cucumber material whose 29th base of the PCR amplification fragment is T is a cucumber material with low folate content in the fruit.

[0019] In the above-mentioned application technology solution, the PCR amplification reaction system includes a DNA template, amplification primers, 2×3G TaqMasterMix for PAGE, and double-distilled water.

[0020] In the above-mentioned application technology solution, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, extension at 72°C for 30 seconds, 35 cycles; and insulation at 72°C for 5 minutes.

[0021] In the above-mentioned application technology scheme, PCR amplification obtains a 208bp fragment. When enzyme digestion and electrophoresis are used for detection, the restriction endonuclease is HinfI. If a 208bp band is obtained by electrophoresis after enzyme digestion, the detection object is a fruit with low folate content; if a 183bp band is obtained by electrophoresis after enzyme digestion, the detection object is a fruit with high folate content.

[0022] In the above application technology scheme, the HinfI enzyme digestion system is: 3 μl of PCR product, 0.2 μl of endonuclease, 1 μl of NEB cutsmart buffer, and 5.8 μl of double-distilled water;

[0023] The enzyme digestion temperature was 37°C and the enzyme digestion time was 2 h.

[0024] The third aspect of the present invention provides a kit for detecting the above-mentioned SNP molecular marker, comprising the amplification primers dcaps-06-F and dcaps-06-R of the SNP molecular marker, wherein the nucleic acid sequences of the primers are as follows:

[0025] dcaps-06-F: 5'-GACTCTTGTCTTCGGTCATTCACAGACT-3',

[0026] dcaps-06-R: 5'-CAACGATTAATCTATACATGAGGGGAGG-3';

[0027] Preferably, the kit further comprises a cucumber genomic DNA extraction reagent, a PCR amplification reaction reagent, a PCR amplification product sequencing reagent or a SNP differential site identification reagent; preferably, the SNP differential site identification reagent comprises a restriction endonuclease capable of identifying SNP differential sites.

[0028] The beneficial effects of the present invention are:

[0029] The present invention not only lays a foundation for the precise positioning and molecular cloning of the folic acid content in cucumber fruits, but also provides an efficient approach for the use of molecular markers to assist in the selection of new cucumber varieties with high folic acid content.

[0030] The present invention provides an application for assisting in the screening of new cucumber varieties with high folate content based on the developed SNP marker. The SNP marker-specific primers dcaps-06-F / dcaps-06-R are used to amplify genomic DNA of the test material, and the amplified product is then sequenced and identified or digested with HinfI. The method provided by the present invention allows screening of cucumber candidate materials for high or low folate content at any stage, offering the advantages of high efficiency, few restrictions, and high accuracy, thereby improving the efficiency of breeding high-folate cucumber varieties and shortening the breeding cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The present invention is a SNP marker (SNP1875192) for detecting cucumber parent material 65G (P1), 02245 (P2), and F1 generation single plant after enzyme digestion and electrophoresis detection results; lanes 1-3 are the detection results of parent material 65G (P1), 02245 (P2), and F1 generation single plant, respectively; wherein, P1: 65G (low folic acid content) obtained a 208 bp fragment, P2: 02245 (high folic acid content) obtained a 183 bp fragment, and two fragments of 208 bp and 183 bp were detected simultaneously in the F1 generation.

[0032] Figure 2 The results of electrophoresis detection of 40 samples of cucumber materials were used to verify the SNP marker (SNP1875192). DETAILED DESCRIPTION

[0033] The present invention will be further described below with reference to the embodiments, but the present invention is not limited thereto.

[0034] In the following examples, all experimental reagents not otherwise specified are conventional reagents in the art and can be prepared according to conventional methods in the art or purchased commercially. All experimental methods not otherwise specified are conventional methods in the art and can be referred to in the Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: a laboratory manual, 2001) or the methods described in the manufacturer's instructions.

[0035] Materials and Methods

[0036] 65G(P1): A European greenhouse-type female cucumber strain bred by the Cucumber Research Group of the Institute of Vegetables and Floriculture, Chinese Academy of Agricultural Sciences. It boasts strong growth, large leaves, and frequent fruiting. The fruit is approximately 18 cm long, with a smooth, no-thorny skin and a low folate content. This is a known variety, also described in the article "New Cucumber Variety 'Zhongnong No. 19'" published by Gu Xingfang et al. in the 2006 Journal of Horticulturae Sinica, Issue 3, Page 690. This product is preserved in our laboratory and guaranteed to be released to the public for verification experiments within 20 years of the application date.

[0037] 02245(P2): This North China spiny cucumber inbred line was bred by the Cucumber Research Group of the Institute of Vegetables and Floriculture, Chinese Academy of Agricultural Sciences. It boasts strong growth, medium-sized leaves, dark green cucumbers, and a length of approximately 35 cm. Its white spines are densely packed, with small to medium-sized tubercles, no ridges, and no veins. Its fruits are high in folate. This is a known variety and was also described in the article "Breeding of a New Heat-Tolerant Cucumber Variety, Zhongnong 106," published by Gu Xingfang et al. in "China Vegetables," Issue 6, pp. 31-33, in 2008. This line is preserved in our laboratory and will be released to the public for verification experiments within 20 years of the application date.

[0038] By crossing '65G' as the female parent and '02245' as the male parent, F1 was obtained. An F9 generation RILs population containing 140 lines was obtained by single seed transmission, and 40 materials were used for verification experiments.

[0039] All experimental materials are kept in the laboratory of the Cucumber Research Group of the Institute of Vegetables and Floriculture, Chinese Academy of Agricultural Sciences, and are guaranteed to be released to the public for verification experiments within twenty years from the date of application.

[0040] The DCAPS-06 marker primers were designed in our laboratory based on the resequencing genome information using DCAPS Finder software (http: / / helix.wustl.edu / dcaps / dcaps.html) and Primer 3.0 software, and synthesized at Beijing Bioengineering Co., Ltd. Details of the resequencing genome are available in the 2013 paper "Agenomic variation map provides insights into the genetic basis of cucumber domestication and diversity" by Qi et al., published in Nature Genetics.

[0041] Main reagents

[0042] PCR experiments used Vazyme's 2×3G Taq Master Mix for PAGE (RedDye). Enzymatic digestion used the restriction endonuclease HinfI from New England Biolabs. Gel electrophoresis used 40% native polyacrylamide (from Beijing Coolbo Technology Co., Ltd.), diluted to 6%. Sequencing was performed at Beijing Bioengineering Co., Ltd.

[0043] Method for detecting folic acid content in cucumber fruit in the embodiment:

[0044] Currently, methods for detecting folic acid content in fruits and vegetables include indirect fluorescence method, high performance liquid chromatography, etc. High performance liquid chromatography has a low detection limit, high accuracy, good repeatability, and simple operation. The present invention adopts high performance liquid chromatography to detect the folic acid content in cucumber fruits.

[0045] Commercial cucumbers of appropriate size, located between nodes 15 and 20, were selected. Thin slices approximately 1 cm long were evenly cut from the head, middle, and tail of the fruit. These slices were quickly frozen in liquid nitrogen and stored at -80°C. The samples were ground using a ball mill and then dried. The folate content was then determined using high-performance liquid chromatography (HPLC)-tandem mass spectrometry (HPLC-MS / MS), following the method developed by Wan Xing et al. (2019) for determining folate in starchy crops.

[0046] Example 1. Acquisition of SNP markers linked to folate content in cucumber fruits

[0047] Based on the resequencing information of the core germplasm population, we first screened for SNPs with a minimum allele frequency (MAF) greater than 0.5 and a deletion rate less than 20%. We then conducted an association analysis using the FaST-LMM (Factored Spectrally Transformed Linear Mixed Models) model with -log 10 A threshold of (P) = 5 was used to screen for significantly associated loci. Manhattan plots and QQ-plots were created using the R package CMplot. The locus associated with cucumber fruit folate content was mapped to chromosome 6, with the maximum threshold point located at SNP 1875192. Based on these results, we conducted this study.

[0048] 1. Acquisition of SNP markers

[0049] Combining the folate content and resequencing data of 130 core germplasm populations, GWAS analysis was used to obtain the SNP marker SNP1875192 (T / C) linked to the high folate content in cucumber fruit at the physical position 1,875,192bp on chromosome 6 of cucumber. It was found that in the genome of cucumber material 65G (low folate content, the folate content in its cucumber fruit was 4.35μg / g), the base of this site was T; in the genome of cucumber material 02245 (high folate content, the folate content in its cucumber fruit was 7.23μg / g), the base of this site was C.

[0050] 2. Development of dCAPS markers based on SNP markers

[0051] Based on the SNP marker SNP1875192, which is linked to high folate content in cucumber fruit, a dCAPS marker (designated dcaps-06) linked to folate content in cucumber fruit was developed. The DNA sequence of the above-mentioned region of the cucumber chromosome 6 reference genome (the reference genome sequence of the North China cucumber line "9930," version number: Cucumber (Chinese Long) v3 Genome) was downloaded from the Cucumber Genome Database website (http: / / cucurbitgenomics.org / ). Based on the location of the SNP, a pair of primers were designed using the dCAPS Finder 2.0 website (http: / / helix.wustl.edu / dcaps / dcaps.html) and Primer 3.0 software:

[0052] dcaps-06-F (SEQ ID NO.1): 5'-GACTCTTGTCTTCGGTCATTCACAGACT-3',

[0053] dcaps-06-R (SEQ ID NO. 2): 5'-CAACGATTAATCTATACATGAGGGGAGG-3'.

[0054] Due to the relationship of the SNPs obtained above (SNP = T / C), when base C is present, the recognition sequence of the restriction endonuclease HinfI is formed (G↓ANTC, ↓ is the enzyme cutting site), and the amplified fragment can be cut by the endonuclease HinfI; when base T is present, the recognition sequence of the restriction endonuclease HinfI cannot be formed, and the amplified fragment cannot be cut by the endonuclease HinfI.

[0055] PCR amplification was performed on the parent materials 65G and 02245 using the above primers (dcaps-06-F / dcaps-06-R). A 208 bp band was obtained in material 65G (low folate content) (nucleotide sequence shown in SEQ ID NO.3); a 208 bp band was also obtained in material 02245 (high folate content) (nucleotide sequence shown in SEQ ID NO.4). The amplified fragment was digested with the endonuclease HinfI to obtain a specific band ( Figure 1 ), a 208 bp band was obtained in material 65G (low folate content), and a 183 bp band was obtained in material 02245 (high folate content) (nucleotide sequence shown in SEQ ID NO.5).

[0056] The specific operation method of the detection is as follows:

[0057] Step 1. DNA extraction and PCR amplification

[0058] Young leaves of cucumber plants were taken and the genomic DNA of parents 65G (P1) and 02245 (P2) as well as F1 and RILs populations were extracted using a modified CTAB (cetyltrimethylammonium bromide) method.

[0059] The dCAPS labeling PCR reaction system is as follows: total reaction system 10 μL, 3 μL DNA (5.0 ng·μL -1 ), forward and reverse primers dcaps-06-F / dcaps-06-R (concentration 50 ng·μL -1 ) 1 μL each, 5 μL 2×3G Taq Master Mix for PAGE (Red Dye) (product of Vazyme).

[0060] The PCR amplification program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 30 s, for 35 cycles; incubation at 72°C for 5 min, and storage at 16°C.

[0061] Step 2. Complete digestion of PCR products with HinfI

[0062] The enzyme digestion system was as follows: 3 μl of PCR product, 0.2 μl of endonuclease, 1 μl of NEB cutsmart buffer, and 5.8 μl of double-distilled water. The digestion temperature was 37°C and the digestion time was 2 h.

[0063] Step 3. Result determination

[0064] Method 1: Skip step 2 and sequence the PCR products directly without enzyme digestion. The sequence obtained for 65G (low folate content) contains a T at base 29; the sequence obtained for 02245 (high folate content) contains a C at base 29; and the sequence obtained for F1 contains both a T and a C at this position.

[0065] Method 2: After complete digestion with endonuclease HinfI, the digestion products were separated by 6% non-denaturing polyacrylamide gel, the electrophoresis buffer was 0.5×TBE, and the electrophoresis was performed at 150V constant power for 1 hour. After electrophoresis, silver staining was performed and the band patterns were counted.

[0066] like Figure 1 As shown, 65G (low folate content) yielded a 208 bp fragment, with the band pattern designated a; 02245 (high folate content) yielded a 183 bp fragment, with the band pattern designated b; two bands were detected simultaneously in F1, with the band pattern designated h. Its field phenotype was low folate content in fruit (the folate content in its cucumber fruit was 5.11 μg / g). The fragment (208 bp) linked to low folate content in cucumber is SEQ ID NO. 3:

[0067] GACTCTTGTCTTCGGTCATTCACAGACT T AGATAACATATTATTCAAGATATTTCGATA

[0068] CTAATTTAACCTCTTGATCATTACTTGTAGCATTATGAAAGTAATTTCATCTTCCTCC

[0069] TCAAAAAGCCCTTGTTCTAAACTACTTTAAGCATTACAGTGCTAGTGTGGCTAAGTAGGTTACCTCCCCTCATGTATAGATTAATCGTTG.

[0070] Fragment linked to cucumber high folate (208 bp), SEQ ID NO. 4:

[0071] GACTCTTGTCTTCGGTCATTCACAGACT C AGATAACATATTATTCAAGATATTTCGATA

[0072] CTAATTTAACCTCTTGATCATTACTTGTAGCATTATGAAAGTAATTTCATCTTCCTCC

[0073] TCAAAAAGCCCTTGTTCTAAACTACTTTAAGCATTACAGTGCTAGTGTGGCTAAGTAGGTTACCTCCCCTCATGTATAGATTAATCGTTG.

[0074] The fragment linked to cucumber high folate was digested with HinfI to generate a fragment (183 bp), SEQ ID NO.5: ACT C AGATAACATATTATTCAAGATATTTCGATACTAATTTAACCTCTTGATCATTACTTGTAGCATTATGAAAGTAATTTCATCTTCCTCCTCAAAAAGCCCTTGTTCTAAACTACTTTAAGCATTACAGTGCTAGTGTGGCTAAGTAGGTTACCTCCCCTCATGTATAGATTAATCGTTG.

[0075] Example 2. Validation of SNP markers linked to high folate content in cucumber fruit

[0076] Using 40 recombinant inbred line materials preserved by our research group, the SNP marker (dcaps-06) linked to fruit folate content obtained in Example 1 was validated to determine the accuracy of this marker for molecular marker-assisted selection. The validation method used steps 1 to 3 described in Example 1. The results of field identification and molecular validation are shown in Table 1. The enzyme digestion bands of the PCR products are shown in Table 1. Figure 2 .

[0077] Table 1. Results of folate content determination and molecular verification of 40 cucumber recombinant inbred lines

[0078]

[0079]

[0080] *Note: The bold slashes in Table 1 indicate materials whose actual folate content phenotype in the fruit was inconsistent with the molecular detection results.

[0081] According to the cluster analysis results of the fruit folate content test results of the RILs population of 140 strains obtained by our research group in the early stage (crossing with '65G' as the female parent and '02245' as the male parent to obtain F1, and the F9 generation RILs population containing 140 strains was obtained by the single seed transmission method), the materials were divided into three categories. The cucumber fruit with a folate content of more than 7.04μg / g was high folate material, the one with a folate content of 5.97-7.04μg / g was medium folate material, and the one with a folate content of less than 5.97μg / g was low folate material.

[0082] The investigation revealed that field phenotypic identification of the 40 cucumber samples used for validation in Table 1 showed a highly significant difference in folate content between low-folate and high-folate samples. Twenty samples had a low folate content field phenotype (less than 5.97 μg / g), with an average folate content of 5.07 μg / g in the fruit. 18 samples had an enzyme electrophoresis band type a, while 2 samples had an enzyme electrophoresis band type b. The accuracy of molecular identification for these 20 samples was 90.0%. Another 20 cucumber samples had a high folate content field phenotype (above 7.04 μg / g), with an average folate content of 8.23 μg / g in the fruit. 18 samples had an enzyme electrophoresis band type b, while 2 samples had an enzyme electrophoresis band type a. The accuracy of molecular identification for these 20 samples was 90.0%.

[0083] In the identification of all 40 materials, the phenotypic data reflected by the electrophoresis band patterns of 36 of the 40 materials using the SNP marker of the present invention were consistent with the actual folate content determination results, and the overall accuracy of the molecular identification results was 90.0%. The molecular identification method of the present invention can be used to identify cucumber materials with high folate content and for molecular-assisted breeding.

Claims

1. A SNP molecular marker for identifying high / low folate content in cucumber fruit, characterized by: The site of the SNP marker is at the physical position 1,875,192bp of cucumber chromosome 6. The base of this site is C or T. The cucumber material with the base C at this site is a cucumber material with high folate content in the fruit, and the cucumber material with the base T at this site is a cucumber material with low folate content in the fruit.

2. Use of the SNP molecular marker for identifying high / low folate content in cucumber fruit according to claim 1 in any of the following (1)-(3): (1) Identify or assist in identifying cucumber fruit materials with high or low folate content; (2) Screening or assisting in the screening of cucumber varieties with high folate content in fruits; (3) Cultivate or assist in the cultivation of cucumber varieties with high folic acid content in fruits; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3 or SEQ ID NO.4, wherein the 29th base is C or T. The cucumber material whose base at this position is C is a cucumber material with a high folate content in the fruit, and the cucumber material whose base at this position is T is a cucumber material with a low folate content in the fruit.

3. The use according to claim 2, characterized in that The application comprises the following steps: extracting genomic DNA of a sample to be tested as a template, performing PCR amplification using the amplification primers of the SNP molecular marker, and performing sequencing or enzyme digestion electrophoresis detection on the PCR amplification product. The enzyme digestion electrophoresis detection refers to using a restriction endonuclease that can recognize the differential site of the SNP molecular marker to digest the PCR amplification product, and then performing electrophoresis on the amplification product; preferably, the electrophoresis adopts non-denaturing polyacrylamide gel electrophoresis.

4. The use according to claim 3, characterized in that: The amplification primers for the SNP molecular markers are as follows: dcaps-06-F: 5'-GACTCTTGTCTTCGGTCATTCACAGACT-3', dcaps-06-R: 5'-CAACGATTAATCTATACATGAGGGGAGG-3'.

5. The use according to claim 4, characterized in that: A 208 bp fragment was obtained by PCR amplification. When sequencing was used for detection, the cucumber material whose 29th base of the PCR amplification fragment was C was a cucumber material with high folate content in the fruit, and the cucumber material whose 29th base of the PCR amplification fragment was T was a cucumber material with low folate content in the fruit.

6. The use according to claim 4 or 5, characterized in that: The PCR amplification reaction system includes DNA template, amplification primers, 2×3G Taq Master Mix for PAGE, and double-distilled water.

7. The use according to claim 6, characterized in that: The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 30 s, for 35 cycles; and insulation at 72°C for 5 min.

8. The use according to claim 4, characterized in that: A 208 bp fragment is obtained by PCR amplification. When enzyme digestion and electrophoresis are used for detection, the restriction endonuclease is HinfI. If a 208 bp band is obtained by electrophoresis after enzyme digestion, the detected object is a fruit with low folate content; if a 183 bp band is obtained by electrophoresis after enzyme digestion, the detected object is a fruit with high folate content.

9. The use according to claim 8, characterized in that: The HinfI digestion system was as follows: PCR product 3 μl, endonuclease 0.2 μl, NEB cutsmart buffer 1 μl, double-distilled water 5.8 μl; The enzyme digestion temperature was 37°C and the enzyme digestion time was 2 h.

10. A kit for detecting the SNP molecular marker according to claim 1, characterized in that: The amplification primers dcaps-06-F and dcaps-06-R containing the SNP molecular marker have the following nucleic acid sequences: dcaps-06-F: 5'-GACTCTTGTCTTCGGTCATTCACAGACT-3', dcaps-06-R: 5'-CAACGATTAATCTATACATGAGGGGAGG-3'; Preferably, the kit further comprises a cucumber genomic DNA extraction reagent, a PCR amplification reaction reagent, a PCR amplification product sequencing reagent or a SNP differential site identification reagent; preferably, the SNP differential site identification reagent comprises a restriction endonuclease capable of identifying SNP differential sites.

Images