Rapid detection kit for phytophthora infestans and application thereof
The rapid detection kit designed by recombinase polymerase amplification and CRISPR/Cas12a reaction solves the complex and cost problems of detection equipment in the prior art, and realizes rapid, sensitive and specific detection of Phytophthora pathogenic at room temperature, which is suitable for grassroots and wild environments.
Patent Information
- Application Number
- CN202510761293.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-09
- Publication Date
- 2025-08-12
AI Technical Summary
The existing Phytophthora pathogenic detection technology is difficult to promote in grassroots testing institutions, especially the immediate detection requirements in fields, which have problems such as complex operation, high cost and high equipment requirements.
A rapid detection kit designed with recombinase polymerase amplification (RPA) and CRISPR/Cas12a reaction is used to identify RPA amplification products using specific RPA primers and crRNA, and combined with fluorescent reporter molecules to detect Phytophthora pathogenic. The reaction temperature is around 37°C without the need for complex temperature control equipment.
It realizes rapid, sensitive and specific detection of Phytophthora pathogenic Phytophthora at room temperature, and can detect early infection of Phytophthora diseases, and is suitable for use in grassroots testing institutions and outdoor environments.
Smart Images

Figure CN120464779A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microbial detection, in particular to a rapid detection kit for Phytophthora infestans and application thereof. Background Art
[0002] Potato late blight, caused by Phytophthora infestans, is the most serious plant disease that reduces potato yields. The disease can infect all parts of the potato plant, including leaves, tubers, and stems, and is considered the "cancer" of the potato. It is a typical climatic epidemic disease, most likely to occur and spread during periods of high humidity, cool temperatures, foggy weather, or rainy weather. It is particularly prone to disasters in rainy years, and is characterized by rapid and widespread spread.
[0003] Currently, a variety of technologies and methods are available for detecting Phytophthora infestans. In addition to traditional disease diagnostic techniques, there are also diagnostic methods based on symptom manifestations, including spectral and imaging detection, and diagnostic methods based on biological causes, including immunological and molecular diagnostic techniques. Molecular diagnostic techniques use DNA or RNA nucleic acids as diagnostic materials and utilize molecular biological methods such as nucleic acid amplification to determine the presence of the pathogen. These techniques include polymerase chain reaction (PCR), real-time fluorescence PCR, and loop-mediated isothermal amplification (LAMP). However, PCR and other techniques require thermal cycling and specialized and expensive laboratory equipment, making them difficult to scale to grassroots testing institutions. Furthermore, they require precise operation and strict control conditions, resulting in high operational complexity and time costs. LAMP is an isothermal amplification technique. While it simplifies temperature control requirements to some extent, the reaction temperature still needs to be kept within the range of 60-65°C, requiring additional temperature control equipment, making it difficult to scale to grassroots testing institutions, especially for immediate field testing. Summary of the Invention
[0004] In order to solve the above problems, the present invention provides a rapid detection kit for Phytophthora infestans and its application. The kit provided by the present invention can quickly detect Phytophthora infestans and has the advantages of strong specificity, high sensitivity, high efficiency, rapidity and early identification.
[0005] In order to achieve the above object, the present invention provides the following technical solutions:
[0006] The present invention provides a rapid detection kit for Phytophthora infestans, comprising: a recombinase polymerase amplification reagent and a CRISPR / Cas12a reaction reagent; the recombinase polymerase amplification reagent comprises an RPA primer; the CRISPR / Cas12a reaction reagent comprises: crRNA and a fluorescent reporter molecule; the RPA primers comprise RPA-F3 and RPA-R1; the nucleotide sequences of RPA-F3 and RPA-R1 are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively; the nucleotide sequence of the crRNA is shown in SEQ ID NO.8; the fluorescent reporter molecule is ssDNA modified with a fluorescent group and a quenching group; the nucleotide sequence of the ssDNA is: 5'-TTATTATT-3'.
[0007] Preferably, the fluorescent group includes: FAM, HEX or europium chelate fluorescein; the quencher group includes: BHQ1 or Cy5.
[0008] Preferably, the 5' end of the ssDNA is modified with a fluorescent group, and the 3' end is modified with a quenching group.
[0009] Preferably, the recombinase polymerase amplification reagent further includes: primer-free rehydration buffer and magnesium acetate; the CRISPR / Cas12a reaction reagent further includes: Reaction Buffer and LbCas12a.
[0010] The present invention provides the use of the kit described in the above technical solution in detecting plant diseases caused by Phytophthora infestans.
[0011] Preferably, the plant diseases include potato late blight and / or tomato late blight.
[0012] The present invention provides a method for detecting Phytophthora infestans for non-diagnostic purposes using the kit described in the above technical solution, comprising the following steps:
[0013] Using the genomic DNA of the sample to be tested as a template, RPA reaction is performed using RPA primers to obtain RPA amplification products;
[0014] Mixing the RPA amplification product with the CRISPR / Cas12a reaction reagent to obtain a reaction solution to be tested;
[0015] Mix ddH2O with CRISPR / Cas12a reaction reagent to obtain a negative control reaction solution;
[0016] The test reaction solution and the negative control reaction solution were subjected to CRISPR / Cas12a reaction respectively, and the fluorescence intensity of the test reaction solution and the negative control reaction solution was detected; the average value of the fluorescence intensity of the negative control reaction solution + 3 times the standard deviation was set as the threshold;
[0017] If the fluorescence intensity of the reaction solution to be tested is greater than the threshold value, the sample to be tested contains Phytophthora infestans or is infected with Phytophthora infestans.
[0018] Preferably, the reaction system of the RPA reaction includes: 2.4 μL of RPA-F3 with a concentration of 10 μM, 2.4 μL of RPA-R1 with a concentration of 10 μM, 2 μL of genomic DNA, 29.5 μL of primer-free rehydration buffer, 2.5 μL of magnesium acetate with a concentration of 280 mM and 11.2 μL of ddH2O; the temperature of the RPA reaction is 37°C and the time is 60 minutes.
[0019] Preferably, the reaction solution includes: 5 μL of 10×Reaction Buffer, 2.5 μL of LbCas12a at a concentration of 2 μM, 2.5 μL of crRNA at a concentration of 2 μM, 5 μL of a fluorescent reporter molecule at a concentration of 2 μM, 2 μL of RPA amplification product and 33 μL of ddH2O; the temperature of the CRISPR / Cas12a reaction is 37°C and the time is 15 minutes.
[0020] Preferably, the sample to be tested includes plant leaves; the plants include potatoes and / or tomatoes.
[0021] Beneficial effects:
[0022] The present invention provides a rapid detection kit for Phytophthora infestans, comprising: a recombinase polymerase amplification reagent and a CRISPR / Cas12a reaction reagent; the recombinase polymerase amplification reagent comprises an RPA primer; the CRISPR / Cas12a reaction reagent comprises: crRNA and a fluorescent reporter molecule; the RPA primers comprise RPA-F3 and RPA-R1; the nucleotide sequences of RPA-F3 and RPA-R1 are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively; the nucleotide sequence of the crRNA is shown in SEQ ID NO.8; the fluorescent reporter molecule is ssDNA modified with a fluorescent group and a quenching group; the nucleotide sequence of the ssDNA is: 5'-TTATTATT-3'. The test kit provided by the present invention is a test kit based on recombinase polymerase amplification (RPA) and CRISPR / Cas12a reaction design, according to the PiNW gene design of Phytophthora infestans, the RPA primers for specific amplification and the crRNA for specific recognition RPA amplification product, using the bispecificity of primers and crRNA, can be specific and quickly detect Phytophthora infestans;In addition, the reaction temperature of RPA is about 37 DEG C, without the need for complicated temperature control equipment, and can even be reacted at room temperature, only simple insulation measures are needed, and it is suitable for application in field environment or grassroots testing agencies, particularly in those lacking professional equipment and strict experimental conditions. The test kit provided by the present invention has a high degree of sensitivity and specificity, can detect and diagnose Phytophthora diseases as early as possible, and can also sensitively detect whether there is Phytophthora infestans pathogen in plants for plants that are in the invasion phase and incubation phase of infection in the early stage and have not yet shown obvious symptoms. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.
[0024] Figure 1 The cross-reaction screening results (AB) of the RPA primers and the specificity detection result (C) of the RPA-CRISPR / Cas12a detection method in Example 1 are shown;
[0025] Figure 2 Feasibility analysis results for RPA-CRISPR / Cas12a detection of Phytophthora infestans genomic DNA;
[0026] Figure 3 This is the sensitivity test result of RPA-CRISPR / Cas12a detection method for PiNW plasmid;
[0027] Figure 4This is the sensitivity test result of the RPA-CRISPR / Cas12a detection method for P. infestans genomic DNA;
[0028] Figure 5 The test results of the RPA-CRISPR / Cas12a detection method on real plant samples;
[0029] Figure 6 The experimental results of 7 experiments were implemented; among them, a is the actual picture of the leaves after inoculation with P. infestans and the healthy leaves, b is the RPA-CRISPR / Cas12a detection results at different inoculation days, and c is the detection sensitivity test results at different inoculation days;
[0030] Among them, ns means P>0.05, ** means P<0.01, *** means P<0.001, and **** means P<0.0001. DETAILED DESCRIPTION
[0031] The present invention provides a rapid detection kit for Phytophthora infestans, comprising: a recombinase polymerase amplification reagent and a CRISPR / Cas12a reaction reagent; the recombinase polymerase amplification reagent comprises an RPA primer; the CRISPR / Cas12a reaction reagent comprises: crRNA and a fluorescent reporter molecule; the RPA primers comprise RPA-F3 and RPA-R1; the nucleotide sequences of RPA-F3 and RPA-R1 are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively; the nucleotide sequence of the crRNA is shown in SEQ ID NO.8; the fluorescent reporter molecule is ssDNA modified with a fluorescent group and a quenching group; the nucleotide sequence of the ssDNA is: 5'-TTATTATT-3'.
[0032] In one embodiment, the fluorescent group includes FAM, HEX, or europium chelate fluorescein; the quencher group includes BHQ1 or Cy5. In one embodiment, the ssDNA is modified with a fluorescent group at its 5' end and a quencher at its 3' end. In another embodiment, the ssDNA is modified with a fluorescent group FAM at its 5' end and a quencher BHQ1 at its 3' end.
[0033] As an embodiment, the recombinase polymerase amplification reagent further includes: primer-free rehydration buffer and magnesium acetate; the CRISPR / Cas12a reaction reagent further includes: Reaction Buffer and LbCas12a.
[0034] The kit provided by the present invention is a kit based on recombinase polymerase amplification (RPA) and CRISPR / Cas12a reaction design. According to the PiNW gene of Phytophthora infestans, RPA primers for specific amplification and crRNA for specific recognition of RPA amplification products are designed. Phytophthora infestans can be specifically and quickly detected by utilizing the bispecificity of primers and crRNA. The specific principle is: when the RPA amplification product after RPA amplification has a recognition site matching crRNA, the Cas12a / crRNA complex recognizes and binds to the target DNA fragment, and this binding process immediately activates the trans-cleavage function of Cas12a, so that it indiscriminately cuts the surrounding single-stranded DNA (ssDNA). In order to achieve sensitive detection of trans-cleavage, the two ends of the single-stranded DNA of the present invention are respectively modified with a fluorescent group and a quencher group. After Cas12a performs cutting, the fluorescent group is released from the adjacent position of the quencher group, thereby destroying the quenching effect of the quencher group, resulting in a significant enhancement of the fluorescence signal in the detection system. By monitoring the intensity change of this fluorescent signal, it is possible to accurately judge whether there is a specific target DNA and its corresponding pathogenic microorganism. Furthermore, RPA has a reaction temperature of approximately 37°C, eliminating the need for complex temperature control equipment and allowing reactions to proceed at room temperature. Simple insulation measures are sufficient, making it suitable for use in field environments or at grassroots testing facilities, particularly where specialized equipment and rigorous experimental conditions are lacking. The kit provided by the present invention possesses high sensitivity and specificity, enabling early detection and diagnosis of Phytophthora diseases. It can also sensitively detect the presence of the pathogenic Phytophthora fungus in plants during the early stages of infection, during the invasive and latent phases, before obvious symptoms appear.
[0035] Based on the above advantages, the present invention provides the use of the kit described in the above technical solution in detecting plant diseases caused by Phytophthora infestans.
[0036] As an embodiment, the plant diseases include potato late blight and / or tomato late blight.
[0037] The present invention provides a method for detecting Phytophthora infestans for non-diagnostic purposes using the kit described in the above technical solution, comprising the following steps:
[0038] Using the genomic DNA of the sample to be tested as a template, RPA reaction is performed using RPA primers to obtain RPA amplification products;
[0039] Mixing the RPA amplification product with the CRISPR / Cas12a reaction reagent to obtain a reaction solution to be tested;
[0040] Mix ddH2O with CRISPR / Cas12a reaction reagent to obtain a negative control reaction solution;
[0041] The test reaction solution and the negative control reaction solution were subjected to CRISPR / Cas12a reaction respectively, and the fluorescence intensity of the test reaction solution and the negative control reaction solution was detected; the average value of the fluorescence intensity of the negative control reaction solution + 3 times the standard deviation was set as the threshold;
[0042] If the fluorescence intensity of the reaction solution to be tested is greater than the threshold value, the sample to be tested contains Phytophthora infestans or is infected with Phytophthora infestans.
[0043] As an embodiment, the reaction system of the RPA reaction includes: 2.4 μL of RPA-F3 with a concentration of 10 μM, 2.4 μL of RPA-R1 with a concentration of 10 μM, 2 μL of genomic DNA, 29.5 μL of primer-free rehydration buffer, 2.5 μL of magnesium acetate with a concentration of 280 mM, and 11.2 μL of ddH2O; the temperature of the RPA reaction is 37°C and the time is 60 minutes.
[0044] As an embodiment, the reaction solution includes: 5 μL of 10×Reaction Buffer, 2.5 μL of LbCas12a with a concentration of 2 μM, 2.5 μL of crRNA with a concentration of 2 μM, 5 μL of fluorescent reporter molecule with a concentration of 2 μM, 2 μL of RPA amplification product and 33 μL of ddH2O; the temperature of the CRISPR / Cas12a reaction is 37 ° C, and the time is 15 minutes.
[0045] As an embodiment, the sample to be tested includes plant leaves; the plants include potatoes and / or tomatoes.
[0046] To further illustrate the present invention, a rapid detection kit for Phytophthora infestans and its application provided by the present invention are described in detail below with reference to the examples and drawings, but they should not be construed as limiting the scope of protection of the present invention.
[0047] Preparation Example
[0048] The pathogens used in this invention are Phytophthora infestans, Phytophthora sojae, and Phytophthora capsici, all provided by the Laboratory of Plant Pathogens and Fungicide Interactions at China Agricultural University. These are published in the following documents: [Wang Hao. Research on CRISPR / Cas Technology in Phytophthora infestans [D]. Beijing. China Agricultural University, 2019] and [Zhang Can. Functional Study of Chitin Synthase Genes in Phytophthora capsici and Phytophthora sojae [D]. Beijing. China Agricultural University, 2017].
[0049] Culture medium used for pathogens: V8 juice medium.
[0050] Pathogen Culture Conditions: Inoculate a pathogen cake into the center of a blank V8 juice medium and place the medium upside down in an incubator. Incubate P. infestans in the dark at 18°C for 7-10 days, P. capsici in the dark at 25°C for 3 days, and P. sojae in the dark at 25°C for 5 days.
[0051] Example 1 Design and synthesis of RPA primers
[0052] In the present invention, the well-conserved PiNW gene of Phytophthora infestans was selected to design three forward primers and four reverse primers. The primer sequences are shown in Table 1.
[0053] Table 1 Different RPA primer sequences
[0054] Primer name Primer sequence (5'-3') SEQ ID NO. RPA-F1 AACTAACGGTTCTCCTACTTCAACAGTGGG 1 RPA-F2 CTAACGGTTCTCCTACTTCAACAGTGGGAC 2 RPA-F3 GATACTATTGCAGGCTGGATACTGTAGATG 3 RPA-R1 TTTCTGAGCGTAGGCACTTTATTTGTCTTC 4 RPA-R2 CTGTAGGTCCATTCCGTAGACAAGACGAGC 5 RPA-R3 TCTGTAGGTCCATTCCGTAGACAAGACGAG 6 RPA-R4 TTTCTGTAGGTCCATTCCGTAGACAAGACG 7
[0055] The Ezup column-based fungal genomic DNA extraction kit was used to extract the genomic DNA of Phytophthora infestans. The extracted genomic DNA was used as a template for RPA isothermal nucleic acid amplification. The reaction system was as follows:
[0056] Reference The Basic kit instructions configure the following RPA reaction system: 2.4 μL of 10 μM forward primer, 2.4 μL of 10 μM reverse primer, 2 μL of genomic DNA, 29.5 μL of primer-free rehydration buffer, 2.5 μL of 280 mM magnesium acetate (MgAOc), and 11.2 μL of ddH2O.
[0057] Mix all the above components except MgAOc and add them to a single reaction tube containing lyophilized microspheres. Vortex to mix thoroughly. Add MgAOc to the cap of the reaction tube and briefly centrifuge to mix it with the remaining components. Incubate the reaction tube at 37°C for 15 minutes to obtain the RPA amplification product.
[0058] In order to ensure that the RPA-CRISPR / Cas12a detection method has the best detection sensitivity, the present invention performs cross-reaction screening of RPA primers according to the above-mentioned RPA reaction system. The RPA amplification products are electrophoresed on a 2% agarose gel. Figure 1 A and B, where F1+R1 is the abbreviation for the primer pair consisting of RPA-F1 and RPA-R1 in Table 1, and the same applies to other abbreviations. The results showed that amplification products of these primers could be observed, and the primer combination with the most obvious target band and the highest amplification efficiency was RPA-F3 and RPA-R1. RPA-F3 and RPA-R1 were used in subsequent experiments.
[0059] Example 2 A system for detecting Phytophthora infestans based on RPA-CRISPR / Cas12a
[0060] crRNA was synthesized by Sangon Biotech (Shanghai) Co., Ltd. and diluted to 2 μM with ddH2O before use. The crRNA sequence is shown in SEQ ID NO.8, as follows:
[0061] 5'-UAAUUUCUACUAAGUGUAGAU AAGCGAUCGUUCAAAAUUUUACC -3', where the underlined sequence is the leader sequence.
[0062] Configure the CRISPR / Cas12a detection reaction system as follows:
[0063] 10×Reaction Buffer 5μL, 2.5μL LbCas12a at a concentration of 2μM, 2.5μL crRNA at a concentration of 2μM, 5μL ssDNA at a concentration of 2μM, RPA amplification product 2μL and ddH2O 33μL. The nucleotide sequence of the ssDNA is: 5'-TTATTATT-3', the 5' end of the ssDNA is modified with a FAM group, and the 3' end is modified with a BHQ1 group. The RPA amplification product is the RPA amplification product obtained by amplification using RPA-F3 and RPA-R1 in Example 1.
[0064] The conditions for the CRISPR / Cas12a detection reaction were as follows: incubation at 37°C for 60 minutes, and the changes in fluorescence intensity during the reaction were recorded using a qPCR instrument.
[0065] Example 3 Feasibility Analysis of RPA-CRISPR / Cas12a Detection Method
[0066] Fresh Phytophthora infestans cells were cultured and tested according to the method of Example 2, with ddH2O as a negative control. The test results were as follows: Figure 2 shown.
[0067] The results showed that when genomic DNA of Phytophthora infestans was added to the detection system, the reaction system produced a strong fluorescence signal, while the fluorescence signal of the negative sample without adding genomic DNA of Phytophthora infestans and using ddH2O as the reaction substrate did not increase significantly, indicating that the detection method is feasible and can detect the presence or absence of Phytophthora infestans.
[0068] Example 4 Specificity detection of RPA-CRISPR / Cas12a detection method
[0069] Three common phytophthora fungi, Phytophthora infestans, Phytophthora sojae, and Phytophthora capsici, were cultured and tested according to the method described in Example 2. ddH2O was also used as a negative control (denoted as NTC). Figure 1 Middle C.
[0070] The results showed that the method provided by the present invention could only detect Phytophthora infestans but could not detect the other two Phytophthora species, indicating that the method of the present invention has good specificity and conservatism.
[0071] Example 5 Sensitivity test of RPA-CRISPR / Cas12a detection method
[0072] Sensitivity testing was performed using the PiNW gene plasmid and P. infestans genomic DNA, respectively, as follows:
[0073] The PiNW gene plasmid was synthesized by Sangon Biotech (Shanghai) Co., Ltd., including the following: Reference Xue Tang et al. (2023) [Tang, X., Li, H., Huang, W., Wang, L., Zhao, Y., Wang, J., Shao, H., Tao, X., Yong, B., 2023. Development of a new PCR assay and arecombinase-aided amplification based isothermal amplification coupled with lateral flow dipstick assay for potato late blight detection. Crop Protection 168,106235. https: / / doi.org / 10.1016 / j.cropro.2023.106235], a 1050 bp fragment located at 351–1400 on NW_003302563.1 was selected as the species-specific genomic sequence of P. infestans, and this gene sequence was cloned into the pUC57 plasmid (Sangon Biotech, Shanghai, China) to obtain the reference plasmid PiNW.
[0074] The PiNW gene plasmid was dissolved and diluted with ddH2O to obtain a concentration of 10 7 fg / μL (denoted as 10 7 , the same below), 10 6 fg / μL, 105 fg / μL, 10 4 fg / μL, 10 3 fg / μL, 10 2 fg / μL, 10 1 fg / μL solution was tested according to the method provided in Example 2, and ddH2O was set up as a negative control (denoted as NTC). The test results are as follows Figure 3 As shown in the figure, it can be seen that the detection limit of the method provided by the present invention for PiNW gene plasmid is 10 2 fg / μL, with strong sensitivity.
[0075] To determine the sensitivity of RPA-CRISPR / Cas12a against P. infestans gDNA, sterile water was used to dilute P. infestans gDNA solution (20 μg / μL) to obtain a concentration of 10 8 fg / μL, 10 7 fg / μL, 10 6 fg / μL, 10 5 fg / μL, 10 4 fg / μL, 10 3 fg / μL, 10 2 fg / μL solution, and ddH2O was set up as a negative control, and the test was carried out according to the method provided in Example 2. The test results are as follows Figure 4 As shown in the figure, it can be seen that the detection limit of the method provided by the present invention for Phytophthora infestans gDNA is 10 3 fg / μL.
[0076] Example 6: Application of RPA-CRISPR / Cas12a Detection Method to Real Plant Samples
[0077] Prepare spore suspension using cultured Phytophthora infestans and dilute the spore concentration to 10 using sterile water. 4 Select three healthy, uniform potato leaves and spray each with 500 μL of a spore suspension of Phytophthora infestans. Incubate the inoculated leaves at 20°C with 16 hours of light and 8 hours of darkness for 6 days, until distinct late blight lesions appear.
[0078] The leaf spots were cut off and the leaf DNA was extracted using the CTAB method. The leaves of healthy plants that were not inoculated were selected as controls and tested according to the method provided in Example 2. The test results are shown in Figure 2. Figure 5 As shown, it can be seen that the method provided by the present invention can successfully detect the DNA of Phytophthora infestans in infected plants.
[0079] Example 7
[0080] Select healthy potato leaves of uniform size. Wash the dust off the leaf surface with tap water. Then rinse the leaf surface with 75% (v / v) alcohol for 2 seconds to disinfect the leaf surface. Rinse the leaf with sterile water three times. Place filter paper soaked in sterile water in a Petri dish. Place the potato leaf with the back facing up on the filter paper. Spray 500 μL of 4×10 4 / mL of spore suspension of Phytophthora infestans (P. infestans), place the culture dish in the dark at 18℃ and culture for 24h. The next day, wipe off the bacterial liquid droplets at the inoculation site, then turn the potato leaves over so that the front side is facing up, and transfer them to 22℃, 16 hours of light and 8 hours of darkness for culture. A total of 20 leaves were inoculated (marked as Inoculated), and 5 uninoculated healthy leaves (marked as Healthy) were set as controls. Within 1 to 5 days after infection (marked as Day1 to Day5), at the same time every day, select 2 different positions on each of the 4 infected leaves and 1 healthy leaf, and cut 1cm 2 The leaf tissue was extracted using the CTAB method to extract DNA from the corresponding position.
[0081] Figure 6 Figure a shows the growth status of healthy leaves and infected leaves at different inoculation times. Within 5 days after inoculation, the growth status of healthy leaves did not change significantly, but late blight lesions began to appear on the inoculated leaves on the 4th day. On the 5th day, the lesions continued to expand and the lesions were obvious. The RPA-CRISPR / Cas12a method provided in Example 2 was used to detect the extracted leaf DNA. The end point fluorescence value was as follows: Figure 6 As shown in b. For the experimental sample group, as the inoculation time increases, the fluorescence intensity gradually increases, indicating that the P. infestans content in the leaves gradually increases. In order to distinguish between positive samples and negative samples during the detection process, this embodiment sets a threshold (Threshold), and samples exceeding the threshold are considered positive, otherwise they are negative. The principle of setting the threshold is to minimize the occurrence of false negative and false positive test results, which is very important for obtaining accurate test results. The threshold is calculated as follows: the mean of the fluorescence intensity of the negative sample plus 3 times the standard deviation (Mean+3×SD). This standard is based on the normal distribution assumption and can cover 99.7% of the negative data, with a false positive rate of less than 0.15%. In this embodiment, the negative sample with ddH2O as the reaction substrate was repeatedly tested 30 times. The fluorescence intensity mean corresponding to the negative sample was Mean=720444.91, and the standard deviation SD=79298.87, so the threshold was 958341.52. By Figure 6As shown in Figure b, on the second day after inoculation, the fluorescence intensity values of 3 samples in the 8 samples of the experimental group exceeded the threshold; on the third day, the fluorescence intensity values of 6 samples exceeded the threshold; on the fourth day, the fluorescence intensity values of all samples exceeded the threshold, indicating that late blight can be detected. This example defines the detection rate as true positive / total positive, which is Figure 6 As shown in Figure c, the detection rate reached 100% on the 4th day after inoculation, and the symptoms on the leaves were still not obvious ( Figure 6 In summary, the RPA-CRISPR / Cas12a method provided by the present invention can detect potato late blight in the early stage of infection with high sensitivity.
[0082] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. A rapid detection kit for Phytophthora infestans, characterized in that: include: Recombinase polymerase amplification reagents and CRISPR / Cas12a reaction reagents; The recombinase polymerase amplification reagent includes RPA primers; The CRISPR / Cas12a reaction reagent includes: crRNA and a fluorescent reporter molecule; the RPA primer includes RPA-F3 and RPA-R1; the nucleotide sequences of RPA-F3 and RPA-R1 are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively; the nucleotide sequence of the crRNA is shown in SEQ ID NO.8; the fluorescent reporter molecule is ssDNA modified with a fluorescent group and a quenching group; the nucleotide sequence of the ssDNA is: 5'-TTATTATT-3'.
2. The kit according to claim 1, wherein The fluorescent group includes: FAM, HEX or europium chelate fluorescein; the quenching group includes: BHQ1 or Cy5.
3. The kit according to claim 1 or 2, characterized in that The 5' end of the ssDNA is modified with a fluorescent group, and the 3' end is modified with a quenching group.
4. The kit according to claim 1, wherein The recombinase polymerase amplification reagent also includes: primer-free rehydration buffer and magnesium acetate; the CRISPR / Cas12a reaction reagent also includes: Reaction Buffer and LbCas12a.
5. Use of the kit according to any one of claims 1 to 4 in detecting plant diseases caused by Phytophthora infestans.
6. The use according to claim 5, characterized in that The plant diseases include potato late blight and / or tomato late blight.
7. A method for detecting Phytophthora infestans for non-diagnostic purposes using the kit according to any one of claims 1 to 4, characterized in that: The following steps are involved: Using the genomic DNA of the sample to be tested as a template, RPA reaction is performed using RPA primers to obtain RPA amplification products; Mixing the RPA amplification product with the CRISPR / Cas12a reaction reagent to obtain a reaction solution to be tested; Mix ddH2O with CRISPR / Cas12a reaction reagent to obtain a negative control reaction solution; The test reaction solution and the negative control reaction solution were subjected to CRISPR / Cas12a reaction respectively, and the fluorescence intensity of the test reaction solution and the negative control reaction solution was detected; the average value of the fluorescence intensity of the negative control reaction solution + 3 times the standard deviation was set as the threshold; If the fluorescence intensity of the reaction solution to be tested is greater than the threshold value, the sample to be tested contains Phytophthora infestans or is infected with Phytophthora infestans.
8. The method according to claim 7, characterized in that The reaction system of the RPA reaction includes: 2.4 μL of RPA-F3 with a concentration of 10 μM, 2.4 μL of RPA-R1 with a concentration of 10 μM, 2 μL of genomic DNA, 29.5 μL of primer-free rehydration buffer, 2.5 μL of magnesium acetate with a concentration of 280 mM and 11.2 μL of ddH2O; the temperature of the RPA reaction is 37°C and the reaction time is 60 minutes.
9. The method according to claim 7, characterized in that The reaction solution includes: 5 μL of 10× Reaction Buffer, 2.5 μL of LbCas12a with a concentration of 2 μM, 2.5 μL of crRNA with a concentration of 2 μM, 5 μL of fluorescent reporter molecule with a concentration of 2 μM, 2 μL of RPA amplification product and 33 μL of ddH2O; the temperature of the CRISPR / Cas12a reaction is 37°C and the reaction time is 15 minutes.
10. The method according to claim 7, characterized in that The sample to be tested includes plant leaves; the plants include potatoes and / or tomatoes.