Chuzhou chrysanthemum extract and application of Chuzhou chrysanthemum extract in preparation of skin care products

Abstract

The invention relates to a Chuzhou chrysanthemum extract and application thereof in skin care products, and relates to the field of natural product chemistry, the Chuzhou chrysanthemum extract is prepared by using dry Chuzhou chrysanthemum flowers as raw materials, performing ultrasonic extraction by using an extraction solvent, then performing filtration and taking filtrate; wherein the extraction solvent is preferably ultrapure water. According to the method, ultrapure water is adopted as an extraction solvent for ultrasonic extraction of the dried Chuzhou chrysanthemum flowers, the extraction method has the advantages of being simple, efficient, convenient, free of toxic and harmful organic solvents and the like, production practice is easier to popularize and apply, and the Chuzhou chrysanthemum water extract obtained through the extraction method has good oxidation resistance and is suitable for industrial production. And the skin care product can be used for preparing the skin care product with the health-care effects of resisting oxidation, repairing the barrier and the like. The method provides a certain research basis for efficiently and systematically expanding the application field of the Chuzhou chrysanthemum and better evaluating the application of the Chuzhou chrysanthemum in the skin care product industry.

Description

Technical Field

[0001] The present invention belongs to the field of natural product chemistry, and particularly relates to a chrysanthemum extract and application thereof in skin care products. Background Art

[0002] Chuju, also known as "white chrysanthemum" or "sweet chamomile," is a chrysanthemum with the most tightly packed petals. It is also one of China's four famous chrysanthemums (Huangshan Gongju, Boju, Hangju, and Chuju). Its unique medicinal and health benefits have made it highly sought after. Its golden stamens and crystal-white petals have earned it the nickname "Golden Heart with Five Petals." Chuju is often consumed as a tea, but its use in skincare products has been less well-received. Chamomile and calendula, both members of the Asteraceae family, have found use in skincare products.

[0003] Keratinocytes, a crucial component of the skin barrier, have a proliferation capacity directly linked to skin health and repair effectiveness after damage. Barrier-repair skincare products on the market primarily utilize hormones and plant extracts to repair the skin. However, the overuse of hormones can easily lead to side effects, while natural plant extracts offer minimal side effects and are currently a research hotspot for skin barrier repair products.

[0004] Chuju contains nutrients such as flavonoids, volatile oils, amino acids, and trace elements. Its selenium content is 8 to 40 times higher than that of other chrysanthemums. Selenium has various benefits, including anti-cancer, anti-aging, immune enhancement, and antagonism against harmful heavy metals. Currently, there are no reports on the effectiveness of Chuju in promoting skin barrier repair. Therefore, we propose a Chuju extract and its application in skincare products. Summary of the Invention

[0005] The purpose of the present invention is to provide a Chuju extract and its application in skin care products in order to solve the above problems.

[0006] The present invention achieves the above-mentioned purpose through the following technical solutions: As a first aspect of the present invention, a chrysanthemum extract is provided, wherein the chrysanthemum extract is prepared by using dried chrysanthemum flowers as raw materials, performing ultrasonic extraction using an extraction solvent, and then filtering to obtain a filtrate; The extraction solvent is ultrapure water, anhydrous ethanol or petroleum ether with a boiling range of 30-60°C or 60-90°C.

[0007] As a further optimized solution of the present invention, the extraction solvent is ultrapure water.

[0008] As a further optimization scheme of the present invention, the ratio between the dried Chuju flowers and the extraction solvent is 10 ml of extraction solvent for every 0.5 g of dried Chuju flowers.

[0009] As a second aspect of the present invention, there is also provided a use of any of the above-mentioned Chuju extracts in the preparation of skin care products with antioxidant efficacy.

[0010] As a third aspect of the present invention, there is also provided a use of any of the above-mentioned Chuju extracts in the preparation of skin barrier repair skin care products.

[0011] As a further optimization scheme of the present invention, the Chuju extract promotes keratinocyte proliferation and barrier factors TGM1 Genes and ABCA12 The expression of genes can achieve skin barrier repair.

[0012] As a further optimized solution of the present invention, the skin care product is a facial mask, essence water, lotion, cream, gel or spray.

[0013] The beneficial effects of the present invention are: The present invention uses ultrapure water as an extraction solvent to ultrasonically extract dried chrysanthemum flowers. This extraction method is simple, efficient, and convenient, and does not use toxic or hazardous organic solvents. This method is more easily applicable in production practice. Furthermore, the chrysanthemum water extract obtained using this extraction method has multiple biological benefits, including good antioxidant properties and skin barrier repair, and can be used to prepare skin care products with health benefits such as antioxidant and barrier repair. This invention provides a research basis for efficiently and systematically expanding the application field of chrysanthemum and better evaluating its application in the skin care industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a bar graph showing the results of a HaCaT cell proliferation experiment using the Chuju water extract provided by the present invention at an addition concentration of 0-20%; Figure 2 This is a bar graph showing the results of a HaCaT cell proliferation experiment using the anhydrous ethanol extract of Chuju provided by the present invention at an addition concentration of 0-20%; Figure 3 This is a bar graph showing the results of a HaCaT cell proliferation experiment using the Chuju petroleum ether (30-60°C) extract provided by the present invention at an addition concentration of 0-20%; Figure 4 This is a bar graph showing the results of a HaCaT cell proliferation experiment using the Chuju petroleum ether (60-90° C.) extract provided by the present invention at an addition concentration of 0-20%; Figure 5 This is a bar graph showing the results of a HaCaT cell proliferation experiment using the chamomile water extract provided by the present invention at an addition concentration of 0-20%; Figure 6 This is a bar graph showing the results of a HaCaT cell proliferation experiment using the Huangshan Gongju water extract provided by the present invention at an addition concentration of 0-20%; Figure 7 This is a bar graph showing the results of a HaCaT cell proliferation experiment using the chrysanthemum water extract provided by the present invention at an addition concentration of 0-20%; Figure 8 This is a bar graph showing the experimental results of the snow chrysanthemum water extract provided by the present invention on HaCaT cell proliferation at an addition concentration of 0-20%; Figure 9 It is a line graph of the experimental results of HaCaT cell proliferation with different chrysanthemum extracts provided by the present invention at an addition concentration of 0-5%; Figure 10 The cell scratch photographing results provided by the present invention; Figure 11 These are the barrier factor and differentiation factor detection results provided by the present invention. DETAILED DESCRIPTION

[0015] The present application is described in further detail below in conjunction with the accompanying drawings. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0016] 1. Materials and Methods Unless otherwise specified, the methods used in the present invention are conventional methods known to those skilled in the art. If specific conditions are not specified, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased commercially.

[0017] 1. Preparation of Chrysanthemum Extract 1.1 Extraction of dried Chuju flowers using different extraction solvents (1) Water extraction method Accurately weigh 0.5 g of fine powder of dried chrysanthemum flowers, add 10 ml of ultrapure water, place in an ultrasonic instrument, sonicate at room temperature for 30 min, and filter to obtain the chrysanthemum water extract.

[0018] (2) Alcohol extraction method Accurately weigh 0.5 g of fine powder of dried flowers of Chuju, add 10 ml of anhydrous ethanol, place in an ultrasonic instrument, sonicate at room temperature for 30 min, filter, and concentrate the filtrate at low temperature to obtain a dry paste, add DMSO to dissolve to the original volume, and obtain the anhydrous ethanol extract of Chuju.

[0019] (3) Petroleum ether extraction method Accurately weigh two portions of 0.5 g of Chuju dried flower powder, add petroleum ether (30-60 ℃) extract to one portion, and add petroleum ether (60-90 ℃) extract to the other portion. Place the mixture in an ultrasonicator and sonicate at room temperature for 30 min. Filter and concentrate the filtrate at low temperature to obtain a dry paste. Add DMSO to dissolve it to the original volume to obtain the Chuju petroleum ether (30-60 ℃) extract and the Chuju petroleum ether (60-90 ℃) extract.

[0020] 1.2. Extraction of different varieties of chrysanthemum by water extraction Accurately weigh 0.5 g each of the dried flower powders of chamomile, Huangshan tribute chrysanthemum, Hangbai chrysanthemum, and snow chrysanthemum, add 10 ml of ultrapure water, place in an ultrasonic instrument, sonicate at room temperature for 30 min, and filter to obtain the aqueous extracts of chamomile, Huangshan tribute chrysanthemum, Hangbai chrysanthemum, and snow chrysanthemum.

[0021] 2. Efficacy verification test 2.1 Antioxidant performance test The antioxidant properties of each chrysanthemum extract were evaluated by DPPH method and ABTS method respectively.

[0022] 2.1.1. DPPH free radical scavenging rate determination DPPH ethanol solution is purple-red with a maximum absorption wavelength at 519 nm. When a free radical scavenger is added, DPPH radicals are scavenged, the solution gradually becomes lighter, and the absorbance at 519 nm decreases. The lighter the solution color, the lower its absorbance, and the more effective the free radical scavenger is in scavenging DPPH radicals.

[0023] The specific method is as follows: use a 96-well plate to set up experimental wells (T), experimental control wells (T0), DPPH model wells (C) and model control wells (C0). For each test concentration of each sample, three parallel wells need to be set up for the experimental well (T), and three parallel wells need to be set up for the DPPH model well (C); add 100 μl of sample solution of the same concentration to the experimental well (T) and the experimental control well (T0), and add 100 μl of sample solvent to the DPPH model well (C) and the model control well (C0); add 100 μl of DPPH working solution (0.5 mmol / L) to the experimental well (T) and the DPPH model well (C), and replace it with 100 μl of anhydrous ethanol to the experimental control well (T0) and the model control well (C0); After incubating the plate at room temperature in the dark for 30 minutes, measure absorbance at 519 nm. Calculate the DPPH free radical scavenging rate of the test substance at different test concentrations. Then, plot concentration-DPPH scavenging rate curves for the different test substances and calculate the IC50 values for each test substance.

[0024] The DPPH free radical scavenging rate was calculated according to the following formula: ; Where: A 模 —DPPH model well absorbance value; A 模对 —Absorbance value of model control well; A 样 —Absorbance value of experimental well; A 样对 -Absorbance value of experimental control wells.

[0025] 2.1.2. ABTS free radical scavenging rate determination ABTS reacts with potassium persulfate to produce green ABTS + Substances with antioxidant properties can scavenge ABTS + ABTS + The maximum absorption is at 734 nm. The absorbance is measured and the free radical scavenging ability of the reactant can be quantitatively determined by the absorbance value. That is, the lower the absorbance value, the stronger the antioxidant's ability to scavenge ABTS free radicals.

[0026] The specific method is as follows: a 96-well plate is used to set up experimental wells (T), experimental control wells (T0), ABTS model wells (C), and model control wells (C0). Three parallel wells are required for each experimental well (T) of each sample and each tested concentration, and three parallel wells are required for the ABTS model well (C). 50 μl of sample solution of the same concentration is added to each experimental well (T) and experimental control well (T0), and 50 μl of sample solvent is added to each ABTS model well (C) and model control well (C0). 150 μl of ABTS working solution (7.4 mmol / L ABTS solution and 2.6 mmol / L K2S2O8 solution mixed in a ratio of 1:1, left for 12 hours, and then diluted 20-fold) is added to each experimental well (T) and ABTS model well (C). 150 μl of ultrapure water is added to the experimental control well (T0) and model control well (C0). The 96-well plate is kept at room temperature for 6 minutes, and the absorbance is measured at 734 nm. Calculate the ABTS free radical scavenging rate of the test substance at different test concentrations. Then, draw the concentration-ABTS scavenging rate curve of different test substances and calculate the IC50 value of different test substances.

[0027] The ABTS free radical scavenging rate was calculated according to the following formula: ; Where: A 模 —ABTS model well absorbance value; A 模对 —Absorbance value of model control well; A 样 —Absorbance value of experimental well; A 样对 -Absorbance value of experimental control wells.

[0028] The results are shown in Table 1.

[0029] Table 1 Antioxidant performance test results ; IC50 refers to the concentration of the test substance at which 50% clearance occurs. The lower the IC50, the lower the concentration required to achieve 50% clearance, and the better the antioxidant effect. As shown in Table 1, snow chrysanthemum has the best antioxidant properties, followed by Chuju water extract.

[0030] 2.2 Barrier repair test This study aimed to investigate the effects of different chrysanthemum extracts on keratinocyte proliferation and to provide experimental basis for skin regeneration, wound healing, and the treatment of related skin diseases. The cell line used was a human immortalized keratinocyte line, HaCaT cells (purchased from Nanjing Kebai Biotechnology Co., Ltd.).

[0031] 2.2.1 Cell recovery and culture Remove the frozen keratinocyte HaCaT cells from liquid nitrogen, quickly thaw them in a 37°C water bath, and then transfer them to a centrifuge tube containing preheated DMEM high-glucose medium (Cat. No.: C3113-0500, Brand: VC). After centrifugation, discard the supernatant, resuspend the cells in fresh DMEM high-glucose medium, inoculate them into a culture dish, and culture them in an incubator until the cells reach the logarithmic phase.

[0032] 2.2.2 Cell passaging and plating The cells in the logarithmic growth phase were passaged and the cell density was adjusted to 1×10 5 After 100 cells / ml, they were seeded into 96-well plates and an appropriate amount of culture medium was added to each well to ensure that the cells were evenly distributed. The cells were cultured until they adhered to the wall and reached the initial density required for the experiment.

[0033] 2.2.3 Chrysanthemum extract intervention After cells adhered and stabilized, the original culture medium was aspirated and replaced with culture medium containing different chrysanthemum extracts. The concentrations of the same chrysanthemum extract were set at 0.1%, 0.2%, 0.3%, 0.6%, 1.3%, 2.5%, 5%, 10%, and 20%. A control group (culture medium only, without chrysanthemum extract) was also established. Multiple replicates were performed for each group to ensure the reliability of the results.

[0034] 2.2.4. Proliferation capacity detection Cell proliferation was assessed using the MTT assay. This assay measures cell proliferation by measuring the amount of MTT converted to formazan crystals by succinate dehydrogenase in living cells. Data were analyzed using statistical software such as Excel or SPSS, and statistical indicators such as mean and standard deviation were calculated.

[0035] The results are as follows Figure 1-9 As shown, Figure 1-8The effects of different chrysanthemum extracts on HaCaT cell proliferation at different addition concentrations are given. It can be seen from the figure that for Chuju, its water extract is beneficial to HaCaT cell proliferation at a wider addition concentration compared with other solvent extracts.

[0036] Figure 9 The effects of different chrysanthemum extracts at a concentration of 0-5% on the proliferation of HaCaT cells are given. It can be seen from the figure that the chrysanthemum water extract at a concentration range of 0-5% is more conducive to the proliferation of HaCaT cells than other groups.

[0037] 2.3 Scratch test 2.3.1 Test methods (1) Cell culture: HaCaT cells in the logarithmic growth phase were digested and cultured at a rate of 1×10 cells per well. 4 cells were added to a 12-well plate; (2) Streaking: When the cell confluence reaches 100%, use a 1 ml sterile pipette tip to streak the cells and wash the floating cell debris with an appropriate amount of PBS; (3) Sample addition: Blank DMEM medium and 1% chrysanthemum extract prepared with DMEM were added to each well; (4) Photographing: Take photos of the cell scratch area at 0, 6, 10 and 24 hours after sample addition ( Figure 10 ).

[0038] (5) Scratch area analysis: Use relevant graphics software (such as Image J) to calculate the scratch area.

[0039] (6) Calculation of migration rate: Cell migration rate (wound healing rate) = (initial scratch area - scratch area at time t) / initial scratch area.

[0040] 2.3.2 Test results and analysis The results are shown in Table 2.

[0041] Table 2 Scratch test results ; As can be seen from Table 2, for Chuju, the cells treated with water extract showed a good migration effect compared with cells treated with other solvent extracts, indicating that the Chuju water extract has the effect of promoting cell repair.

[0042] In addition, combined Figure 10It can be seen that for different types of chrysanthemum water extracts, the cell migration rate of chamomile water extract and chrysanthemum water extract is slightly better than that of Chuju water extract at 6 hours, but after 10 hours and 24 hours, the cell migration rate of Chuju water extract is higher, and the difference is more significant. It can be seen that Chuju water extract has a better effect in promoting cell repair than other types of chrysanthemum water extracts.

[0043] 2.4. Detection of barrier factors and differentiation factors 2.4.1 Cell recovery and culture Remove the frozen keratinocyte HaCaT cells from liquid nitrogen, quickly thaw them in a 37°C water bath, and then transfer them to a centrifuge tube containing preheated culture medium. After centrifugation, discard the supernatant, resuspend the cells in fresh culture medium, inoculate them into a culture dish, and culture them in an incubator until the cells reach the logarithmic phase.

[0044] 2.4.2 Cell passaging and plating The cells in the logarithmic growth phase were passaged and the cell density was adjusted to 3×10 5 After 100 cells / ml, they were inoculated into 6-well plates, 1 ml per well, and appropriate amount of culture medium was added to ensure uniform distribution of cells. The culture was continued until the cells were stably attached to the wall.

[0045] 2.4.3 Chrysanthemum Extract Intervention After the cells have attached and stabilized, remove the original culture medium and add culture medium containing different chrysanthemum extracts prepared in step 1 at a 100-fold dilution. Simultaneously, set up a control group (culture medium only, without chrysanthemum extract) and continue culturing for 24 hours. Set up multiple replicates for each group to ensure the reliability of the results.

[0046] 2.4.4. Detection of barrier factors and differentiation factors Remove the cell culture plate, discard the culture medium, and add the RZ lysis buffer of the total RNA extraction kit (brand: TIANGEN, product number: DP419) directly to the culture dish. Extract RNA according to the kit instructions and measure the RNA concentration using a micro-UV spectrophotometer. When the RNA quality is good, proceed to the next step.

[0047] Reverse transcription was performed in an RNase-free PCR tube according to the instructions for the Starscript II Reverse Transcription Kit (Genstar, Catalog No. A233-10). Primers and template were added according to the instructions for the 2xSYBR Green Master Mix Kit (Bimake, Catalog No. B21203). The primer information is as follows: TGM1 The NCBI accession number of the gene is NM_000359.3; TGM1Upstream primer: 5′GGCAAGTTTCAGTTCACAGTCC 3′; TGM1 Downstream primer: 5′GGTCCCGTAGTAAATTCTCCC 3′; ABCA12 The NCBI accession number of the gene is NM_015657.4; ABCA12 Upstream primer: 5'TGGCTGTGCTGTCTAATCCTA 3', ABCA12 Downstream primer: 5′ACCCAAATCGCTCCTTCC 3′; GAPDH The NCBI accession number of the gene is NM_001357943.2; Internal Reference GAPDH Upstream primer: 5′-TGAAGGTCGGAGTCAACGG-3′; Internal Reference GAPDH Downstream primer: 5'-CCTGGAAGATGGTGATGGG-3'. For real-time fluorescence quantitative PCR, select a 20μl system and add 1μl of template, 1μl of upstream primer and 1μl of downstream primer, 10μl of 2xSYBR Green Master Mix, and 7μl of deionized water to each well of a 96-well plate to prepare a mixed solution. After applying a PCR transparent sealing film, centrifuge and place on a PCR instrument for amplification according to the table below. Use statistical software such as Excel or SPSS to organize the collected data and calculate 2 -△△ct The PCR reaction conditions are shown in Table 3.

[0048] Table 3 PCR reaction conditions ; Test results such as Figure 11 shown.

[0049] from Figure 11 It can be seen that, first of all, for Chuju, the extract obtained by water extraction can better promote the barrier factor compared with the extract obtained by other solvent extraction TGM1 gene expression, and targeting ABCA12 The expression of genes, Chuju water extract is not as good as other solvent extraction. Secondly, Chuju water extract is more able to promote barrier factors than other different types of chrysanthemum water extracts. TGM1 、 ABCA12 gene expression, TGM1、ABCA12Genes play an important role in skin health and are crucial for the repair of the skin barrier and the formation and maintenance of the skin's stratum corneum. Therefore, it can be seen that Chuju water extract has a good effect in promoting skin barrier repair.

[0050] 3. Conclusion The extraction method provided by the present invention is simple, efficient, and convenient, and it does not use toxic or hazardous organic solvents, making it easier to promote and apply in production practices. Furthermore, the Chuju extract obtained using this method has excellent antioxidant properties and multiple biological benefits, such as skin barrier repair, and can be used to prepare skin care products with health benefits such as antioxidant and barrier repair.

[0051] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. A Chuju extract, characterized in that The Chuju extract is prepared by using dried Chuju flowers as raw materials, performing ultrasonic extraction using an extraction solvent, and then filtering to obtain the filtrate; Wherein, the extraction solvent is ultrapure water, anhydrous ethanol or petroleum ether with a boiling range of 30-60°C or 60-90°C.

2. The Chuju extract according to claim 1, characterized in that: The extraction solvent is ultrapure water.

3. The Chuju extract according to claim 1, characterized in that: The ratio between the dried chrysanthemum flowers and the extraction solvent is 10 ml of the extraction solvent for every 0.5 g of dried chrysanthemum flowers.

4. Use of the Chuju extract according to any one of claims 1 to 3 in the preparation of skin care products with antioxidant efficacy.

5. The use according to claim 4, characterized in that The antioxidant effect is specifically manifested in the ability to scavenge DPPH free radicals and ABTS free radicals.

6. Use of the Chuju extract according to any one of claims 1 to 3 in preparing skin barrier repair skin care products.

7. The use according to claim 6, characterized in that The Chuju extract promotes keratinocyte proliferation and barrier factors TGM1 Genes and ABCA12 The expression of genes can achieve skin barrier repair.

8. The use according to any one of claims 4 to 7, characterized in that: The skin care product is a facial mask, essence water, lotion, cream, gel or spray.

Images