Application of Foxo1 in preparation of medicine for treating hepatic fibrosis

By regulating the Foxo1 signaling pathway in macrophages, using Foxo1 inhibitors or downregulators, the problem of unknown macrophage immune regulation mechanism in liver fibrosis is solved, and effective treatment of liver fibrosis is achieved.

CN120478635APending Publication Date: 2025-08-15TIANJIN FIRST CENT HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510321936.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-18
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

In the prior art, the mechanism of liver fibrosis has not been fully understood, especially the immune regulatory mechanisms in macrophages, resulting in the lack of effective antifibrotic therapy, and cirrhosis is considered an incurable disease.

Method used

By applying Foxo1 or its inhibitor, or its downregulator, modulate the Foxo1 signaling pathway in macrophages, inhibit M1 polarization and mitochondrial damage, and use small-molecule compounds or biological macromolecules to reduce the activity or expression of Foxo1, drugs for treating liver fibrosis are developed.

Benefits of technology

It reduces ROS production in macrophages, restores mitochondrial biogenesis, reduces inflammatory response, regulates mitochondrial function, and controls the progression of liver fibrosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120478635A_ABST
    Figure CN120478635A_ABST
Patent Text Reader

Abstract

The invention provides an application of Foxo1 in preparation of a medicine for treating hepatic fibrosis, a research result shows that the lack of Foxo1 in macrophages leads to reduction of ROS production, mitochondrial biogenesis recovery and inflammation alleviation, and from mechanism explanation, Nrf1 is directly combined with Foxo1 so as to inhibit the transcriptional activity of Foxo1. The downstream target gene KLF16 of the Foxo1 is regulated and controlled by an Nrf1-Foxo1 complex, and is of great importance to regulation of mitochondrial functions and immune response. According to the invention, the important role of the macrophage Nrf1-Foxo1 axis in controlling the mitochondrial function and the hepatic fibrosis progress is defined.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to the application of Foxo1 in preparing drugs for treating liver fibrosis. Background Art

[0002] Liver fibrosis is a common response to chronic liver damage caused by various etiologies, such as cholestasis, viral hepatitis, and fatty liver. This process leads to cirrhosis, the end stage of progressive fibrosis, characterized by a feathery distribution of fibrous structures and associated functional impairment and risk of organ failure. Cirrhosis is generally considered an incurable disease and is the 14th leading cause of death worldwide. Currently, no effective anti-fibrotic therapies other than liver transplantation have been approved. Therefore, further understanding of the precise mechanisms of liver fibrosis is urgently needed.

[0003] The mechanisms of liver fibrosis are a hotly debated topic. It is becoming increasingly clear that uncontrolled immune dysfunction is a key driver of liver fibrosis progression. During the development of liver fibrosis, damaged hepatocytes secrete danger-associated molecular patterns (DAMPs), which activate resident macrophages (Kupffer cells) and recruited monocyte-derived macrophages. These activated macrophages release a variety of cytokines that directly damage hepatocytes, enhance the activation of hepatic stellate cells (HSCs), and promote the accumulation of extracellular matrix (ECM). As one of the most frequently studied cell types in innate immunity, hepatic macrophages have emerged as a central player in the progression and regression of liver fibrosis. Activated macrophages exist in two main polarization states: the classical activated inflammatory phenotype (M1) and the alternative anti-inflammatory phenotype (M2). When the liver is damaged, stimuli such as a high-fat diet can fully polarize macrophages to the M1 phenotype, characterized by high expression of proinflammatory cytokines, which stimulates HSCs to release ECM, leading to progressively worsening fibrosis. Accumulating evidence suggests that the metabolic switch between glycolysis and mitochondrial oxidative phosphorylation plays a central role in macrophage polarization. M1 macrophages primarily rely on glycolysis, whereas M2 macrophages utilize the tricarboxylic acid cycle and oxidative phosphorylation. Therefore, factors affecting macrophage metabolism may perturb the M1 / M2 balance and exacerbate inflammation. However, how macrophages regulate liver metabolic, inflammatory, and fibrotic programs remains poorly understood.

[0004] The vertebrate genome encodes three nuclear factors, erythroid-derived nuclear factor-related protein 2 (Nrf1–3). Despite sharing similar DNA-binding patterns, Nrf1, Nrf2, and Nrf3 exhibit distinct biological functions and regulate partially overlapping sets of target genes. Nrf2, best known as the cap-basic region leucine zipper factor, is widely considered a master regulator of antioxidant responses in inflammatory diseases in humans and mice. Similar to Nrf2, Nrf1 binds to the ARE region and plays a central role in maintaining organ integrity. However, the regulatory mechanisms, target genes, and requirements for Nrf1 activation appear distinct from those of Nrf2. Nrf1 is primarily localized to the endoplasmic reticulum and, under pathological conditions, is activated by the DNA damage-inducible protein 1 homolog 2 (DDI2) proteasome. Activated Nrf1 translocates to the nucleus and initiates transcriptional programs. Accumulating evidence suggests that Nrf1 inactivation in hepatocytes leads to mitochondrial dysfunction and subsequent alcoholic steatohepatitis. Furthermore, Nrf1-deficient hepatocytes exhibit robust oxidative stress. Decreased expression of multiple ARE-containing genes leads to liver inflammation, fibrosis, and neoplastic growth.

[0005] The Foxo1 transcription factor plays multiple key roles in regulating innate immunity induced by oxidative stress. Earlier studies have shown that the myeloid Foxo1-β-catenin axis plays a central role in mediating liver inflammation and necroptosis induced by oxidative stress. The current study shows that the macrophage Foxo1 signaling pathway is crucial for controlling the innate immune response mediated by STING during the progression of MASH.

[0006] However, previous studies have primarily focused on the profibrotic function of Nrf1 in mesenchymal cells such as hepatocytes, while neglecting its role in inflammatory cells such as macrophages. Therefore, a deeper understanding of the immune regulatory mechanisms of macrophage Foxo1 may provide valuable insights into preventing and effectively reversing ongoing liver fibrosis. Summary of the Invention

[0007] In view of this, the present invention aims to propose the application of Foxo1 in the preparation of drugs for treating liver fibrosis, so as to gain a deeper understanding of the mechanism of action of Foxo1 in liver fibrosis.

[0008] To achieve the above object, the technical solution of the present invention is achieved as follows: The first aspect of the present invention provides the use of Foxo1 or its inhibitor, or its downregulator in the preparation of a drug for treating liver fibrosis.

[0009] The second aspect of the invention provides the use of Foxo1 or its inhibitor, or its downregulator in the preparation of a drug for inhibiting M1 polarization in fibrotic liver.

[0010] The third aspect of the invention provides the use of Foxo1 or its inhibitor, or its downregulator in the preparation of a drug for inhibiting mitochondrial damage in fibrotic liver.

[0011] Furthermore, the inhibitors described in the first aspect, the second aspect or the third aspect of the present invention are selected from small molecule compounds or biological macromolecules.

[0012] Furthermore, the liver fibrosis described in the first aspect of the present invention is liver fibrosis caused by cholestasis, viral hepatitis, and fatty liver.

[0013] In a fourth aspect, the present invention provides a pharmaceutical composition for treating liver fibrosis, comprising the Foxo1 inhibitor or Foxo1 downregulator according to the first, second or third aspect of the present invention and a pharmaceutically acceptable carrier.

[0014] Furthermore, the pharmaceutical composition is in the form of tablets, capsules, suspensions, syrups, granules, creams, pills, gels, patches, sprays, aerosols, oral solutions or injections.

[0015] A fifth aspect of the present invention provides the use of Foxo1 as a target in screening drugs for treating liver fibrosis.

[0016] Compared with the prior art, the application of Foxo1 in the preparation of drugs for treating liver fibrosis according to the present invention has the following advantages: Foxo1 deficiency in macrophages leads to reduced ROS production, restored mitochondrial biogenesis, and reduced inflammation. Mechanistically, Nrf1 directly binds to Foxo1, inhibiting its transcriptional activity. KLF16, a downstream target gene of Foxo1, is regulated by the Nrf1-Foxo1 complex and is crucial for regulating mitochondrial function and immune responses. The macrophage Nrf1-Foxo1 axis plays a crucial role in controlling mitochondrial function and the progression of liver fibrosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The accompanying drawings, which constitute part of the present invention, are provided to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are provided to explain the present invention and do not constitute an undue limitation of the present invention. In the accompanying drawings: Figure 1 A is a comparison of Nrf1 mRNA expression levels in normal and fibrotic liver tissues detected by qRT-PCR technology in Example 1 of the present invention; Figure 1 BC is the negative correlation between serum ALT values and liver Nrf1 expression in patients with MASH and liver cirrhosis in Example 1 of the present invention; Figure 1D is a double immunofluorescence staining image in Example 1 of the present invention, showing the localization of Nrf1 mainly on macrophages in human fibrotic liver tissue; Figure 1 EG is a comparison of Nrf1 protein levels in liver samples from three different mouse liver fibrosis models (HFD, CCl4, BDL) and their control groups in Example 1 of the present invention; Figure 1 H is a double immunofluorescence staining image in Example 1 of the present invention, comparing the difference in the number of Nrf1+CD68+ macrophages in the liver of fibrosis and control group; Figure 2 A is the expression of Nrf1 in liver macrophages of two mouse models detected by labeling technology in Example 2 of the present invention; Figure 2 B shows the changes in serum ALT and AST levels of the three mice after liver fibrosis induction treatment in Example 2 of the present invention; Figure 2 C is the staining results of HE, Masson, Sirius Red and α-SMA in Example 2 of the present invention, which is used to visually demonstrate the pathological changes and fibrosis degree of the liver tissues of the three mice; Figure 2 DG is the comparison of the expression levels of TGF-β, Col1a1, TIMP1 and type I collagen in three types of mouse liver tissues in Example 2 of the present invention; Figure 3 A is a comparison of the expression levels of TNF-α and IL-1β in fibrotic liver tissue in Example 3 of the present invention; Figure 3 B is Nrf1 in Example 3 of the present invention M-KO Comparison of serum TNF-α and IL-1β levels between mice and control mice; Figure 3 C shows the infiltration of macrophages and neutrophils in fibrotic liver tissue by labeling F4 / 80, CD11b and Ly6G in Example 3 of the present invention; Figure 3 D is the expression changes of iNOS mRNA and Arg1 mRNA in fibrotic liver in Example 3 of the present invention; Figure 3 E is the change in ATP production among different groups in Example 3 of the present invention; Figure 3 F is the difference in mtROS release in Example 3 of the present invention; Figure 3 G is the analysis of the degree of mitochondrial damage in Example 3 of the present invention; Figure 4A is the expression level of Foxo1 mRNA and protein in Example 4 of the present invention; Figure 4 B is the expression of Foxo1 in Example 4 of the present invention; Figure 4 C is the serum ALT and AST levels in Example 4 of the present invention; Figure 4 D is the severity of liver histological lesions and fibrosis in Example 4 of the present invention; Figure 4 EF is the expression level of TNF-α mRNA and iNOS mRNA in Example 4 of the present invention; Figure 4 G is the interruption of ATP generation in Example 4 of the present invention; Figure 4 H is the mtDNA release situation in Example 4 of the present invention; Figure 4 I is the mitochondrial fragmentation in Example 4 of the present invention; Figure 5 A is the relative levels of Nrf1 and Foxo1 in the nucleus of macrophages before and after LPS treatment in Example 5 of the present invention; Figure 5 B is the double immunofluorescence image in Example 5 of the present invention; Figure 5 C is the result of the immunoprecipitation experiment in Example 5 of the present invention; Figure 5 D is the ChIP-seq experimental result in Example 5 of the present invention; Figure 5 E is the ChIP-PCR experimental result in Example 5 of the present invention; Figure 5 F is the result of RNA in situ hybridization experiment in Example 5 of the present invention; Figure 5 GJ are the effects of Foxo1 or Nrf1 deficiency on KLF16, TFAM, ATP production, mDNA copy number, and iNOS expression in Example 5 of the present invention; Figure 6 A shows the changes in TFAM and CytC after KLF16 knockdown in Example 6 of the present invention; Figure 6 B shows the effect of KLF16 knockdown on TFAM, iNOS and ROS levels in Example 6 of the present invention; Figure 6 C shows the effect of KLF16 knockdown on mtDNA leakage in Example 6 of the present invention; Figure 6 D is the comparison of KLF16 knockdown on ATP production in Example 6 of the present invention; Figure 6 E is the effect of KLF16 knockdown on the expression level of IL-1β in Example 6 of the present invention; Figure 6 F is the effect of KLF16 activation on the expression of TFAM and CytC in Example 6 of the present invention; Figure 6 G shows the effect of KLF16 activation on TFAM, iNOS and ROS levels in Example 6 of the present invention; Figure 6 H represents the change in mtDNA copy number caused by KLF16 activation in Example 6 of the present invention; Figure 6 I is the comparison of KLF16 activation and ATP generation in Example 6 of the present invention; Figure 6 J is the effect of KLF16 activation on IL-1β secretion in Example 6 of the present invention; Figure 7 A shows the changes in the activity of mitochondrial respiratory complex I caused by TFAM knockdown in Example 7 of the present invention; Figure 7 B is a comparison of the changes in ATP production caused by TFAM knockdown in Example 7 of the present invention; Figure 7 C shows the change in mtDNA copy number caused by TFAM knockdown in Example 7 of the present invention; Figure 7 D shows the effect of TFAM knockdown on ROS production in Example 7 of the present invention; Figure 7 E is the change in the expression level of pro-inflammatory cytokines mRNA by knockdown of TFAM in Example 7 of the present invention; Figure 7 F shows the changes in iNOS protein expression levels after TFAM knockdown in Example 7 of the present invention; Figure 7 G is the change in the activity of mitochondrial respiratory complex I caused by overexpression of TFAM in Example 7 of the present invention; Figure 7 H is a comparison of the changes in ATP production caused by overexpression of TFAM in Example 7 of the present invention; Figure 7 I represents the change in mtDNA copy number caused by TFAM overexpression in Example 7 of the present invention; Figure 7 J is the effect of TFAM overexpression on ROS production in Example 7 of the present invention; Figure 7 K is the change in protein expression level of iNOS caused by overexpression of TFAM in Example 7 of the present invention; Figure 7L represents the change in the expression level of proinflammatory cytokines mRNA by overexpression of TFAM in Example 7 of the present invention. DETAILED DESCRIPTION

[0018] It should be noted that, in the absence of conflict, the embodiments of the present invention and the features in the embodiments may be combined with each other.

[0019] The present invention will be described in detail below with reference to the accompanying drawings and in conjunction with embodiments.

[0020] The Foxo1 inhibitors described in the present invention include, but are not limited to, inhibitors and antagonists. Any substance that can reduce the activity of Foxo1 protein, decrease the stability of Foxo1 protein, inhibit the expression of Foxo1 protein, prevent the secretion of Foxo1 protein, shorten the effective action time of Foxo1 protein, or inhibit the transcription and translation of Foxo1 can be used in the present invention.

[0021] As a preferred embodiment of the present invention, the Foxo1 inhibitors include (but are not limited to): siRNA (small interfering RNA), shRNA (short hairpin RNA) that can specifically downregulate Foxo1 expression, or CRISPR / Cas9-mediated gene editing tools to achieve Foxo1 gene knockout or mutation. In addition, expression vectors or expression constructs containing specific regulatory sequences that, upon transfection into cells, can result in decreased (preferably, low or absent) Foxo1 expression can also be used. Typically, such expression vectors comprise a gene cassette containing an antisense RNA coding sequence or other negative regulatory element associated with Foxo1 and an expression regulatory sequence operably linked thereto. Here, "operably linked" or "operably linked to" refers to a situation where a portion of a linear DNA sequence can regulate or control the activity of another portion of the same linear DNA sequence, for example, by affecting the transcription efficiency of a coding sequence through a promoter, but in this case, it is used to reduce Foxo1 expression.

[0022] Materials and methods Human liver samples Liver samples were obtained from 30 patients with hemangiomas undergoing liver resection at Tianjin First Central Hospital. Ten of these patients were diagnosed with cirrhosis; 10 were diagnosed with metabolic dysfunction-associated steatohepatitis (MASH). Individuals in the control group had no history of diabetes, alcohol abuse, or viral hepatitis. Pathologists diagnosed liver fibrosis using hematoxylin and Masson staining. Two senior pathologists graded liver fibrosis samples according to an established fibrosis scoring system. The study design and sample collection protocol were approved by the Ethics Committee of Tianjin First Central Hospital. All patients provided written informed consent at the time of recruitment.

[0023] Animal experiments All mice were housed in a specific pathogen-free (SPF) animal facility with controlled temperature and humidity, a 12-h light-dark cycle, and free access to food and water.

[0024] To investigate high-fat diet (HFD)-induced liver fibrosis, 4-week-old male mice were fed either a normal chow diet (NCD) containing 18.3% protein, 10.2% fat, and 71.5% carbohydrates (Research Diets, New Brunswick, Canada) or a HFD diet containing 61.6% protein, 61.6% fat, and 20.3% carbohydrates (Research Diets) for 26 weeks.

[0025] To study carbon tetrachloride (CCl4)-induced liver fibrosis, 6-8 week-old male mice were randomly assigned to receive intraperitoneal injections of either olive oil or CCl4 (10% by volume dissolved in olive oil, at a concentration of 2 mg / kg) twice weekly for 8 weeks.

[0026] To investigate bile duct ligation (BDL)-induced liver fibrosis, 6- to 8-week-old male mice underwent surgical intervention. Mice were anesthetized with isoflurane, and after skin disinfection, a midline abdominal incision was performed. The common bile duct was exposed and ligated with 5-0 non-absorbable sutures. Samples were collected 4 weeks after surgery.

[0027] This study complied with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health.

[0028] Construction of myeloid-specific knockout mice This study used male mice of the following genotypes: wild type (WT), FloxP-Nrf1 (Nrf1 FL / FL )、FloxP-Foxo1(Foxo1 FL / FL ), myeloid cell-specific Nrf1 knockout mice (Nrf1 M-KO ) and myeloid cell-specific Foxo1 knockout mice (Foxo1 M-KO ), all mice were derived on a C57BL / 6 background.

[0029] The floxed Nrf1 (Nrf1 FL / FL ) mice (C57BL / 6JCya-Nrf1 em1flox / Cya) and floxed Foxo1(Foxo1 FL / FL ) mice (C57BL / 6NCya-Foxo1 em1floxCya) purchased from Cyybe Biotechnology Co., Ltd. (Suzhou) and mice expressing Cre recombinase under the control of the Lysozyme 2 (Lyz2) promoter (LysM-Cre; purchased from Cyybe Biotechnology Co., Ltd. (Suzhou)) were used to generate myeloid cell-specific Nrf1 knockout mice (Nrf1 M-KO ) and myeloid cell-specific Foxo1 knockout mice (Foxo1 M-KO ). Generate Nrf1 M-KO The mice were generated in two steps: first, homozygous floxed Nrf1 mice were crossed with homozygous Lyz2-Cre mice to generate F1 mice that were heterozygous for both the Nrf1 allele at the loxP-site and the Lyz2-Cre allele. FL / FL Backcrossing mice ultimately resulted in Nrf1 M-KO Mice (25% of the offspring). These mice are homozygous for the Nrf1 allele at the loxP site and heterozygous for the Lyz2-Cre allele. Foxo1 M-KO Mouse breeding methods and Nrf1 M-KO Mice are bred in a similar manner.

[0030] Isolation, culture, and treatment of primary macrophages To differentiate bone marrow-derived macrophages (BMDMs), recombinant M-CSF (M9170, Sigma-Aldrich) was used. The specific steps are as follows: From euthanized male mice, the femurs and tibias were carefully removed from the laminar flow hood. Bone marrow cells were then flushed from these bones into a container containing DMEM using a 20 mL syringe with a 30 G needle. They were then washed with Roche buffer (11814389001) to remove red blood cells, then rinsed with PBS and cultured in DMEM medium enriched with 20 ng / mL M-CSF and 10% fetal bovine serum (FBS). After four days of culture, the cells were washed with PBS and the medium was replaced with new medium. By day 7, the cells were fully differentiated into BMDMs. Subsequently, BMDMs (1×10 6 ) were transfected with CRISPR KLF6 activation, CRISPR TFAM activation, KLF6-siRNA, TFAM-siRNA, and control vector (SantaCruz Biotechnology) using Lipofectamine according to the manufacturer's instructions (Invitrogen), and the transfected cells were treated with lipopolysaccharide (LPS, 100 ng / ml) for 6 h.

[0031] Experimental results Example 1: Nrf1 expression is reduced in macrophages of fibrotic liver tissue By analyzing 30 human liver samples (including normal and fibrotic liver tissues), qRT-PCR detection showed that the messenger RNA (mRNA) expression of Nrf1 was significantly decreased in fibrotic livers compared with normal livers ( Figure 1 A). Serum alanine aminotransferase (ALT) levels in patients with nonalcoholic steatohepatitis (MASH) or cirrhosis are negatively correlated with Nrf1 expression in liver biopsies ( Figure 1 To determine the specific expression of Nrf1 in different cell types, we used double immunofluorescence staining, and the results showed that Nrf1 was mainly expressed on macrophages in human fibrotic liver ( Figure 1 D). We then assessed Nrf1 protein levels in three mouse models of liver fibrosis, including HFD-induced, CCl4-induced, and BDL-induced. Consistent with the results from human samples, all mouse models showed lower Nrf1 protein levels in fibrotic liver samples compared to controls ( Figure 1 Double immunofluorescence staining further confirmed that the number of Nrf1+CD68+ macrophages in fibrotic livers was significantly less than that in control livers ( Figure 1 H). In summary, our data indicate that Nrf1 is significantly suppressed in fibrotic liver tissue, especially in liver macrophages.

[0032] Example 2: Myeloid-specific Nrf1 knockout can aggravate liver fibrosis To further elucidate the role of Nrf1 in macrophages in liver fibrosis, we used the Cre-LoxP system to create a myeloid-specific Nrf1-KO (Nrf1 M-KO ) mouse model. The experimental results showed that Nrf1 M-KO The expression of Nrf1 in the liver macrophages of mice was successfully knocked out, while in the control group Nrf1 FL / FL In mice, normal expression is maintained ( Figure 2 A) Then, by administering Nrf1 FL / FL and Nrf1 M-KO Mice were induced with HFD, CCl4 injection or BDL surgery to induce liver fibrosis. M-KO In mice, serum ALT (alanine aminotransferase) and AST (aspartate aminotransferase) levels were elevated ( Figure 2 B), indicating that liver cell damage is aggravated. In addition, Nrf1 M-KO Nrf1 FL / FL Mice showed more severe histopathological damage and liver fibrosis, as shown by HE, Masson, Sirius Red, and α-SMA staining results ( Figure 2 C). Further analysis showed that TGF-β, Col1a1, TIMP1 and type I collagen were expressed in Nrf1 M-KO The expression level in the liver tissue of mice was significantly higher than that in the control group of mice, indicating that Nrf1 M-KO Mice had higher levels of liver fibrosis ( Figure 2 DG). Our results indicate that myeloid Nrf1 deficiency exacerbates liver fibrosis in mice.

[0033] Example 3: Myeloid Nrf1 knockout promotes inflammatory response and mitochondrial damage in fibrotic liver Subsequently, we investigated the effect of Nrf1-deficient macrophages on local inflammation in fibrotic liver tissue. M-KO The expression of TNF-α and IL-1β in the liver of mice was significantly increased ( Figure 3 A). In addition, compared with littermate control mice, Nrf1 M-KO The serum levels of TNF-α and IL-1β in mice were higher ( Figure 3 B) To assess the accumulation of inflammatory cells in fibrotic liver tissue, we used macrophage markers F4 / 80 and CD11b and neutrophil marker Ly6G for detection. The results showed that Nrf1 FL / FL Myeloid-specific Nrf1 deficiency significantly aggravated macrophage and neutrophil infiltration in fibrotic livers compared with mice ( Figure 3 C) In Nrf1 M-KO In fibrotic livers of mice, the mRNA expression level of iNOS was upregulated, while the mRNA expression level of Arg1 was downregulated ( Figure 3 D), suggesting that Nrf1 deficiency may promote M1 polarization. In addition, myeloid Nrf1 deficiency exhibited severe mitochondrial dysfunction compared with controls, as evidenced by decreased ATP production ( Figure 3 E), increased mtROS release ( Figure 3 F) and increased mitochondrial damage ( Figure 3 G).

[0034] Example 4: Disruption of myeloid Foxo1 inhibits M1 polarization and mitochondrial dysfunction in fibrotic livers Since the Foxo1 signaling pathway can be activated in acute or chronic hepatitis, we then explored whether the Foxo1 signaling pathway affects the inflammatory response and mitochondrial function in liver fibrosis. First, we detected the expression of Foxo1 in liver fibrosis samples. The experimental results showed that compared with the normal control group, the levels of Foxo1 mRNA and protein in livers with liver fibrosis were significantly increased ( Figure 4 A). With Foxo1 FL / FLUnlike mice, Foxo1 M-KO Foxo1 expression was not shown in mice ( Figure 4 B). In addition, Foxo1 M-KO The serum ALT and AST levels of mice ( Figure 4 C), liver histological lesions and severity of fibrosis ( Figure 4 D) are all inhibited. FL / FL Compared with the control group, the expression of Foxo1 M-KO The mRNA expressions of TNF-α and iNOS in the liver of mice were significantly decreased ( Figure 4 EF), indicating that the inflammatory response in fibrotic livers was improved. M-KO Mitochondrial dysfunction in fibrotic livers of mice was also ameliorated, as evidenced by disrupted ATP production ( Figure 4 G), mtDNA release ( Figure 4 H) and mitochondrial fragmentation ( Figure 4 I).

[0035] Example 5: Nrf1 directly binds to Foxo1 and regulates KLF6 transcription in macrophages To further explore the mechanism of action of macrophage Nrf1 and Foxo1 in regulating liver fibrosis, we extracted nuclear proteins to study the distribution of these two proteins in macrophages under LPS stimulation. The experimental results showed that LPS could induce a decrease in the level of Nrf1 in the nucleus and an increase in Foxo1 ( Figure 5 Double immunofluorescence analysis showed that Nrf1 and Foxo1 colocalized in the nucleus ( Figure 5 B). In addition, immunoprecipitation experiments demonstrated that Nrf1 binds to Foxo1 in macrophages ( Figure 5 C). Subsequently, to explore the potential role of Nrf1-Foxo1 interaction, we performed ChIP combined with massively parallel sequencing (ChIP-Seq) experiments. The results showed that Foxo1 ChIP-seq peaks were detected within the KLF16 gene, one of which was located in the promoter region, and the others were located in introns and exons ( Figure 5 D). To confirm the Foxo1 ChIP-seq peak in the KLF16 promoter region, ChIP-PCR experiments were performed in LPS-stimulated BMDMs using a Foxo1 antibody. After ChIP with the Foxo1 antibody, PCR analysis was performed using specifically designed primers to identify the Foxo1 DNA binding site in the KLF16 promoter ( Figure 5 E).

[0036] In line with the ChIP results, RNA in situ hybridization experiments demonstrated that Foxo1 deficiency enhanced the expression of KLF16 transcripts in LPS-stimulated macrophages. Conversely, disruption of Nrf1 resulted in a decrease in KLF16 transcript levels ( Figure 5 F). Consistently, Foxo1 deficiency reduced the protein expression of KLF16 and TFAM in macrophages, accompanied by decreased ATP production and increased mDNA copy number. In addition, iNOS expression was also lower in Foxo1-deficient macrophages than in controls ( Figure 5 GJ). and Nrf1 FL / FL Unlike macrophages, Nrf1 M-KO promoted the protein levels of KLF16 and TFAM, but reversed mitochondrial damage and inhibited macrophage M1 polarization ( Figure 5 GJ). Taken together, these results suggest that the Nrf1-Foxo1 complex plays an important role in the regulation of its target gene KLF16, which may be involved in energy imbalance and the progression of liver fibrosis.

[0037] Example 6: KLF16 is required for mitochondrial function and M1 polarization regulated by the Nrf1-Foxo1 axis To further determine the effect of KLF16 on mitochondrial function and macrophage M1 polarization regulated by the Nrf1-Foxo1 axis, we generated KLF16 knockdown BMMs. The specific experimental steps were as follows: 1×10 6Bone marrow-derived macrophages (BMDMs) were used for transfection experiments. First, siRNA targeting the KLF16 gene (KLF16-siRNA) (the siRNA sequence is shown in SEQ ID NO. 1, specifically GGGAAAGAAATTATTTATTGTCC) and a control vector (used as a negative control) were prepared according to the manufacturer's instructions (Santa Cruz Biotechnology). Transfections were performed using Lipofectamine 3000 reagent (Invitrogen). Transfection complexes were prepared according to the manufacturer's instructions: an appropriate amount of KLF16-siRNA or control vector was mixed with diluted Lipofectamine and incubated at room temperature for 10-20 minutes to form stable transfection complexes. The complexes were then added to BMDM culture plates, and the cells and transfection reagent were incubated in serum-free medium for 4-6 hours. After incubation, replace the culture medium with fresh complete medium (e.g., DMEM supplemented with 10% FBS) and continue incubating the cells at 37°C in a 5% CO2 incubator. After 24 hours, verify transfection efficiency and KLF16 knockdown efficiency by western blot. A control group (BMDMs transfected with a control vector) should be included in the experiment to ensure specificity and reliability.

[0038] The results showed that KLF16 deficiency led to decreased TFAM and increased CytC ( Figure 6 A), The abundance of TFAM in mitochondria (marker Tom20) was also reduced by KLF16 siRNA intervention ( Figure 6 Furthermore, loss of KLF16 leads to mitochondrial dysfunction, as evidenced by increased mtDNA leakage ( Figure 6 C) Decreased ATP production ( Figure 6 D) and increased ROS production ( Figure 6 B) These phenomena were also observed in Foxo1 knockout BMMs. In addition, KLF16 knockdown significantly aggravated the expression of pro-inflammatory cytokine IL-1β ( Figure 6 E) and iNOS ( Figure 6 B) expression.

[0039] Next, we investigated the effects of KLF16 on mitochondrial biogenesis and inflammatory responses in Nrf1-deficient macrophages. Nrf1-deficient bone marrow-derived macrophages were transfected with a KLF16 activation plasmid and stimulated with LPS. The results showed that KLF16 activation led to increased TFAM protein levels, while CytC expression was suppressed in Nrf1-deficient bone marrow-derived macrophages ( Figure 6F). In particular, KLF16 activation plasmid enhanced the TFAM content in mitochondria ( Figure 6 G). We then determined the role of KLF16 in mitochondrial function and macrophage injury in Nrf1-deficient bone marrow-derived macrophages, demonstrating that KLF16 activation plasmid reversed mtDNA copy number ( Figure 6 H) and ROS generation ( Figure 6 G), while ATP production was restored compared with that in the control Nrf1 knockout cells ( Figure 6 I). Furthermore, KLF16 activation abolished Nrf1 knockout-induced pro-inflammatory IL-1β release ( Figure 6 J) and macrophage M1 polarization ( Figure 6 G). These results confirm that the mitochondrial function of KLF16 is critical for M1 polarization and inflammation regulated by the Nrf1-Foxo1 axis.

[0040] Example 7: TFAM is crucial for maintaining mitochondrial biogenesis and participating in anti-inflammatory innate immunity To further test the functional role of TFAM in regulating mitochondrial biogenesis and innate immunity, we isolated Foxo1 M-KO and Nrf1 M-KO BMMs were isolated from mice. The specific experimental steps were as follows: 1×10 6Bone marrow-derived macrophages (BMDMs) were used for transfection experiments. First, siRNA targeting the TFAM gene (F-siRNA) (the siRNA sequence is shown in SEQ ID NO. 2, specifically GTCTGTATTCCGAAGTGTTTTTC) and a control vector (used as a negative control) were prepared according to the manufacturer's instructions (Santa Cruz Biotechnology). Transfections were performed using Lipofectamine 3000 reagent (Invitrogen). Transfection complexes were prepared according to the manufacturer's instructions: an appropriate amount of TFAM-siRNA or control vector was mixed with diluted Lipofectamine 3000 and incubated at room temperature for 10-20 minutes to form stable transfection complexes. The complexes were then added to BMDM culture plates, and the cells and transfection reagent were incubated in serum-free medium for 4-6 hours. After incubation, replace the culture medium with fresh complete medium (e.g., DMEM supplemented with 10% FBS) and continue incubating the cells at 37°C in a 5% CO2 incubator. After 24 hours, verify transfection efficiency and TFAM gene knockdown efficiency by western blot. A control group (BMDMs transfected with a control vector) should be included in the experiment to ensure specificity and reliability.

[0041] The results showed that siRNA-mediated knockdown of TFAM exacerbated the expression of Foxo1 in LPS-treated M-KO Mitochondrial damage in macrophages, manifested by decreased mitochondrial respiratory complex I activity ( Figure 7 A) Decreased ATP production ( Figure 7 B) Increased mtDNA copy number ( Figure 7 C) and increased ROS release ( Figure 7 D). In addition, we observed that TFAM knockdown enhanced the expression of pro-inflammatory cytokines in macrophages ( Figure 7 E) and iNOS protein levels ( Figure 7 F). However, TFAM overexpression restored mitochondrial function ( Figure 7 GJ), and inhibited pro-inflammatory M1 polarization ( Figure 7 KL).

[0042] in conclusion These experiments demonstrate that Nrf1 / Foxo1 axis-mediated mitochondrial metabolic regulation is crucial for macrophage function regulation in liver fibrosis. Key findings include: (1) Nrf1 expression is reduced in macrophages and negatively correlated with histological damage observed in liver fibrosis; (2) Myeloid Nrf1 deficiency exacerbates M1 polarization, enhances inflammatory responses, and promotes liver fibrosis; (3) Nrf1 directly binds to Foxo1 and inhibits downstream KLF16 transcription in the nucleus; (4) KLF16 is crucial for Nrf1 / Foxo1-regulated mitochondrial energy metabolism, macrophage polarization, and inflammatory responses in fibrotic livers. Our results confirm the key role of Nrf1 in regulating macrophage mitochondrial function and inflammation during liver fibrosis.

[0043] Nrf1 in macrophages enhances mitochondrial protein turnover through the ubiquitin-proteasome system, thereby alleviating mitochondrial stress and inflammation. Our data demonstrate that Nrf1 expression in macrophages is significantly reduced in liver fibrosis tissues from both humans and mice. Furthermore, myeloid Nrf1 deficiency is associated with impaired energy expenditure, M1 polarization, and fibrosis. Our findings highlight the role of Nrf1 in regulating macrophage inflammatory responses in the progression of liver fibrosis.

[0044] We observed that metabolic stress upregulated Foxo1 expression in three different mouse models of liver fibrosis. Furthermore, Foxo1 deficiency in macrophages reduced ROS production, restored mitochondrial biogenesis, and alleviated inflammation.

[0045] Furthermore, Nrf1 can translocate to the nucleus and interact with Foxo1 to regulate the transcription of genes involved in mitochondrial biogenesis. Our in vitro studies showed that the nuclear expression of both Nrf1 and Foxo1 increased upon LPS stimulation. Importantly, Nrf1 interacts with Foxo1 in the nucleus through direct binding. Furthermore, ChIP sequencing and ChIP analysis revealed that Nrf1 and Foxo1 colocalize in the promoter region of KLF16, indicating that KLF16 is a bona fide target gene of Foxo1 and is regulated by the Nrf1-Foxo1 complex. Furthermore, disruption of the Foxo1 signaling pathway reduced KLF16 expression, whereas Nrf1 deficiency enhanced KLF16 transcription. This suggests that Nrf1 functions as a transcriptional co-repressor of Foxo1 in conditions involving mitochondrial dysfunction, macrophage M1 polarization, and inflammation.

[0046] These experiments indicate that Foxo1 represses KLF16 expression by directly interacting with its promoter. Upregulated transcription of KLF16 promotes mitochondrial biogenesis in macrophages.

[0047] Knockdown of KLF16 inhibited TFAM expression, accompanied by impaired mitochondrial function, but increased Foxo1 expression in response to LPS stimulation. M -KO iNOS levels in macrophages. However, KLF16 overexpression positively regulates mitochondrial TFAM levels in response to LPS stimulation of Nrf1 and reduces mtDNA leakage in M-KO macrophages. Consistent with this finding, TFAM disruption leads to reduced mitochondrial DNA content and reduced complex I activity, but promotes macrophage M1 polarization. Finally, TFAM overexpression in macrophages significantly ameliorated mitochondrial dysfunction and inflammatory responses. Taken together, these results reveal a mechanistic link between the KLF16-TFAM axis and mitochondrial stress-dependent innate immune regulation.

[0048] In summary, our study elucidates the functional role of the macrophage Nrf1-Foxo1 signaling pathway in the pathogenesis of liver fibrosis. Our results suggest that macrophage Nrf1 deficiency mediates liver fibrosis by impairing mitochondrial biogenesis and mitochondrial respiratory function. Mechanistically, Nrf1 acts as a transcriptional co-repressor of Foxo1 through direct interaction. The target gene KLF16, regulated by the Nrf1-Foxo1 complex, is crucial for regulating mitochondrial function and immune responses. By elucidating the molecular pathways by which the Nrf1-Foxo1 axis mediates liver inflammation, our findings provide a theoretical foundation for developing personalized therapeutic strategies targeting macrophage-mediated liver inflammatory responses and fibrosis.

[0049] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Use of Foxo1 or its inhibitors, or its downregulators in the preparation of drugs for treating liver fibrosis.

2. Use of Foxo1 or its inhibitor, or its downregulator in the preparation of a drug for inhibiting M1 polarization in fibrotic liver.

3. Use of Foxo1 or its inhibitor, or its downregulator in the preparation of a drug for inhibiting mitochondrial damage in fibrotic liver.

4. The use according to any one of claims 1 to 3, characterized in that: The inhibitor is selected from small molecule compounds or biomacromolecules.

5. The use according to claim 1, characterized in that: The liver fibrosis is caused by cholestasis, viral hepatitis, and fatty liver.

6. A pharmaceutical composition for treating liver fibrosis, characterized in that: The method comprises the Foxo1 inhibitor or Foxo1 downregulator according to any one of claims 1 to 5 and a pharmaceutically acceptable carrier.

7. The pharmaceutical composition for treating liver fibrosis according to claim 6, characterized in that: The dosage form of the pharmaceutical composition is tablet, capsule, suspension, syrup, granule, cream, pill, gel, patch, spray, aerosol, oral solution or injection.

8. Application of Foxo1 as a target in screening drugs for the treatment of liver fibrosis.